The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	153031	277873	8542333	transposase,integrase,protease	Paenibacillus_phage(35.71%)	55	177669:177724	278406:278461
WP_087913513.1|153031_153418_+|protease	clan AA aspartic protease	protease	NA	NA	NA	NA
WP_087913514.1|154682_155615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913515.1|159035_159692_-	VanZ family protein	NA	NA	NA	NA	NA
WP_157685387.1|159912_161862_+	serine hydrolase	NA	A0A2P1JQM9	Mycobacterium_phage	26.5	1.1e-08
WP_087920068.1|161853_162891_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.4	8.3e-08
WP_087913517.1|163722_164385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913518.1|164646_165246_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_087913519.1|165408_165903_+	DinB family protein	NA	NA	NA	NA	NA
WP_169834300.1|166078_166246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834301.1|166318_166459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913520.1|166957_167089_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_087913521.1|167154_167514_-	hydrolase/acyltransferase	NA	NA	NA	NA	NA
WP_087913522.1|167635_168103_+	SprT family protein	NA	NA	NA	NA	NA
WP_087913523.1|168205_168844_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_087913524.1|168863_169298_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087913525.1|169427_170174_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_087913526.1|170220_171147_+	cysteine synthase A	NA	C3U2M1	Lactococcus_phage	53.5	3.3e-80
WP_169834302.1|171595_172162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087920069.1|172685_173591_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_087920070.1|173606_174563_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_169834504.1|174564_175326_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.5	4.7e-16
WP_087913529.1|175332_176034_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	6.4e-12
WP_087913530.1|176202_177402_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
177669:177724	attL	CTTGAGGGGGTAGTGGGTGTATACCCGTGGAGGTTCGAGTCCTCTCTACCGCATAA	NA	NA	NA	NA
WP_087913531.1|178335_179598_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_087913485.1|180141_181380_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.2	4.6e-29
WP_087913532.1|181769_182342_-	antiterminator LoaP	NA	NA	NA	NA	NA
WP_169834303.1|182702_183488_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_087913534.1|183484_185857_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_169834304.1|185870_193826_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_157794184.1|202572_205326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913537.1|205322_219761_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	34.4	1.7e-34
WP_087913538.1|219766_225520_+	hypothetical protein	NA	D0R7J2	Paenibacillus_phage	29.2	9.9e-34
WP_087913539.1|225516_241218_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.1	6.0e-49
WP_169834305.1|241331_244955_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	40.8	2.6e-56
WP_087913541.1|244994_246419_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_087913542.1|246445_246694_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_087913543.1|246671_247910_+	polyketide beta-ketoacyl:ACP synthase	NA	NA	NA	NA	NA
WP_087913544.1|247928_249188_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_087913545.1|249184_249949_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
WP_087913546.1|249986_250745_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_087913547.1|251483_252458_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087913548.1|252488_252878_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_087913549.1|253268_254021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087913550.1|254906_255848_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_087913551.1|255844_256717_-|integrase	tyrosine-type recombinase/integrase	integrase	F8HGP4	Streptococcus_phage	22.7	5.6e-05
WP_157685390.1|256713_256977_-|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	59.3	5.2e-15
WP_087913553.1|259207_262114_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_087913554.1|262106_265346_+	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	28.5	2.9e-06
WP_087913555.1|265556_266618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913556.1|266614_269698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087913557.1|269694_272181_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_087913558.1|272445_273063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087913559.1|273126_274572_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_169834306.1|275402_276380_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	56.0	1.3e-106
WP_157685392.1|276433_277873_-|transposase	transposase	transposase	NA	NA	NA	NA
278406:278461	attR	CTTGAGGGGGTAGTGGGTGTATACCCGTGGAGGTTCGAGTCCTCTCTACCGCATAA	NA	NA	NA	NA
>prophage 2
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	1032479	1113297	8542333	transposase,coat	Bacillus_phage(35.71%)	59	NA	NA
WP_087914107.1|1032479_1033583_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	75.7	8.2e-163
WP_087913723.1|1034323_1035541_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157685441.1|1036169_1036955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834327.1|1036938_1037703_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.4	3.1e-28
WP_087914111.1|1037699_1038629_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	2.4e-22
WP_087914112.1|1038766_1039687_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.4	2.7e-42
WP_087914113.1|1039679_1040372_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087914114.1|1040501_1042118_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	5.2e-49
WP_087914115.1|1042187_1043039_-	DegV family protein	NA	NA	NA	NA	NA
WP_087914116.1|1043777_1044653_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087920127.1|1044740_1046423_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_087914117.1|1046501_1048820_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_087914118.1|1048920_1049583_-	beta-phosphoglucomutase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.3	4.7e-12
WP_087914119.1|1049731_1050769_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_087914120.1|1059271_1061017_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_087914121.1|1061651_1062992_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_087914122.1|1063098_1064415_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_087914123.1|1064411_1065257_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_087914124.1|1065558_1067628_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.8	3.5e-05
WP_087914125.1|1067661_1068600_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_087914126.1|1068700_1070206_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_087920128.1|1070431_1071592_-	sporulation protein YhbH	NA	NA	NA	NA	NA
WP_087914127.1|1071957_1072413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914128.1|1072570_1072981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087914129.1|1073145_1073529_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_087914130.1|1073624_1074140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087914131.1|1074357_1074660_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_087914132.1|1074944_1075406_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	56.9	1.9e-41
WP_087914133.1|1075720_1076503_+	Fe-S cluster assembly ATPase SufC	NA	NA	NA	NA	NA
WP_087914134.1|1076529_1077831_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_087914135.1|1077827_1079054_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.3	8.4e-108
WP_087914136.1|1079040_1079472_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	29.9	3.3e-11
WP_087914137.1|1079496_1080894_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_087914138.1|1081069_1081318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920129.1|1081550_1082102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914139.1|1083241_1085002_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	7.2e-52
WP_087914140.1|1085005_1086868_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.3	4.4e-60
WP_087914141.1|1086976_1087225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087914142.1|1087468_1088326_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_087914143.1|1088517_1090380_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_087914144.1|1090422_1091880_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_087914145.1|1092024_1093575_+	response regulator	NA	NA	NA	NA	NA
WP_087914146.1|1094219_1095182_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_087914147.1|1095197_1096067_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_087914148.1|1096096_1097755_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_087914149.1|1097840_1099583_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_087914150.1|1099586_1100879_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_087914151.1|1101794_1102829_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_087914152.1|1102915_1103620_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_087914153.1|1103790_1105230_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_087914154.1|1105300_1106128_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_087914155.1|1106230_1107334_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_087914156.1|1107503_1108640_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_087914157.1|1108652_1110020_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_087914158.1|1110234_1110549_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_087914159.1|1110658_1111057_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	69.2	6.4e-49
WP_087914160.1|1111213_1112269_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0A8WI33	Clostridium_phage	30.0	9.7e-20
WP_087914161.1|1112801_1113050_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_087914162.1|1113030_1113297_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
>prophage 3
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	1324047	1334063	8542333		Bacillus_phage(66.67%)	9	NA	NA
WP_087914353.1|1324047_1325841_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.9	4.2e-39
WP_087914354.1|1325966_1326695_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.3	1.9e-35
WP_087914355.1|1326762_1327557_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.4	1.1e-15
WP_087914356.1|1327590_1328250_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_087914357.1|1328428_1331092_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.5	5.1e-49
WP_087914358.1|1331144_1331981_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.4	1.9e-18
WP_087914359.1|1332153_1332900_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_087914360.1|1332909_1333503_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_087914361.1|1333499_1334063_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	38.4	1.2e-16
>prophage 4
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	2104909	2117559	8542333	integrase	Paenibacillus_phage(35.71%)	22	2097367:2097381	2111897:2111911
2097367:2097381	attL	GTGCCTTATTATCTG	NA	NA	NA	NA
WP_087914913.1|2104909_2106145_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	61.0	6.8e-150
WP_087914914.1|2106222_2106633_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	40.0	2.2e-12
WP_087914915.1|2106641_2107043_-	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	32.7	5.5e-08
WP_087914916.1|2107139_2107367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087914917.1|2107472_2107766_+	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	58.9	8.6e-27
WP_087914918.1|2107809_2108016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914919.1|2108029_2109148_+	ParB N-terminal domain-containing protein	NA	A0A1D6Z271	Staphylococcus_phage	47.9	1.1e-40
WP_087914920.1|2109147_2109561_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087914921.1|2109557_2109761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914922.1|2109841_2110912_+	replication protein	NA	S5M5Q5	Brevibacillus_phage	34.3	1.3e-40
WP_087914923.1|2110912_2111872_+	ATP-binding protein	NA	S5MU12	Brevibacillus_phage	44.0	7.1e-62
WP_087914924.1|2111877_2113005_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	49.1	3.8e-38
2111897:2111911	attR	GTGCCTTATTATCTG	NA	NA	NA	NA
WP_087914925.1|2113088_2113394_+	hypothetical protein	NA	A0A218KCM5	Bacillus_phage	38.8	6.0e-07
WP_087914926.1|2113396_2113597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914927.1|2113593_2113965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087920197.1|2113987_2114170_-	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	67.5	3.2e-08
WP_157685527.1|2114361_2114535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914928.1|2114597_2115275_+	HNH endonuclease	NA	D0R7I8	Paenibacillus_phage	59.4	8.9e-59
WP_087914929.1|2115286_2115556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087914930.1|2115681_2116857_+	hypothetical protein	NA	Q8W6F2	Sinorhizobium_phage	28.6	3.8e-17
WP_087914931.1|2116920_2117151_+	hypothetical protein	NA	A0A218KCM5	Bacillus_phage	47.1	3.1e-08
WP_087914932.1|2117166_2117559_+	hypothetical protein	NA	A0A160DH61	Gordonia_phage	39.2	1.0e-14
>prophage 5
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	3090653	3099801	8542333		Staphylococcus_phage(42.86%)	9	NA	NA
WP_087915678.1|3090653_3092009_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A286M2S8	Vibrio_phage	23.4	2.7e-06
WP_087915679.1|3092996_3093731_+	hypothetical protein	NA	A0A2H4PQU3	Staphylococcus_phage	45.8	3.9e-76
WP_087915680.1|3093752_3094172_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	61.9	1.3e-44
WP_087915681.1|3094298_3094976_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.9	9.9e-26
WP_087915682.1|3094972_3095983_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	6.7e-10
WP_087915683.1|3096075_3096789_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.9	1.6e-26
WP_087915684.1|3096785_3097571_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087915685.1|3097567_3098326_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_087915686.1|3098811_3099801_+	alpha/beta hydrolase	NA	A0A088FS12	Mycobacterium_phage	30.4	7.5e-06
>prophage 6
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	3381291	3416146	8542333	portal,terminase,plate,capsid,holin,tail	Bacillus_phage(33.33%)	43	NA	NA
WP_087915939.1|3381291_3382437_-|holin	choline esterase	holin	NA	NA	NA	NA
WP_087915940.1|3382549_3383209_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157685616.1|3383944_3384649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920281.1|3384910_3385675_-	HNH endonuclease	NA	C7BGE9	Burkholderia_phage	32.5	8.8e-23
WP_087915942.1|3385679_3386831_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_087915943.1|3386879_3387104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915944.1|3387646_3388330_-	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	60.4	1.5e-42
WP_087915945.1|3388329_3388596_-	hypothetical protein	NA	A0A249XXG8	Clostridium_phage	38.6	1.1e-09
WP_087915946.1|3388602_3388848_-	hemolysin XhlA family protein	NA	A0A1B1P7E0	Bacillus_phage	45.3	1.5e-08
WP_087915947.1|3388946_3389351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915948.1|3389500_3390526_-	acyltransferase	NA	NA	NA	NA	NA
WP_157685618.1|3390617_3390764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915949.1|3390760_3391159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915950.1|3391170_3391677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915951.1|3391692_3392559_-	hypothetical protein	NA	A0A1B0XUH9	Freshwater_phage	57.3	6.7e-19
WP_087915952.1|3392573_3393767_-	hypothetical protein	NA	A0A0A7S1G0	Clostridium_phage	50.9	6.4e-20
WP_087915953.1|3393756_3394080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915954.1|3394082_3394625_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_087915955.1|3394621_3395452_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_087920282.1|3395448_3395793_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_087915956.1|3395878_3396220_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_087915957.1|3396222_3397203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915958.1|3397204_3397864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834295.1|3397868_3399845_-	hypothetical protein	NA	A0A0N7ACN7	Bacillus_phage	62.5	1.3e-17
WP_157685620.1|3400022_3401408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915961.1|3401896_3402307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915962.1|3402377_3402821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915963.1|3402824_3404177_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4J187	uncultured_Caudovirales_phage	29.0	1.1e-20
WP_087915964.1|3404157_3404418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915965.1|3404421_3404889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915966.1|3404885_3405410_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_087915967.1|3405396_3405723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915968.1|3405719_3406106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915969.1|3406083_3406389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915970.1|3406388_3407336_-|capsid	major capsid protein	capsid	H7BVA6	unidentified_phage	32.6	1.2e-32
WP_087915971.1|3407357_3408596_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.4	5.6e-51
WP_157685621.1|3408801_3409590_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_087915973.1|3409770_3410601_-	hypothetical protein	NA	A0A2L0HK45	Gordonia_phage	41.4	5.1e-08
WP_087915974.1|3410593_3412072_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	30.8	3.0e-51
WP_087915975.1|3412075_3413392_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	58.5	1.4e-137
WP_087915976.1|3413378_3414257_-|terminase	terminase	terminase	D2IZ21	Enterococcus_phage	40.3	2.2e-25
WP_087915977.1|3414541_3414751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087915978.1|3414886_3416146_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	44.3	2.4e-86
>prophage 7
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	3462789	3475250	8542333		Paenibacillus_phage(27.27%)	16	NA	NA
WP_087916028.1|3462789_3463881_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	51.5	1.1e-87
WP_157685628.1|3464040_3464214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916029.1|3464214_3466128_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	45.9	2.8e-150
WP_087916030.1|3466124_3466505_-	hypothetical protein	NA	A0A2H4J3D3	uncultured_Caudovirales_phage	50.0	4.4e-23
WP_087916031.1|3466504_3466777_-	hypothetical protein	NA	R9TNJ5	Paenibacillus_phage	51.4	1.4e-10
WP_087916032.1|3466789_3467479_-	hypothetical protein	NA	A0A0C5ABQ1	Bacteriophage	41.5	2.3e-30
WP_087920287.1|3467475_3467673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916033.1|3467868_3468123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916034.1|3468094_3469447_-	hypothetical protein	NA	Q38152	Bacillus_phage	33.9	1.6e-59
WP_157685629.1|3469436_3469808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916036.1|3469755_3470670_-	replication protein	NA	A0A290FZL4	Caldibacillus_phage	41.7	4.6e-18
WP_087916037.1|3470688_3471501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916039.1|3471683_3472022_-	HNH endonuclease	NA	U5PZG9	Bacillus_phage	49.5	1.1e-22
WP_087916040.1|3472021_3472840_-	hypothetical protein	NA	R9TMF6	Paenibacillus_phage	68.4	3.6e-107
WP_087916041.1|3472826_3473615_-	recombinase RecT	NA	H7BUU1	unidentified_phage	53.0	1.8e-66
WP_087916042.1|3473618_3475250_-	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	70.3	2.0e-218
>prophage 8
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	3488174	3515575	8542333	portal,terminase,protease,capsid,holin,head,tail	Bacillus_phage(27.78%)	39	NA	NA
WP_087916067.1|3488174_3489038_+	ATP-dependent DNA ligase	NA	A0A2H4JD86	uncultured_Caudovirales_phage	32.8	6.1e-20
WP_087916068.1|3489118_3489556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916069.1|3489564_3489888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916070.1|3489884_3490103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916071.1|3490116_3490335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916072.1|3490331_3491075_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_157685635.1|3491359_3491899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916074.1|3491895_3493968_-|tail	phage tail protein	tail	A0A0U4B063	Bacillus_phage	46.4	3.7e-124
WP_087916075.1|3493977_3494496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916076.1|3494583_3494862_-|holin	holin	holin	A0A1W6JQK4	Staphylococcus_phage	42.9	4.2e-07
WP_087916077.1|3494875_3495793_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CPP8	Brevibacillus_phage	52.4	2.7e-42
WP_087916078.1|3495792_3496077_-	hemolysin XhlA family protein	NA	A0A2I7QHK4	Enterococcus_phage	37.5	8.1e-06
WP_087914968.1|3496365_3496734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087914967.1|3496745_3497939_-	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	31.9	1.5e-24
WP_169834389.1|3497954_3498806_-	hypothetical protein	NA	A0A0U4IVC6	Arthrobacter_phage	41.7	5.6e-18
WP_087916079.1|3498792_3498990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916080.1|3499004_3499409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916081.1|3499422_3499818_-	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	35.9	1.3e-14
WP_087916082.1|3499830_3500424_-|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	41.1	2.9e-21
WP_087916083.1|3500420_3504905_-|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	49.4	1.1e-83
WP_087916084.1|3504901_3505174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916085.1|3505197_3505545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157685639.1|3505551_3506334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157685641.1|3506351_3506498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916087.1|3506500_3506881_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_087916088.1|3506880_3507306_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_087916089.1|3507305_3507635_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	35.4	3.4e-08
WP_087916090.1|3507631_3507889_-	hypothetical protein	NA	A6XMJ7	Bacillus_virus	44.6	1.6e-08
WP_087916091.1|3507894_3508161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_087916092.1|3508179_3508404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916093.1|3508457_3509597_-|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	69.8	2.9e-139
WP_087916094.1|3509589_3510369_-|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	61.4	8.6e-74
WP_087916095.1|3510361_3511579_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	48.9	3.4e-101
WP_157685643.1|3511588_3513319_-|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	62.2	3.0e-212
WP_087916097.1|3513272_3513647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916098.1|3513988_3514345_-	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	54.4	7.2e-28
WP_157685645.1|3514328_3515021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916100.1|3515043_3515244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916101.1|3515236_3515575_-	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	32.6	3.2e-09
>prophage 9
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	3734198	3783367	8542333	tRNA,terminase,integrase,protease,capsid	Paenibacillus_phage(35.9%)	70	3742482:3742497	3783381:3783396
WP_087916292.1|3734198_3734978_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_087920298.1|3735880_3736648_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_087920299.1|3736647_3737172_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_087916293.1|3737264_3737495_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_087916294.1|3737517_3737790_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_087916295.1|3738124_3739513_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_087916296.1|3739534_3739891_-	YlxM family DNA-binding protein	NA	NA	NA	NA	NA
WP_087916297.1|3740043_3740688_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_087916298.1|3740779_3742297_-	carboxypeptidase M32	NA	NA	NA	NA	NA
3742482:3742497	attL	GGGTAAAGTGCGGGTA	NA	NA	NA	NA
WP_087916299.1|3742529_3742751_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	56.5	2.9e-19
WP_157793863.1|3743114_3743273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916300.1|3743372_3743615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916301.1|3743611_3743845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916302.1|3743907_3744573_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWL7	uncultured_phage	43.6	6.9e-32
WP_087920300.1|3744559_3744838_-	hypothetical protein	NA	A0A249XXG8	Clostridium_phage	38.6	2.0e-09
WP_087916303.1|3744853_3745132_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	37.8	6.9e-10
WP_087916304.1|3745322_3745733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916305.1|3745744_3746938_-	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	31.3	1.1e-27
WP_087916306.1|3746953_3747820_-	hypothetical protein	NA	A0A1B0XUH9	Freshwater_phage	56.9	2.3e-19
WP_087916307.1|3747834_3748608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916308.1|3748561_3748789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916309.1|3748888_3749089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916310.1|3749298_3749523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916311.1|3749545_3750073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916312.1|3750139_3752374_-	hypothetical protein	NA	R9TMD0	Paenibacillus_phage	61.9	5.9e-152
WP_087916313.1|3752378_3752735_-	hypothetical protein	NA	R9TNE7	Paenibacillus_phage	45.3	2.3e-26
WP_087916314.1|3752746_3755770_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	39.1	1.9e-44
WP_087920301.1|3755770_3756097_-	hypothetical protein	NA	M9Q2I4	Clostridium_phage	48.5	8.4e-23
WP_087916315.1|3756122_3756428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916316.1|3756431_3756884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920302.1|3756892_3757279_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	60.9	6.8e-40
WP_087916317.1|3757278_3757671_-	hypothetical protein	NA	M9Q249	Clostridium_phage	47.7	5.9e-23
WP_087916318.1|3757671_3757998_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	62.9	8.9e-33
WP_087916319.1|3757997_3758363_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	47.1	1.5e-20
WP_087916320.1|3758371_3758605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834519.1|3758617_3759496_-|capsid	capsid protein	capsid	M9Q2F4	Clostridium_phage	52.0	4.2e-77
WP_087916322.1|3759505_3760099_-	hypothetical protein	NA	A0A0K2CP96	Brevibacillus_phage	42.6	5.1e-26
WP_087916323.1|3760202_3761333_-|capsid	capsid protein	capsid	M9Q2F2	Clostridium_phage	46.2	8.3e-94
WP_087916324.1|3761329_3762814_-|capsid	capsid protein	capsid	M9Q246	Clostridium_phage	59.0	2.1e-169
WP_087916325.1|3762818_3764213_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	68.8	1.4e-188
WP_087916326.1|3764205_3764952_-|terminase	terminase small subunit	terminase	H2DE31	Erwinia_phage	46.0	6.3e-50
WP_087916327.1|3764973_3765180_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	78.8	9.9e-22
WP_087916329.1|3765622_3766225_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_087916330.1|3766246_3767215_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_169834396.1|3767215_3767374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916331.1|3767363_3767648_-	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	47.0	3.2e-10
WP_169834397.1|3767596_3767818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916332.1|3767821_3768046_-	hypothetical protein	NA	A0A2I7SC31	Paenibacillus_phage	58.1	1.6e-20
WP_087920303.1|3768049_3768448_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	72.3	2.0e-50
WP_087916333.1|3768689_3770942_-	AAA family ATPase	NA	A0A0K2CZ75	Paenibacillus_phage	82.2	0.0e+00
WP_087916334.1|3770960_3771164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916335.1|3771167_3771440_-	hypothetical protein	NA	A0A2H4JG95	uncultured_Caudovirales_phage	73.8	3.6e-27
WP_087920304.1|3771444_3773025_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	86.5	4.2e-269
WP_087916336.1|3773043_3773613_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	64.7	9.4e-62
WP_087916337.1|3773639_3774725_-	ATP-binding protein	NA	A0A2I7SC30	Paenibacillus_phage	66.2	5.1e-133
WP_087916338.1|3774726_3776106_-	AAA family ATPase	NA	Q5YA97	Bacillus_phage	69.6	2.6e-166
WP_087916339.1|3776120_3776831_-	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	80.9	3.5e-106
WP_087920305.1|3776869_3777229_-	replication terminator protein	NA	A0A2I7SC29	Paenibacillus_phage	80.5	1.4e-47
WP_087916340.1|3777455_3778349_-	hypothetical protein	NA	A0A1S7FYZ0	Listeria_phage	57.6	2.8e-92
WP_087916341.1|3778352_3778613_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.8	2.1e-21
WP_087916342.1|3778628_3779327_-	hypothetical protein	NA	A0A2I7SC26	Paenibacillus_phage	53.0	1.9e-72
WP_087916343.1|3779415_3779598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916344.1|3779607_3780186_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	34.7	1.1e-20
WP_157793866.1|3780140_3780305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916345.1|3780301_3780574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916346.1|3780570_3780771_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087916347.1|3780767_3780989_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087916348.1|3781211_3781646_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	45.1	1.1e-25
WP_087916349.1|3781663_3782074_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	50.9	8.6e-25
WP_087916350.1|3782152_3783367_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	33.1	1.9e-43
3783381:3783396	attR	GGGTAAAGTGCGGGTA	NA	NA	NA	NA
>prophage 10
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4023838	4031464	8542333		Bacillus_phage(33.33%)	8	NA	NA
WP_087916557.1|4023838_4024405_-	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	49.7	2.6e-43
WP_157793878.1|4024395_4024545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916558.1|4024937_4026965_-	hypothetical protein	NA	A0A0H3UZI5	Geobacillus_virus	38.0	4.9e-121
WP_087916559.1|4027237_4028182_-	hypothetical protein	NA	A0A0X8WNZ1	Ralstonia_phage	31.6	2.7e-05
WP_087916560.1|4028251_4029472_-	PHP domain-containing protein	NA	A0A0H3UZI5	Geobacillus_virus	47.5	2.9e-108
WP_087916561.1|4029728_4029986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916562.1|4029976_4030921_-	ParM/StbA family protein	NA	S5Y097	Bacillus_phage	25.1	1.6e-18
WP_087920323.1|4031098_4031464_-	hypothetical protein	NA	A0A2R2ZGU6	Clostridioides_phage	29.4	8.0e-06
>prophage 11
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4036486	4051007	8542333	protease	Bacillus_phage(35.71%)	20	NA	NA
WP_087916572.1|4036486_4037332_-	hypothetical protein	NA	A0A0K2CNV8	Brevibacillus_phage	62.7	3.3e-18
WP_087916573.1|4037377_4037659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916574.1|4037829_4038381_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.2	7.5e-24
WP_087916575.1|4038774_4039491_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	60.1	1.3e-76
WP_087920324.1|4039557_4040094_-	HAD family hydrolase	NA	A0A0N9SIY2	Staphylococcus_phage	40.0	7.3e-24
WP_087916576.1|4040140_4041163_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	73.2	2.1e-136
WP_087916577.1|4041137_4043234_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	76.9	0.0e+00
WP_087916578.1|4043226_4043589_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	55.2	9.3e-31
WP_087916579.1|4043594_4044104_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0K0QSK0	Citrobacter_phage	39.8	3.9e-27
WP_087920325.1|4044100_4046317_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	38.5	2.1e-141
WP_087920326.1|4046338_4046584_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	73.8	1.2e-21
WP_087916580.1|4046740_4047217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916581.1|4047264_4047495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916582.1|4047491_4047707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916583.1|4047959_4048286_-	hypothetical protein	NA	A0A088F787	Idiomarinaceae_phage	60.5	4.2e-22
WP_157793882.1|4048343_4048520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916584.1|4048601_4049012_-	hypothetical protein	NA	M4HPW3	Bacillus_phage	44.4	3.6e-23
WP_087916585.1|4049011_4050142_-	hypothetical protein	NA	A0A2R2ZGT9	Clostridioides_phage	47.8	5.0e-91
WP_087916586.1|4050138_4050573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916587.1|4050599_4051007_-	hypothetical protein	NA	O64133	Bacillus_phage	46.9	2.3e-30
>prophage 12
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4061728	4071729	8542333		Bacillus_phage(55.56%)	17	NA	NA
WP_087916609.1|4061728_4062805_-	DNA primase	NA	A0A218KBY7	Bacillus_phage	40.3	1.0e-61
WP_087916610.1|4062840_4064346_-	replication protein	NA	A0A0K2FLE2	Brevibacillus_phage	26.2	1.9e-45
WP_087916611.1|4064356_4064926_-	hypothetical protein	NA	A0A0K2FML1	Brevibacillus_phage	26.7	9.2e-09
WP_157793892.1|4064958_4065183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916613.1|4065266_4065677_-	hypothetical protein	NA	A0A142F137	Bacillus_phage	63.5	6.3e-44
WP_087916614.1|4065892_4066087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916615.1|4066128_4066764_-	hypothetical protein	NA	A0A0K2D0P9	Bacillus_phage	54.2	1.2e-62
WP_087916616.1|4066832_4067093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916617.1|4067105_4067324_-	hypothetical protein	NA	B6V317	Bacillus_phage	60.6	1.7e-19
WP_087916618.1|4067301_4067931_-	hypothetical protein	NA	A0A0K2CP60	Brevibacillus_phage	50.2	6.3e-51
WP_087916619.1|4067974_4068826_-	hypothetical protein	NA	A0A088FAU5	Sulfitobacter_phage	38.7	2.4e-53
WP_087916620.1|4068901_4069177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916621.1|4069187_4069406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916622.1|4069564_4069756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916623.1|4069990_4070278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916624.1|4070413_4070644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916626.1|4070997_4071729_-	nucleotidyltransferase domain-containing protein	NA	A0A127AWL3	Bacillus_phage	45.6	6.2e-50
>prophage 13
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4089611	4097144	8542333		Bacillus_phage(57.14%)	18	NA	NA
WP_087920327.1|4089611_4090250_-	hypothetical protein	NA	A0A0X8WPY3	Ralstonia_phage	28.6	6.9e-05
WP_087916670.1|4090356_4090827_-	hypothetical protein	NA	A0A0D3MVI4	Staphylococcus_phage	30.0	3.0e-13
WP_087916671.1|4090846_4091215_-	hypothetical protein	NA	A0A0K2CPG3	Brevibacillus_phage	43.2	2.8e-19
WP_087916672.1|4091216_4091510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157793905.1|4091551_4091788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916674.1|4091788_4091974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916675.1|4092013_4092253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916676.1|4092253_4092577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916677.1|4092577_4093273_-	HNH endonuclease	NA	A0A1P8CWZ4	Bacillus_phage	36.4	8.3e-28
WP_087916678.1|4093289_4093529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916679.1|4093518_4093791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157793906.1|4093805_4093964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157793907.1|4094002_4094212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157793908.1|4094434_4094971_-	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	45.7	1.4e-30
WP_087916681.1|4094963_4095293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916682.1|4095292_4095796_-	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	43.5	6.2e-09
WP_157793909.1|4095869_4096031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916683.1|4096145_4097144_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	63.4	4.7e-109
>prophage 14
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4135282	4195966	8542333	tail,holin,integrase	Brevibacillus_phage(25.0%)	56	4128380:4128403	4175869:4175892
4128380:4128403	attL	ATATATATGTTTACTTTATAAATT	NA	NA	NA	NA
WP_157793922.1|4135282_4136341_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JJT4	Lactococcus_phage	30.7	6.1e-22
WP_169834406.1|4136737_4136983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916737.1|4137028_4139614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916738.1|4139756_4140080_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	46.2	4.9e-15
WP_087916739.1|4140408_4141599_+	PhoH family protein	NA	A0A0H3UZA8	Geobacillus_virus	42.5	5.9e-82
WP_157793924.1|4141713_4141887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916740.1|4141893_4143213_+	hypothetical protein	NA	A0A0U3TGE6	Bacillus_phage	56.9	2.2e-122
WP_087916741.1|4143272_4143632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916742.1|4143842_4144688_+	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	31.9	8.2e-38
WP_087916743.1|4144691_4146434_+	hypothetical protein	NA	Q331V8	Clostridium_botulinum_C_phage	63.0	1.5e-203
WP_087916744.1|4146479_4148057_+	hypothetical protein	NA	A0A0K2FL40	Brevibacillus_phage	28.7	7.9e-50
WP_157793925.1|4148091_4149663_+	hypothetical protein	NA	A0A0N9RRJ7	Staphylococcus_phage	24.8	7.7e-05
WP_087916746.1|4149698_4150205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916747.1|4150233_4151349_+	hypothetical protein	NA	A0A2R2ZGI2	Clostridioides_phage	27.0	4.7e-25
WP_087916748.1|4151424_4152099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916749.1|4152110_4152539_+	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	33.3	1.0e-15
WP_087916750.1|4152540_4153752_+	hypothetical protein	NA	H7BUZ5	unidentified_phage	25.1	5.3e-14
WP_087916751.1|4153764_4154277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916752.1|4154296_4154773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916753.1|4154769_4155489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916754.1|4155504_4156299_+	hypothetical protein	NA	A0A0K2FL50	Brevibacillus_phage	31.5	2.0e-25
WP_169834407.1|4156381_4157257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916756.1|4157512_4158253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916757.1|4158270_4159302_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087916758.1|4159318_4159804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916759.1|4159793_4160231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916760.1|4160292_4161297_+|integrase	site-specific integrase	integrase	A0A0H3V0P2	Geobacillus_virus	63.2	2.0e-115
WP_087916761.1|4161371_4161791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916762.1|4161858_4163607_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	34.9	2.5e-41
WP_087916763.1|4163734_4164823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916764.1|4164990_4170492_+	C40 family peptidase	NA	A0A0H3V0Q1	Geobacillus_virus	33.7	4.4e-39
WP_087916765.1|4170543_4174971_+|tail	phage tail protein	tail	A0A0K2FLF6	Brevibacillus_phage	27.5	3.4e-151
WP_087916766.1|4175061_4175772_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_087916767.1|4175955_4176792_+	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	42.2	1.2e-49
4175869:4175892	attR	ATATATATGTTTACTTTATAAATT	NA	NA	NA	NA
WP_087916768.1|4176880_4177084_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	34.3	8.0e-08
WP_087916769.1|4177234_4177624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916770.1|4177620_4178364_+	phage antirepressor KilAC domain-containing protein	NA	A0A088C4Y6	Shewanella_sp._phage	29.4	7.3e-14
WP_087916771.1|4178488_4178806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087916772.1|4179079_4179274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157793927.1|4179282_4179654_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_157793928.1|4179764_4180256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916774.1|4180269_4180875_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_087916775.1|4180891_4181527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916776.1|4181538_4182180_+|tail	phage tail family protein	tail	A0A218KCB4	Bacillus_phage	29.4	1.3e-06
WP_087916777.1|4182202_4183354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916778.1|4183384_4183954_+	hypothetical protein	NA	A0A0K2FLS8	Brevibacillus_phage	63.3	2.6e-59
WP_087916779.1|4184367_4184988_+	hypothetical protein	NA	G3MAA3	Bacillus_virus	42.1	1.9e-39
WP_087916780.1|4185007_4185358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916781.1|4185374_4185929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916782.1|4185943_4186582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087916783.1|4186597_4188772_+	discoidin domain-containing protein	NA	A0A0K2FM20	Brevibacillus_phage	26.9	5.6e-22
WP_157793929.1|4188842_4190072_+	discoidin domain-containing protein	NA	G3MAA5	Bacillus_virus	30.4	6.2e-34
WP_087916785.1|4190160_4191366_+	discoidin domain-containing protein	NA	E5ESI2	Bathycoccus_sp._RCC1105_virus	28.9	1.8e-06
WP_157793930.1|4191429_4193493_+	DUF4082 domain-containing protein	NA	A0A0K2FLT7	Brevibacillus_phage	41.1	2.7e-66
WP_087916787.1|4193531_4195454_+	DNRLRE domain-containing protein	NA	A0A0K2FM25	Brevibacillus_phage	26.1	2.7e-52
WP_087920328.1|4195531_4195966_+|holin	phage holin family protein	holin	Q0H258	Geobacillus_phage	41.0	1.6e-16
>prophage 15
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	4402494	4411812	8542333		Staphylococcus_phage(57.14%)	9	NA	NA
WP_087916962.1|4402494_4403721_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	34.7	4.4e-08
WP_087916963.1|4403928_4404384_-	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_087916964.1|4404472_4405186_-	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_087916965.1|4406482_4407088_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.8	9.2e-15
WP_087916966.1|4407056_4407848_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	28.6	4.1e-07
WP_087920341.1|4407983_4408451_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.3	2.5e-44
WP_087916967.1|4408523_4409777_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.4	3.5e-117
WP_087916968.1|4409985_4410654_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.4	5.9e-39
WP_087916969.1|4410696_4411812_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	1.5e-55
>prophage 16
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	6133468	6192933	8542333	transposase,protease	Tupanvirus(40.0%)	42	NA	NA
WP_087918232.1|6133468_6134335_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_087920457.1|6134331_6135384_-|protease	FtsH protease activity modulator HflK	protease	A0A2K9KZA2	Tupanvirus	23.9	1.2e-06
WP_087918233.1|6135569_6135779_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087918234.1|6135819_6136773_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_087918236.1|6137895_6138546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920458.1|6139011_6139803_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_157794036.1|6139892_6140039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918238.1|6140265_6140844_-	RNA 2'-phosphotransferase	NA	G3MA21	Bacillus_virus	45.2	2.8e-37
WP_169834443.1|6140997_6141717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918240.1|6141932_6142592_-	type A chloramphenicol O-acetyltransferase	NA	NA	NA	NA	NA
WP_157794037.1|6142644_6142812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087918241.1|6142942_6143890_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087918242.1|6143938_6144466_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_087918243.1|6144431_6145418_-	phosphotransferase	NA	NA	NA	NA	NA
WP_087918244.1|6145422_6145845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087920459.1|6145907_6146930_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_087918245.1|6148672_6149212_-	hypothetical protein	NA	Q9HH70	Methanothermobacter_phage	33.9	1.9e-16
WP_157794038.1|6149416_6149755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834444.1|6149965_6151120_-	response regulator	NA	NA	NA	NA	NA
WP_087918247.1|6151094_6152924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169834445.1|6153065_6167336_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_087918249.1|6167951_6168449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918250.1|6168426_6168972_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087918251.1|6169767_6171507_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	21.7	7.9e-27
WP_087918252.1|6171716_6172157_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087918253.1|6172785_6173010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918254.1|6173065_6173251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918255.1|6173252_6174383_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087918256.1|6174379_6175534_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087918257.1|6175554_6176517_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	2.1e-29
WP_157794040.1|6176836_6177106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087918258.1|6177778_6181186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918259.1|6181303_6182872_-	TniQ family protein	NA	NA	NA	NA	NA
WP_087918260.1|6182899_6183352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918261.1|6183399_6184341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918262.1|6184452_6186009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087918263.1|6185998_6186550_-	TniQ family protein	NA	NA	NA	NA	NA
WP_087918264.1|6186565_6188281_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_157794041.1|6188286_6189783_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_087918266.1|6189869_6190415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918267.1|6190428_6191232_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087917418.1|6191637_6192933_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	6200624	6242461	8542333	portal,transposase,plate,holin,tail	Clostridium_phage(26.32%)	38	NA	NA
WP_087913645.1|6200624_6201836_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_087918274.1|6202399_6206347_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_157794042.1|6206707_6207793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918276.1|6208070_6208607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918277.1|6208627_6209116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918278.1|6210219_6211488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918279.1|6213085_6214918_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HVL7	Paramecium_bursaria_Chlorella_virus	40.8	3.5e-110
WP_087918280.1|6215484_6216825_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_087918281.1|6216921_6218409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918282.1|6218401_6219232_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_087918283.1|6219539_6220154_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_087918284.1|6220277_6220844_-	RNA polymerase sigma factor SigW	NA	A0A291I9B2	Pseudomonas_phage	28.1	8.0e-05
WP_087918285.1|6221096_6221939_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.9	3.7e-06
WP_087918286.1|6222284_6225077_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_087920460.1|6225277_6225541_-|holin	holin	holin	NA	NA	NA	NA
WP_087918287.1|6225551_6226268_-	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	52.4	4.4e-40
WP_157794045.1|6226239_6226635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918289.1|6226621_6226822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157794046.1|6226824_6227112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918291.1|6227704_6228223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918292.1|6228240_6229758_-	hypothetical protein	NA	S6B1J7	Thermus_phage	37.7	3.2e-08
WP_087918293.1|6229769_6230381_-	YmfQ family protein	NA	S6BFJ0	Thermus_phage	55.2	5.5e-52
WP_169834446.1|6230384_6230723_-|tail	phage tail protein	tail	A0A0A7S181	Clostridium_phage	68.6	1.5e-06
WP_087918294.1|6230735_6231758_-	DUF2793 domain-containing protein	NA	NA	NA	NA	NA
WP_087918295.1|6231759_6232173_-	phosphoglucomutase	NA	A0A0A7S1G0	Clostridium_phage	50.0	8.1e-31
WP_087918296.1|6232175_6233234_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	50.9	1.1e-90
WP_087918297.1|6233226_6233655_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	42.5	2.7e-21
WP_087918298.1|6233651_6233948_-	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	40.4	2.2e-14
WP_087918299.1|6233952_6234915_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	48.1	5.4e-86
WP_087918300.1|6234926_6235628_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CNM3	Brevibacillus_phage	41.9	8.0e-47
WP_087918301.1|6235629_6237684_-	hypothetical protein	NA	S5MNW9	Brevibacillus_phage	27.8	1.8e-30
WP_087918302.1|6237878_6238301_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.4	2.1e-10
WP_087918303.1|6238386_6238857_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	58.3	1.2e-46
WP_087918304.1|6238858_6240181_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0K2CNL4	Brevibacillus_phage	47.9	2.2e-106
WP_087918305.1|6240235_6240415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918306.1|6240411_6240825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087918307.1|6241214_6241727_-	transcriptional regulator	NA	A0A0C5AJ96	Bacteriophage	61.2	3.5e-39
WP_087918308.1|6242008_6242461_+	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	41.8	1.4e-20
>prophage 18
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	7431223	7438262	8542333		Paramecium_bursaria_Chlorella_virus(33.33%)	9	NA	NA
WP_087919233.1|7431223_7432252_+	agmatine deiminase family protein	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	38.3	3.3e-65
WP_087919234.1|7432294_7433170_+	N-carbamoylputrescine amidase	NA	M1GUG4	Paramecium_bursaria_Chlorella_virus	48.5	4.3e-74
WP_087919235.1|7433411_7434227_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087919236.1|7434312_7434960_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_087920529.1|7434974_7435697_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	4.0e-25
WP_087919237.1|7435852_7436299_+	tellurite resistance TerB family protein	NA	A0A1Y0T181	Sinorhizobium_phage	29.5	8.8e-07
WP_087919238.1|7436424_7437021_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	35.0	1.9e-25
WP_087919239.1|7437051_7437627_+	TerD family protein	NA	NA	NA	NA	NA
WP_087919240.1|7437680_7438262_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	36.1	1.5e-27
>prophage 19
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	7567909	7649506	8542333	portal,tRNA,transposase,terminase,integrase,protease,capsid,head,tail	Bacillus_phage(21.88%)	88	7581800:7581846	7619542:7619588
WP_087919343.1|7567909_7569208_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	30.1	1.9e-49
WP_087919344.1|7569621_7570176_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_087919345.1|7570677_7572207_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_087919346.1|7572818_7573850_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	47.0	4.3e-89
WP_087919347.1|7574120_7576454_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0Y0AS84	Bacillus_phage	60.8	3.5e-256
WP_087919348.1|7576510_7577026_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2H5BH04	Vibrio_virus	41.9	4.1e-32
WP_087920538.1|7577022_7579008_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2R2ZH54	Clostridioides_phage	38.9	2.2e-129
WP_087919349.1|7579771_7580080_+	MTH1187 family thiamine-binding protein	NA	NA	NA	NA	NA
WP_087919350.1|7580084_7580441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919351.1|7580418_7581273_+	beta-ketoacyl synthase	NA	NA	NA	NA	NA
7581800:7581846	attL	CGCACTCGTAATGCGTAGGCCGGGGGTTCAATTCCCTTCACCAGCAT	NA	NA	NA	NA
WP_087919352.1|7581926_7583159_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.5	3.3e-51
WP_087919353.1|7583264_7583594_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087919354.1|7583761_7583977_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087919355.1|7584180_7584918_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087919356.1|7585104_7585374_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_157794119.1|7585401_7585614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794120.1|7585768_7586023_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	40.9	2.5e-06
WP_087919359.1|7586019_7586310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919360.1|7586306_7586528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919362.1|7586782_7587085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834477.1|7587111_7587336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919363.1|7587340_7588150_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_087919364.1|7588127_7588475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919365.1|7588440_7589811_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	46.0	3.4e-89
WP_169834478.1|7589822_7589981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794121.1|7589980_7590157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794122.1|7590183_7590351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169834479.1|7590430_7590580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919366.1|7590576_7590942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919367.1|7590944_7591184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919368.1|7591353_7591818_+	hypothetical protein	NA	R9TNM5	Paenibacillus_phage	35.5	2.1e-11
WP_087919369.1|7591908_7592223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919370.1|7592290_7592725_+	hypothetical protein	NA	S5MUP2	Brevibacillus_phage	52.2	1.3e-15
WP_087919371.1|7592895_7593372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087920540.1|7593670_7593979_+	hypothetical protein	NA	A0A0S2MUH2	Bacillus_phage	67.5	2.6e-26
WP_157794123.1|7593968_7594121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794124.1|7594107_7594260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919372.1|7594284_7594776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919374.1|7595047_7595443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919375.1|7595439_7595649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919376.1|7595742_7596120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919377.1|7596542_7597103_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	45.6	2.9e-39
WP_157794125.1|7597346_7598093_+	hypothetical protein	NA	D2IZ90	Enterococcus_phage	34.4	5.1e-15
WP_087919379.1|7598092_7598776_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_087919380.1|7598915_7599242_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	31.7	6.4e-07
WP_087919381.1|7599238_7600951_+|terminase	terminase	terminase	A0A290GJW3	Caldibacillus_phage	30.6	6.7e-79
WP_087920541.1|7601018_7602215_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	29.9	9.5e-40
WP_087920542.1|7602201_7602849_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0F7L115	uncultured_marine_virus	39.3	2.2e-22
WP_087919382.1|7602860_7604147_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_087919383.1|7604469_7604742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919384.1|7604738_7605059_+|head	phage head closure protein	head	R9TPZ2	Paenibacillus_phage	41.5	1.0e-09
WP_087919385.1|7605051_7605441_+	HK97 gp10 family phage protein	NA	W8CZ44	Bacillus_phage	39.8	1.3e-14
WP_087919386.1|7605437_7605812_+	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	45.2	9.6e-23
WP_157794126.1|7605814_7606699_+	Ig-like domain-containing protein	NA	A0A0K2CZP8	Paenibacillus_phage	43.5	2.2e-33
WP_087919387.1|7606774_7607089_+	hypothetical protein	NA	E2ELJ2	Clostridium_phage	34.0	4.4e-05
WP_169834480.1|7607118_7607259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919388.1|7607270_7611833_+|tail	phage tail tape measure protein	tail	A0A0S2SXL7	Bacillus_phage	30.4	2.1e-66
WP_087919389.1|7611832_7612636_+|tail	phage tail family protein	tail	A0A290FZP5	Caldibacillus_phage	30.8	5.6e-28
WP_087919390.1|7612651_7614661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157794128.1|7614647_7615253_+	transferase	NA	NA	NA	NA	NA
WP_087919392.1|7615435_7617145_+|tail	phage tail protein	tail	W8EEW0	Geobacillus_phage	24.9	7.5e-14
WP_087919393.1|7617190_7617748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919394.1|7617812_7618016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087919395.1|7618099_7618384_+	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_087919396.1|7618388_7618655_+	hypothetical protein	NA	A0A2H4JAH4	uncultured_Caudovirales_phage	37.7	3.4e-06
WP_087919397.1|7618654_7619362_+	N-acetylmuramoyl-L-alanine amidase	NA	R9TQ04	Paenibacillus_phage	62.8	4.1e-83
WP_157794129.1|7619897_7621694_+	histidine kinase	NA	NA	NA	NA	NA
7619542:7619588	attR	CGCACTCGTAATGCGTAGGCCGGGGGTTCAATTCCCTTCACCAGCAT	NA	NA	NA	NA
WP_169834481.1|7621671_7622811_+	response regulator	NA	NA	NA	NA	NA
WP_087919400.1|7622977_7624618_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_087919401.1|7624658_7625549_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_087919402.1|7625585_7626464_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_087919403.1|7626477_7627347_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_087919404.1|7627485_7627887_-	hypothetical protein	NA	A0A0N9SIM5	Paenibacillus_phage	35.5	1.0e-14
WP_169834539.1|7632054_7632222_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_087920543.1|7632844_7633810_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_087919406.1|7634601_7634991_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_087919407.1|7634974_7635538_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_087919408.1|7635554_7636412_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.3	1.3e-27
WP_087919409.1|7636402_7637302_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	33.0	5.7e-21
WP_087919410.1|7637298_7638090_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_087919411.1|7638128_7640054_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.6	4.5e-15
WP_087919412.1|7640193_7641495_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.8	3.0e-31
WP_087919413.1|7641481_7642363_+	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_087919414.1|7643438_7644419_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_087919415.1|7644437_7644887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087919416.1|7645078_7646959_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087919417.1|7647005_7647923_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_087913645.1|7648294_7649506_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP021780	Paenibacillus donghaensis strain KCTC 13049 chromosome, complete genome	8542333	7813680	7825751	8542333		Mollivirus(25.0%)	9	NA	NA
WP_087919545.1|7813680_7814976_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	28.1	1.4e-23
WP_087919546.1|7815573_7816464_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	33.4	4.9e-41
WP_036680912.1|7816606_7816852_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	36.7	3.7e-07
WP_087919547.1|7816857_7817547_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_087919548.1|7817524_7819771_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.2	5.4e-169
WP_087919549.1|7819755_7821252_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	2.0e-50
WP_087919551.1|7822501_7823542_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.6	1.9e-68
WP_087919552.1|7823541_7824156_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	5.4e-23
WP_087919553.1|7824203_7825751_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.3	4.1e-75
