The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	318488	332779	3856634	tail	Organic_Lake_phycodnavirus(100.0%)	13	NA	NA
WP_038245127.1|318488_318938_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038245112.1|318975_320046_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_038245109.1|320069_321470_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_004721430.1|321537_322767_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_004721429.1|322782_323241_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_038245105.1|323237_323420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245103.1|323416_324109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245100.1|324105_325722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004721421.1|325731_326154_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_038245097.1|326150_326576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004721418.1|326607_328896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245091.1|328892_331769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004721414.1|331822_332779_+|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	29.7	5.3e-09
>prophage 2
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	1306366	1344854	3856634	terminase,capsid,integrase,lysis,holin,transposase	Escherichia_phage(25.0%)	49	1300025:1300042	1336568:1336585
1300025:1300042	attL	GCGGCTGGCGATTATCGT	NA	NA	NA	NA
WP_038244061.1|1306366_1307356_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.6	3.8e-103
WP_071665719.1|1307342_1307603_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_038244308.1|1307686_1308112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038244059.1|1308248_1309829_-	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	47.1	4.5e-106
WP_051847044.1|1309815_1310661_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.1	5.8e-68
WP_038244056.1|1310653_1310932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071665720.1|1310961_1311762_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	55.7	1.2e-41
WP_038244052.1|1311812_1312082_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	43.4	1.2e-11
WP_038244048.1|1312165_1312411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071665721.1|1312973_1313666_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_038244045.1|1313651_1313882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038244042.1|1313894_1314566_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	38.2	1.6e-28
WP_038244039.1|1314675_1314954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038244038.1|1314957_1315320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051847039.1|1315316_1315499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051847036.1|1315507_1316365_+	hypothetical protein	NA	I6NW17	Burkholderia_virus	51.0	3.3e-34
WP_038244036.1|1316367_1317141_+	hypothetical protein	NA	H2DE84	Erwinia_phage	52.5	6.8e-47
WP_038244033.1|1317144_1318281_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	6.8e-96
WP_038244031.1|1318280_1318466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080717341.1|1318434_1318911_+	hypothetical protein	NA	A0A2H5BG54	Pseudoalteromonas_phage	50.7	8.2e-35
WP_071666668.1|1318907_1319555_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.2	6.3e-14
WP_038245993.1|1319556_1319880_+	DUF1364 domain-containing protein	NA	A0A223LHA7	Pseudoalteromonas_phage	44.9	1.2e-13
WP_038245992.1|1319951_1320884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245990.1|1320880_1321348_+	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	32.8	1.6e-11
WP_071665758.1|1321391_1321721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038246024.1|1321742_1322354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245245.1|1322479_1323283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245248.1|1323647_1323860_+|holin	holin	holin	H9C183	Pectobacterium_phage	70.0	7.8e-22
WP_087931043.1|1323859_1324348_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	59.4	5.8e-52
WP_051847055.1|1324474_1324999_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	44.9	2.0e-10
WP_038245250.1|1325028_1325886_+|terminase	small subunit bacteriophage terminase	terminase	A0A1I9KFG9	Aeromonas_phage	40.0	3.9e-43
WP_051847060.1|1325924_1327589_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	70.5	3.5e-234
WP_038245254.1|1327588_1329715_+	hypothetical protein	NA	A0A0P0ZG74	Escherichia_phage	67.8	2.2e-252
WP_038245256.1|1329740_1329944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245257.1|1329986_1331018_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	41.8	6.7e-58
WP_038245259.1|1331204_1332428_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	74.3	7.4e-173
WP_038245261.1|1332504_1332888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245263.1|1332942_1333377_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	50.3	5.5e-30
WP_038245265.1|1333379_1333967_+	hypothetical protein	NA	A0A2I7RNR3	Vibrio_phage	31.6	7.3e-17
WP_038245267.1|1333966_1334620_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	58.6	2.9e-67
WP_071665709.1|1334616_1336758_+	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	37.3	3.6e-29
1336568:1336585	attR	ACGATAATCGCCAGCCGC	NA	NA	NA	NA
WP_087931044.1|1337194_1337611_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.3	1.8e-41
WP_038245968.1|1339044_1340673_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	56.2	3.5e-178
WP_038245970.1|1340669_1341884_+	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	48.2	6.6e-105
WP_087931045.1|1341950_1342979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087931046.1|1342953_1343328_+	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	53.8	6.2e-30
WP_038245427.1|1343560_1344208_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	51.7	2.7e-49
WP_038245425.1|1344210_1344594_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	56.0	1.7e-30
WP_038245423.1|1344593_1344854_+	hypothetical protein	NA	A0A1I9KFI4	Aeromonas_phage	50.0	7.4e-06
>prophage 3
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	1574026	1655121	3856634	terminase,protease,capsid,integrase,holin,transposase	Escherichia_phage(18.6%)	85	1629129:1629144	1634549:1634564
WP_038243350.1|1574026_1574296_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.4	4.5e-14
WP_038243351.1|1574652_1575165_-	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	71.2	3.7e-73
WP_038243353.1|1575422_1575677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243354.1|1575673_1576210_-	hypothetical protein	NA	A0A2D1GNV6	Pseudomonas_phage	46.2	7.0e-43
WP_051847014.1|1576209_1576689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243357.1|1576685_1576922_-	hypothetical protein	NA	A0A248SL48	Klebsiella_phage	66.2	3.8e-17
WP_038243358.1|1576918_1577254_-	hypothetical protein	NA	A0A248SKX5	Klebsiella_phage	40.4	3.5e-16
WP_051847017.1|1577267_1578071_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	36.9	5.1e-45
WP_038243361.1|1578159_1578588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243363.1|1578584_1579724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243366.1|1579768_1581373_-	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	52.5	2.5e-112
WP_087931105.1|1581359_1582163_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.4	2.4e-71
WP_051847015.1|1582529_1583162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243372.1|1583150_1583441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243374.1|1583499_1583760_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	45.7	1.3e-13
WP_038243377.1|1583835_1584081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243379.1|1584602_1585217_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_038243382.1|1585227_1585914_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	53.4	8.7e-62
WP_038243385.1|1586044_1586290_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	64.4	2.3e-17
WP_038243388.1|1586371_1586677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243391.1|1586762_1587125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243394.1|1587121_1587301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243397.1|1587309_1588155_+	hypothetical protein	NA	H2DE83	Erwinia_phage	42.9	4.7e-41
WP_038243398.1|1588157_1588931_+	hypothetical protein	NA	H2DE84	Erwinia_phage	52.5	5.2e-47
WP_038243401.1|1588934_1590071_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	61.0	3.4e-95
WP_038243404.1|1590070_1590427_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	43.4	3.9e-05
WP_038243407.1|1590419_1591085_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	68.1	2.7e-84
WP_087931051.1|1591081_1591729_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.2	9.8e-15
WP_038245410.1|1591739_1592174_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	38.1	3.0e-12
WP_071665737.1|1592166_1592475_+	DUF1364 domain-containing protein	NA	A0A2I7RNU4	Vibrio_phage	47.8	6.5e-17
WP_038245411.1|1592497_1593088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051847065.1|1593125_1593593_+	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	31.1	3.6e-11
WP_038246022.1|1593636_1593966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038246024.1|1593987_1594599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245275.1|1594724_1595534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245276.1|1595706_1595919_+|holin	holin	holin	H9C183	Pectobacterium_phage	71.4	5.4e-23
WP_087931052.1|1595918_1596407_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	62.5	6.2e-54
WP_038245278.1|1596538_1597081_+	DUF2570 domain-containing protein	NA	H9C185	Pectobacterium_phage	39.1	5.3e-14
WP_051847063.1|1597077_1597422_+	hypothetical protein	NA	W8EHJ5	Vibrio_phage	72.4	1.5e-33
WP_038245280.1|1597487_1598345_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	42.0	6.4e-46
WP_087931053.1|1598382_1600047_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	70.7	2.4e-235
WP_038245283.1|1600046_1602173_+	hypothetical protein	NA	A0A0P0ZG74	Escherichia_phage	68.2	1.1e-256
WP_038245284.1|1602443_1603493_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	43.2	1.2e-62
WP_038245287.1|1603553_1604777_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	75.1	3.0e-174
WP_038245289.1|1604839_1605223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038245291.1|1605277_1605718_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	49.7	1.1e-28
WP_038245293.1|1605720_1606308_+	hypothetical protein	NA	A0A088CE76	Shigella_phage	38.5	4.0e-31
WP_038245295.1|1606307_1606961_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	58.1	2.2e-67
WP_087931054.1|1606957_1609327_+	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	31.0	1.2e-28
WP_087931055.1|1610036_1611124_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	1.7e-43
WP_038246006.1|1611350_1612979_+	hypothetical protein	NA	A0A0P0ZG21	Escherichia_phage	56.6	8.4e-180
WP_038246004.1|1612975_1614190_+	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	50.7	3.7e-108
WP_087931056.1|1614256_1615285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087931057.1|1615259_1615634_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	53.8	1.3e-30
WP_038242749.1|1615889_1616549_+	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	54.6	1.4e-48
WP_038242747.1|1616551_1616935_+	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	58.4	1.5e-31
WP_038242746.1|1616934_1617195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242745.1|1617207_1618596_+	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	26.6	2.6e-20
WP_051847002.1|1619097_1627338_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	29.5	4.0e-270
WP_038242744.1|1627573_1628935_-	hypothetical protein	NA	NA	NA	NA	NA
1629129:1629144	attL	CTCGCTCATAACTGCC	NA	NA	NA	NA
WP_038242742.1|1629670_1629919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242741.1|1629940_1630594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242740.1|1630598_1630814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242739.1|1630829_1631012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242738.1|1631260_1631644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038242737.1|1632014_1632227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038242736.1|1632491_1633100_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	45.8	8.8e-42
WP_038242735.1|1633218_1634364_-	CMY2/MIR/ACT/EC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_038242734.1|1635104_1635791_-	hypothetical protein	NA	NA	NA	NA	NA
1634549:1634564	attR	CTCGCTCATAACTGCC	NA	NA	NA	NA
WP_004721714.1|1635997_1636627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051847005.1|1637809_1638217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038242732.1|1638756_1638936_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_038242730.1|1639747_1640419_+	membrane protein	NA	NA	NA	NA	NA
WP_004721705.1|1640425_1640794_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_038242727.1|1640790_1641450_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_004721700.1|1641976_1642210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004721697.1|1642879_1643278_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004721695.1|1643397_1643640_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_004721693.1|1643750_1645460_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_038242725.1|1646374_1649005_-	PqiB family protein	NA	NA	NA	NA	NA
WP_038242723.1|1648973_1650221_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_004723359.1|1650560_1651058_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004723358.1|1651153_1651867_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_004723357.1|1651886_1653926_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.2	2.3e-86
WP_004723356.1|1654236_1655121_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	1674064	1692728	3856634	plate,tRNA,integrase	Tupanvirus(25.0%)	17	1681425:1681448	1686089:1686112
WP_004717744.1|1674064_1675993_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	1.0e-128
WP_002227898.1|1675996_1676548_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_002211834.1|1676646_1676844_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004717737.1|1676881_1677238_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004717736.1|1677718_1678702_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.0	1.2e-35
WP_004717734.1|1678716_1681104_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	5.1e-08
WP_004717732.1|1681108_1681405_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
1681425:1681448	attL	GGCCGCGCAAGCGGCCTTTTCCTT	NA	NA	NA	NA
WP_038242701.1|1681548_1682154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004717723.1|1683181_1683841_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	47.2	5.1e-43
WP_004717719.1|1684538_1684727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038242696.1|1684820_1685438_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	42.5	3.0e-37
WP_051847000.1|1685659_1685947_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	61.3	2.0e-28
WP_004717712.1|1686292_1687300_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
1686089:1686112	attR	GGCCGCGCAAGCGGCCTTTTCCTT	NA	NA	NA	NA
WP_038242694.1|1687462_1688224_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	27.0	3.0e-07
WP_038242692.1|1688603_1689758_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.3	2.8e-20
WP_038242690.1|1689744_1690725_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	33.0	2.2e-34
WP_038242688.1|1690724_1692728_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	24.6	7.0e-19
>prophage 5
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	2130324	2201487	3856634	protease,terminase,head,capsid,integrase,tRNA,tail,holin,transposase,portal	Yersinia_phage(31.91%)	74	2151199:2151258	2197732:2197916
WP_038242469.1|2130324_2130654_-|protease	AprI/Inh family metalloprotease inhibitor	protease	NA	NA	NA	NA
WP_004720585.1|2131043_2132477_-|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004720582.1|2133486_2134899_-	anion permease	NA	NA	NA	NA	NA
WP_038242279.1|2135980_2137612_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_038242277.1|2137604_2138324_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_038251223.1|2138654_2139863_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	79.1	2.1e-183
WP_038275327.1|2139886_2140303_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	1.6e-42
WP_051847067.1|2142080_2142653_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	3.4e-11
WP_038245618.1|2143128_2145300_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.6	1.4e-25
WP_004719050.1|2145512_2146949_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_038245616.1|2147895_2148546_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_004719049.1|2148526_2149270_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087931055.1|2149850_2150937_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	1.7e-43
2151199:2151258	attL	TTTATCAAACTATCAATATCACATATGCTTAATAATAGCGTTACCAAACTCTGAACATTT	NA	NA	NA	NA
WP_038244025.1|2152347_2152896_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038244021.1|2153009_2153900_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_038244017.1|2154202_2154952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087931062.1|2155112_2157284_-	hypothetical protein	NA	Q7Y3Z0	Yersinia_phage	72.7	1.6e-37
WP_038245552.1|2157296_2158322_-	hypothetical protein	NA	Q7Y3Z1	Yersinia_phage	70.5	8.5e-138
WP_038245551.1|2158332_2160876_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	82.2	0.0e+00
WP_038245550.1|2160868_2161270_-	hypothetical protein	NA	Q7Y3Z5	Yersinia_phage	73.7	1.9e-56
WP_038245548.1|2161289_2161919_-	hypothetical protein	NA	A0A0A7S0D9	Clostridium_phage	35.8	5.2e-05
WP_038245546.1|2162024_2162609_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	83.5	8.4e-90
WP_038245545.1|2162608_2163205_-	hypothetical protein	NA	Q7Y3Z8	Yersinia_phage	83.8	9.4e-97
WP_038245544.1|2163208_2166487_-|tail	phage tail tape measure protein	tail	Q7Y400	Yersinia_phage	66.0	0.0e+00
WP_038245543.1|2166479_2166695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245541.1|2166715_2167087_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	58.5	2.9e-35
WP_038245539.1|2167095_2167380_-	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	64.9	1.7e-24
WP_038245537.1|2167355_2167808_-|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	80.7	9.1e-68
WP_038245535.1|2167847_2168252_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	71.1	2.2e-44
WP_038245534.1|2168248_2168638_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	57.9	1.3e-35
WP_038245532.1|2168618_2168969_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	65.8	1.7e-37
WP_038245530.1|2168968_2169298_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	67.6	1.3e-34
WP_038245529.1|2169278_2169545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087931063.1|2169607_2170891_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	72.2	3.4e-168
WP_087931064.1|2170959_2171874_-	S49 family peptidase	NA	Q7Y411	Yersinia_phage	67.8	4.1e-107
WP_038245525.1|2172016_2173276_-|portal	phage portal protein	portal	Q7Y412	Yersinia_phage	72.7	4.8e-175
WP_038245523.1|2173275_2173455_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	1.7e-09
WP_038245521.1|2173448_2175173_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	78.1	1.4e-273
WP_038245517.1|2175169_2175640_-|terminase	phage terminase small subunit P27 family	terminase	A0A1V0E8B7	Vibrio_phage	57.7	2.0e-46
WP_038245509.1|2175758_2176109_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	68.1	2.4e-44
WP_038245507.1|2176230_2176755_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	55.2	3.5e-47
WP_038277302.1|2177138_2177366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717352.1|2177340_2177625_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_071665706.1|2177681_2178305_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	65.7	7.9e-70
WP_071708424.1|2178308_2178653_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	61.0	5.9e-27
WP_038243002.1|2178910_2179471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243004.1|2179666_2180545_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_038243006.1|2180823_2181912_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	62.5	8.5e-128
WP_038243008.1|2182279_2183098_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	43.9	2.0e-57
WP_038243010.1|2183155_2184157_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	47.9	6.4e-90
WP_038243013.1|2184153_2184975_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	61.7	2.1e-91
WP_038243015.1|2185064_2185763_-	antirepressor	NA	A0A1P8DTE1	Proteus_phage	54.6	8.8e-54
WP_038243017.1|2185856_2186234_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	65.3	6.7e-40
WP_080717335.1|2186224_2188240_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	50.7	1.2e-124
WP_038243019.1|2188236_2189256_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	73.1	9.6e-33
WP_038243030.1|2189252_2189432_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_038243031.1|2189433_2189616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243032.1|2189612_2190149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080717336.1|2190154_2190442_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	77.5	1.3e-22
WP_038243035.1|2190548_2191268_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.5	6.2e-87
WP_038243038.1|2191335_2192493_+	type I restriction enzyme R protein	NA	A0A1S5SAB0	Streptococcus_phage	27.7	1.2e-31
WP_005174523.1|2192807_2193068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243042.1|2193064_2193298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243065.1|2193582_2193957_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	73.1	2.0e-44
WP_038243066.1|2194015_2194843_+	YfdQ family protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	60.0	2.0e-89
WP_038243067.1|2194931_2195468_+	hypothetical protein	NA	A5LH62	Enterobacteria_phage	60.8	1.6e-55
WP_038243068.1|2195464_2195647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243069.1|2195647_2196217_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	67.2	1.7e-66
WP_071665738.1|2196273_2196525_+	excisionase	NA	NA	NA	NA	NA
WP_038243074.1|2196499_2197627_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	59.2	7.2e-122
WP_004719048.1|2197749_2199003_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
2197732:2197916	attR	TTTATCAAACTATCAATATCACATATGCTTAATAATAGCGTTACCAAACTCTGAACATTTCAGTAACTTAGCGCCTTCCATCAAACGTTCGAAGTCGTAAGTTACAGTCTTGGCCTGAATCGCGCCTTCAGTGCCTTTAATGATTAAATCAGCGGCTTCAGTCCAGCCCATATGACGCAGCATCA	NA	NA	NA	NA
WP_004719047.1|2199134_2199761_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_038241663.1|2199753_2200200_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004719044.1|2200371_2201487_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	2353411	2362965	3856634	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004717331.1|2353411_2355136_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	2.0e-14
WP_004717329.1|2355235_2355946_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2356109_2356328_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004717327.1|2356583_2358860_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	3.3e-166
WP_004717325.1|2358887_2359208_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	1.8e-14
WP_004717324.1|2359567_2359789_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	4.6e-17
WP_004717322.1|2359900_2361850_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.3	7.2e-37
WP_038241510.1|2361849_2362965_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	1.9e-10
>prophage 7
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	2594971	2716427	3856634	terminase,protease,head,tRNA,capsid,integrase,tail,holin,plate,transposase,portal	Salmonella_phage(22.54%)	152	2642260:2642275	2716562:2716574
WP_038275327.1|2594971_2595388_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	1.6e-42
WP_038251223.1|2595411_2596620_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	79.1	2.1e-183
WP_038243498.1|2596659_2599350_-	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_038243495.1|2599368_2599695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243492.1|2599742_2601137_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_038243489.1|2602015_2603683_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.2	2.7e-290
WP_038243486.1|2603870_2605901_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.2	5.6e-08
WP_038243483.1|2606234_2607035_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_004721843.1|2607054_2608194_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_038243481.1|2608216_2609437_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_038243479.1|2609527_2610280_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_004721839.1|2610746_2612411_+	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	38.6	3.3e-83
WP_038243478.1|2613477_2614659_-	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_004720216.1|2614857_2616282_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_087931070.1|2616518_2617610_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.7	2.1e-46
WP_038243476.1|2617606_2618080_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_038243474.1|2618152_2619031_+	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_038243471.1|2619038_2620574_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_038243469.1|2620652_2620964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004720206.1|2621315_2622212_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004720204.1|2622390_2623131_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_038243466.1|2623130_2623805_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_038243463.1|2623804_2624530_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	8.7e-28
WP_004720199.1|2624626_2625109_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_004720194.1|2625392_2627975_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	2.7e-188
WP_038243460.1|2627989_2628568_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
WP_038243458.1|2628564_2629599_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_038243456.1|2629588_2630269_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_038243454.1|2630653_2631076_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	39.6	1.1e-17
WP_051847018.1|2631077_2631947_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	35.8	2.3e-19
WP_038243451.1|2631997_2632594_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.8	2.5e-33
WP_038243449.1|2632590_2633727_-|plate	baseplate J/gp47 family protein	plate	A0A1B0Z1L7	Shewanella_phage	24.9	2.8e-09
WP_038243447.1|2633730_2634168_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	44.7	2.0e-19
WP_038243444.1|2634164_2634758_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_038243442.1|2634757_2635828_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	31.5	2.8e-43
WP_038243440.1|2635824_2637234_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	28.3	3.9e-24
WP_038243437.1|2637382_2637820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243434.1|2637894_2639703_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.2	5.9e-25
WP_004722866.1|2639820_2640123_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_004722867.1|2640124_2640493_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_004722869.1|2640505_2641996_-|tail	tail protein	tail	A0A192Y7L1	Salmonella_phage	44.8	1.4e-104
WP_038243432.1|2641995_2642187_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
2642260:2642275	attL	ATACCCGCCAGCGGCT	NA	NA	NA	NA
WP_087931031.1|2642537_2643687_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	62.4	2.9e-94
2642260:2642275	attL	ATACCCGCCAGCGGCT	NA	NA	NA	NA
WP_004722873.1|2643971_2644319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245658.1|2644322_2644694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004722877.1|2644695_2645742_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	32.8	1.3e-48
WP_038245663.1|2645846_2646245_-|head	head decoration protein	head	NA	NA	NA	NA
WP_038245665.1|2646241_2646868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245669.1|2646867_2647725_-	S49 family peptidase	NA	Q6UYI0	Burkholderia_phage	48.8	6.6e-51
WP_004722885.1|2647721_2649356_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.1	2.8e-98
WP_049689466.1|2649355_2649619_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_038245674.1|2653028_2653247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245675.1|2653426_2653984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245676.1|2654027_2654405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245677.1|2654564_2654792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245678.1|2654766_2655111_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_071708642.1|2655107_2655731_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	64.3	1.9e-68
WP_071708424.1|2655734_2656079_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	61.0	5.9e-27
WP_038243921.1|2656295_2656520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243919.1|2656524_2656968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243918.1|2657485_2657974_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	72.8	1.3e-64
WP_038243916.1|2657970_2658579_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	56.3	9.4e-52
WP_038243913.1|2658680_2659196_-	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	72.8	6.1e-68
WP_038243911.1|2659792_2660218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243908.1|2660214_2660577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243905.1|2660573_2660849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243902.1|2660845_2661556_-	DNA replication protein	NA	I6PBN0	Cronobacter_phage	54.8	3.8e-60
WP_038243900.1|2662462_2662759_-	hypothetical protein	NA	A2SY75	Escherichia_phage	65.3	1.6e-25
WP_038243898.1|2662876_2663104_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	51.4	1.0e-11
WP_038243897.1|2663203_2663881_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	58.0	3.1e-64
WP_038243895.1|2664029_2664470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243893.1|2664793_2665141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071665753.1|2665766_2666009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243890.1|2666011_2666194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243887.1|2666409_2666745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243886.1|2666827_2667799_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	62.2	4.0e-44
WP_038243884.1|2668218_2668848_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	65.3	4.1e-66
WP_038243881.1|2668847_2669300_+	phage protein	NA	A0A2I6PID1	Escherichia_phage	63.0	1.2e-35
WP_051847024.1|2669324_2669714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243878.1|2669762_2670206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243992.1|2670333_2670672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243876.1|2670671_2670977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243874.1|2671165_2671711_+	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	66.7	6.4e-60
WP_038243872.1|2671800_2672043_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	53.9	1.2e-13
WP_071665754.1|2672039_2672285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243871.1|2672250_2673327_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.9	3.8e-96
WP_038243454.1|2673586_2674009_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	39.6	1.1e-17
WP_051847018.1|2674010_2674880_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	35.8	2.3e-19
WP_038243451.1|2674930_2675527_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.8	2.5e-33
WP_087931071.1|2675523_2676660_-|plate	baseplate J/gp47 family protein	plate	A0A1B0Z1L7	Shewanella_phage	24.9	2.2e-09
WP_038243447.1|2676663_2677101_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	44.7	2.0e-19
WP_038243444.1|2677097_2677691_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_038243442.1|2677690_2678761_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	31.5	2.8e-43
WP_038243440.1|2678757_2680167_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	28.3	3.9e-24
WP_038243437.1|2680315_2680753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087931072.1|2680827_2682651_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	48.5	3.8e-24
2682352:2682367	attR	ATACCCGCCAGCGGCT	NA	NA	NA	NA
WP_071704405.1|2682771_2683074_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
2682352:2682367	attR	ATACCCGCCAGCGGCT	NA	NA	NA	NA
WP_004722867.1|2683075_2683444_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071704406.1|2683456_2684947_-|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	43.1	4.2e-101
WP_038243432.1|2684946_2685138_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_038251479.1|2685149_2685689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004722873.1|2685685_2686033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049689463.1|2686036_2686408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004722877.1|2686409_2687456_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	32.8	1.3e-48
WP_038245663.1|2687560_2687959_-|head	head decoration protein	head	NA	NA	NA	NA
WP_038245665.1|2687955_2688582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245669.1|2688581_2689439_-	S49 family peptidase	NA	Q6UYI0	Burkholderia_phage	48.8	6.6e-51
WP_004722885.1|2689435_2691070_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.1	2.8e-98
WP_049689466.1|2691069_2691333_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_080717353.1|2691341_2693321_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.2	1.6e-140
WP_038245671.1|2693289_2693889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245672.1|2694014_2694662_-	hypothetical protein	NA	A0A0K1LLF3	Rhodobacter_phage	32.3	7.7e-20
WP_038245674.1|2694753_2694972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245675.1|2695151_2695709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245676.1|2695752_2696130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245677.1|2696289_2696517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038245678.1|2696491_2696836_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_071708642.1|2696832_2697456_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	64.3	1.9e-68
WP_071708424.1|2697459_2697804_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	61.0	5.9e-27
WP_038243921.1|2698020_2698245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038243919.1|2698249_2698693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243918.1|2699210_2699699_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	72.8	1.3e-64
WP_038243916.1|2699695_2700304_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	56.3	9.4e-52
WP_087931073.1|2700409_2700577_-	NinE family protein	NA	NA	NA	NA	NA
WP_071666887.1|2700552_2701023_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	55.2	2.6e-41
WP_071666888.1|2701019_2701487_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	34.1	2.9e-08
WP_071666889.1|2701486_2701696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071666890.1|2701692_2702001_-	hypothetical protein	NA	A0A1W6DXQ0	Salmonella_phage	37.9	7.9e-15
WP_071666891.1|2702000_2703404_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	62.6	8.5e-165
WP_071666892.1|2703393_2704278_-	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	52.7	1.1e-77
WP_071666893.1|2704462_2704756_-	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	1.4e-24
WP_071666894.1|2704867_2705086_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	2.0e-20
WP_071666895.1|2705192_2705858_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	60.2	4.7e-73
WP_038243895.1|2705988_2706429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071666896.1|2706625_2706841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071666897.1|2706837_2707314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087931074.1|2707847_2708144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050130527.1|2708306_2708573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071704720.1|2708628_2708967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071704721.1|2709389_2709677_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	27.4	8.2e-06
WP_087931075.1|2709783_2709915_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	58.5	6.3e-06
WP_071704722.1|2710036_2710333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071704723.1|2710332_2711250_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.1	2.5e-109
WP_057632488.1|2711246_2711930_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	59.5	5.6e-77
WP_057632490.1|2711926_2712109_+	DUF1317 family protein	NA	A0A193GYJ8	Enterobacter_phage	58.8	8.2e-12
WP_071704724.1|2712148_2712691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071704725.1|2712683_2713181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071704726.1|2713180_2714077_+	hypothetical protein	NA	A0A0U4KRZ0	Arthrobacter_phage	65.6	1.5e-05
WP_071704731.1|2714265_2714811_+	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	66.1	2.7e-58
WP_038243872.1|2714900_2715143_+	hypothetical protein	NA	A0A2H4J398	uncultured_Caudovirales_phage	53.9	1.2e-13
WP_071704730.1|2715139_2715385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038243871.1|2715350_2716427_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.9	3.8e-96
2716562:2716574	attR	GATATTCTTTCCA	NA	NA	NA	NA
>prophage 8
NZ_CP017236	Yersinia ruckeri strain QMA0440 isolate 14/0165-5k chromosome, complete genome	3856634	3047637	3056381	3856634	transposase	Escherichia_phage(16.67%)	7	NA	NA
WP_071666903.1|3047637_3047943_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	66.7	1.2e-10
WP_087931081.1|3048517_3049637_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	5.1e-51
WP_038245058.1|3050138_3050369_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_038245072.1|3050594_3053150_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.2	1.4e-27
WP_004719154.1|3053442_3054441_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.6e-32
WP_004719153.1|3054497_3055475_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.5	4.6e-08
WP_038245053.1|3055754_3056381_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.3	9.1e-34
