The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	839751	887105	4978342	transposase,protease	Stx2-converting_phage(38.46%)	34	NA	NA
WP_000997995.1|839751_841290_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|842417_842768_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|842764_843190_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|843561_843699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|843850_844768_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|844801_845677_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|845725_847198_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|847201_848032_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|848077_848788_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|848800_849910_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|849971_850895_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|850930_851665_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|851764_852751_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|852902_854130_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|854630_856721_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|857552_857825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|858115_858475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|858478_858694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|861911_863525_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|863555_863906_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|863902_864328_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001254932.1|866014_867166_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|867762_871650_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|872593_874795_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|874876_876154_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|876150_877893_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|877892_878840_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|878840_880565_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|880700_881894_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|882611_883040_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|883079_883640_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|883681_883942_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|885775_885889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|885979_887105_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
>prophage 2
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	1177373	1184513	4978342		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1177373_1178012_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1178008_1179271_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1179267_1180176_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|1180371_1181139_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1181189_1181846_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|1181951_1184513_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 3
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	1761102	1770547	4978342		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1761102_1762029_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1762033_1762765_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1762745_1762853_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1762912_1763644_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1763865_1765551_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1765547_1766267_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1766313_1766784_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1766824_1767286_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1767410_1769414_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1769410_1770547_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 4
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	1864723	1871026	4978342		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|1864723_1866118_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|1866292_1867186_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|1867558_1868644_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|1868643_1869543_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|1869600_1870479_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|1870483_1871026_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 5
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	1894173	1935685	4978342	transposase	Stx2-converting_phage(21.43%)	45	NA	NA
WP_001531805.1|1894173_1894632_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|1894742_1896170_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|1896378_1897545_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|1897663_1898137_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|1898334_1899393_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1899564_1899894_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|1899994_1900177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|1900665_1900779_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1900791_1900986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|1900982_1901357_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|1901445_1901814_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|1901829_1902474_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|1902492_1902714_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|1902776_1903253_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|1903268_1903742_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|1903835_1904081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1904080_1904899_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|1905119_1905530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1905978_1906725_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1906739_1908281_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|1908395_1908809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|1908944_1910015_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|1910011_1910917_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|1910913_1913298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|1913515_1913950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|1914378_1916544_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|1916554_1917544_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|1917562_1918621_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|1918617_1919385_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|1919438_1919696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|1920226_1921372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|1922571_1922751_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|1922896_1923919_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_072093906.1|1923915_1924611_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
WP_001327829.1|1924947_1925163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1925636_1926239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|1926332_1926611_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|1926734_1927931_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001336659.1|1928694_1928871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221519.1|1929510_1930080_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271042.1|1930245_1930647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221618.1|1930634_1931045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|1933268_1933694_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1933690_1934041_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1934071_1935685_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 6
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	2052422	2141445	4978342	integrase,capsid,holin,portal,plate,tRNA,terminase,transposase,tail	Escherichia_phage(22.73%)	102	2052237:2052296	2095626:2095750
2052237:2052296	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|2052422_2053439_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2053407_2053671_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2053880_2054063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2054062_2054632_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2054628_2056845_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2056875_2057196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2058206_2058620_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2058718_2058949_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2059007_2059484_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2059523_2059748_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2059744_2060500_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|2060489_2061905_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2061943_2062354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2062355_2062592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2062588_2062900_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2062896_2063121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2063802_2064591_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2064765_2065689_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|2066877_2067576_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|2068038_2068644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2068653_2069142_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|2069540_2069774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2070017_2070659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2070810_2070990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2071067_2071664_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2071660_2071954_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2071953_2072625_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2072737_2073121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2073120_2073393_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2073392_2073872_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2073879_2074074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2074133_2074379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2074747_2075314_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2075300_2077163_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2077162_2077396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2077392_2078967_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2078966_2080274_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2080273_2080603_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2080661_2081696_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2081730_2082150_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2082146_2082527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2082558_2083239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2083235_2083772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901289.1|2085434_2085776_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2085772_2086693_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2086695_2087322_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|2087314_2088499_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2088498_2088888_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2088884_2090387_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2090404_2090917_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2090929_2091211_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2091319_2092960_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2092995_2093385_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2093546_2093771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|2094985_2095405_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2095876_2096542_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2095626:2095750	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|2096592_2097804_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2097994_2098234_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2098271_2098769_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2098940_2099264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2099527_2099614_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2099728_2099980_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2100057_2100561_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2101355_2102345_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|2102414_2103929_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|2103943_2104930_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2105096_2105897_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2105871_2107296_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2107302_2107731_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2108510_2108861_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2108863_2109442_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2109568_2110456_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2110452_2111379_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2111383_2113348_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2113368_2113872_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2114016_2115678_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2115968_2116829_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2116831_2117881_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2117895_2118285_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|2118295_2118940_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2119128_2120277_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2120269_2122348_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2122347_2122740_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2122792_2124526_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2124741_2125308_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2125321_2126068_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2126455_2127556_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2127580_2130010_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564759.1|2130045_2131017_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2131013_2131757_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2131797_2132193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|2132245_2133064_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|2133060_2133627_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2133936_2135709_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|2135701_2136154_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|2136182_2136923_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|2136957_2137479_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|2137480_2138083_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|2138153_2138219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2138357_2138969_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|2138977_2139988_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|2140097_2141445_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 7
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	2633162	2704130	4978342	integrase,capsid,holin,portal,head,terminase,transposase,tail,protease	Stx2-converting_phage(25.0%)	79	2662048:2662062	2705094:2705108
WP_000422062.1|2633162_2634212_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|2634431_2635190_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|2635186_2635777_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|2635833_2636142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|2636151_2637138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|2637343_2638219_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|2638431_2640327_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2640354_2640975_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|2640971_2641853_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2641990_2642035_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|2642126_2643689_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001195273.1|2645287_2646646_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|2646657_2647851_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|2647850_2648657_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|2649032_2649308_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|2649304_2649862_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|2650273_2650543_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|2650599_2651268_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|2651466_2651649_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|2651876_2652662_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|2652663_2653197_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|2653227_2653755_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|2653770_2656677_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|2657138_2657885_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2657899_2659441_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|2660081_2663555_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
2662048:2662062	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|2663897_2664530_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|2664475_2665219_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|2665229_2665928_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|2665927_2666269_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|2666261_2669504_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|2669551_2669761_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|2669856_2670231_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|2670245_2670962_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|2671028_2671373_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2671369_2671816_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2671812_2672163_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2672172_2672499_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|2672495_2675081_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2675026_2675248_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|2675292_2677230_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|2677293_2678955_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|2678951_2679515_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|2679805_2680171_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|2680212_2680413_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|2680611_2680827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|2680912_2681098_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|2681319_2681406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|2681960_2682494_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_085949154.1|2682603_2683751_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000369850.1|2683852_2684125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2684090_2684435_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2684439_2684655_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|2684805_2686659_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|2686919_2687255_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|2687535_2687667_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|2688468_2689518_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|2689669_2689867_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|2690093_2690915_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|2690911_2691292_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|2691292_2692348_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2692349_2692622_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2692789_2693002_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2693182_2693848_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|2694022_2694448_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|2694463_2695234_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|2695255_2696002_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|2696008_2696971_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|2696993_2697419_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2697415_2697631_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|2697680_2698397_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|2698669_2698825_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|2698984_2699203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|2699251_2699419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|2699768_2699957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|2699953_2700145_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|2700237_2702709_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|2702773_2703022_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|2702999_2704130_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
2705094:2705108	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 8
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	2843344	2889052	4978342	integrase,capsid,holin,portal,tRNA,lysis,head,terminase,tail	Enterobacteria_phage(55.1%)	57	2862127:2862141	2890721:2890735
WP_000654172.1|2843344_2843623_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|2843619_2845641_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|2845699_2849182_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|2849242_2849845_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|2849781_2850525_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|2850529_2851228_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|2851227_2851557_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|2851553_2854115_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000479203.1|2854522_2854945_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|2854960_2855701_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|2855708_2856104_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|2856100_2856679_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|2856690_2857044_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|2857055_2857454_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|2857495_2858521_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|2858576_2858909_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|2858918_2860238_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|2860218_2861820_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|2861816_2862023_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|2862019_2863945_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
2862127:2862141	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|2863919_2864465_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|2865028_2865211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2865417_2865744_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2866224_2866518_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2866608_2866791_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|2867007_2867484_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|2867470_2867776_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|2868097_2868787_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|2868783_2868924_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|2868920_2869283_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|2869279_2869570_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|2869562_2869733_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|2869732_2870188_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|2870184_2870286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2870635_2871679_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|2871715_2875981_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|2876230_2876932_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|2876928_2877858_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|2877944_2878484_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|2878553_2878784_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2878888_2879578_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|2880173_2880380_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|2880455_2880752_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|2880757_2881543_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2881539_2882220_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2882216_2882399_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2882371_2882563_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|2882573_2882855_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|2882953_2883175_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2883174_2883501_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2883484_2883724_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2883863_2884100_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2884089_2885232_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2885345_2886596_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|2886767_2887421_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2887430_2887892_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2887945_2889052_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2890721:2890735	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 9
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	3086160	3125757	4978342	integrase,tRNA,head,transposase,tail	Burkholderia_virus(48.15%)	54	3095445:3095460	3114765:3114780
WP_001295930.1|3086160_3086946_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3087081_3087861_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|3087837_3088731_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|3088884_3089631_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|3089627_3089810_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|3089861_3091094_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|3091130_3092117_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|3092113_3093862_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|3093898_3096163_-	ComEC family protein	NA	NA	NA	NA	NA
3095445:3095460	attL	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_000167336.1|3096368_3096653_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3096812_3098486_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3098596_3099280_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|3099452_3100235_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001281701.1|3100378_3100768_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|3100739_3101189_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|3101190_3101397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|3101386_3101617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|3101613_3102297_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|3102293_3102509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3102523_3102820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|3102829_3103102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3103390_3103921_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|3103948_3104218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|3104220_3105387_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|3105397_3107167_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|3107182_3107500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047759.1|3108429_3108738_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|3108790_3108979_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|3109072_3109429_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|3109545_3110310_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|3110500_3110716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3110714_3111119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|3111094_3111823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|3111953_3112304_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|3112306_3113047_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|3113030_3113681_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|3113677_3114004_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|3114003_3114315_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|3114314_3114860_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
3114765:3114780	attR	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_000167500.1|3114856_3116452_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000090684.1|3116451_3117948_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|3117928_3118750_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|3118752_3119211_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|3119425_3120541_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|3120555_3121509_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|3121518_3121857_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|3121858_3122305_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|3122304_3122769_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|3122765_3123020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|3123009_3124437_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|3124436_3124958_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|3124960_3125242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|3125339_3125675_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|3125598_3125757_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
>prophage 10
NZ_CP021454	Escherichia coli strain H105, complete genome	4978342	3128784	3171513	4978342	tRNA,plate,tail,protease	Burkholderia_phage(16.0%)	36	NA	NA
WP_000458387.1|3128784_3129669_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|3129665_3129881_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|3129868_3131023_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|3131019_3131616_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|3131670_3132018_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|3132008_3133112_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|3133104_3133683_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001554039.1|3133685_3134966_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	43.8	7.8e-40
WP_000072165.1|3134972_3135587_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_088144067.1|3135586_3136069_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	1.7e-27
WP_064767240.1|3136109_3136550_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|3136609_3137182_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|3137437_3138721_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|3138791_3139880_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|3140078_3140771_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|3140900_3142661_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|3143066_3143924_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|3143978_3146261_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3146452_3147193_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_000109283.1|3147289_3148438_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3148751_3149378_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|3149413_3150277_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|3150278_3150896_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3150906_3153351_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3153589_3154882_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|3154972_3156316_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3156326_3156938_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|3157096_3161203_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3161337_3161832_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|3162375_3163341_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|3163463_3165230_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|3165230_3166952_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|3166993_3167698_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3167982_3168201_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3168885_3171162_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3171192_3171513_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 1
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	0	61521	134899	transposase,protease	Escherichia_phage(33.33%)	61	NA	NA
WP_000612626.1|1918_2266_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2262_2667_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|3168_4677_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_011478084.1|4985_5357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020413.1|6942_8118_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|8186_10448_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|10616_11393_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|11400_12276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|14726_15062_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|15190_15538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|15557_16067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|16063_16324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011478084.1|17157_17529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|17837_18326_+|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000874189.1|19230_19716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|19740_20226_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|20212_20908_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|20912_22043_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|22032_23316_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|23318_24698_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|24801_25329_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|25369_27256_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|27602_28418_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|28600_29107_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|29096_29255_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_001067858.1|30697_31402_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389366.1|32367_32841_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|32971_33760_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|33965_34313_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|34306_35146_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|35273_35477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|35632_36838_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|36848_37154_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|37380_38145_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|38637_39222_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|39221_40460_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|40456_41362_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|41483_42188_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_024192851.1|42212_42425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|42732_43548_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|43608_44412_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|44411_45248_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_042005022.1|45301_45538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000470729.1|45569_46223_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|46301_47501_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001067858.1|47917_48622_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032277257.1|49078_49954_-	class A extended-spectrum beta-lactamase CTX-M-27	NA	A0A1B0VBP7	Salmonella_phage	100.0	1.2e-153
WP_001067855.1|50267_50972_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|52282_52684_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|52616_52874_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|52966_53620_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001617855.1|54559_55417_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|55409_55484_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|55720_55975_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|56271_56406_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000080195.1|56841_58455_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|58485_58836_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|58832_59258_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_013023861.1|59816_60029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|60159_60720_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|60774_61521_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
>prophage 2
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	81670	91248	134899	transposase	Yersinia_phage(20.0%)	13	NA	NA
WP_001234469.1|81670_82492_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|82610_82898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|83130_83319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|83819_83978_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085947770.1|84088_85458_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|85703_86423_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|86419_86854_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|86908_88867_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|88932_89166_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290841.1|89228_89768_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|90001_90190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001553845.1|90410_90659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|90684_91248_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
>prophage 3
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	96969	104867	134899	integrase	Macacine_betaherpesvirus(80.0%)	6	91164:91180	107692:107708
91164:91180	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000086185.1|96969_97653_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|98037_98940_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|99806_100778_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|100777_101944_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|102531_103287_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|104060_104867_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
107692:107708	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	109079	118345	134899	transposase	Escherichia_phage(62.5%)	9	NA	NA
WP_001553854.1|109079_112196_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_023142242.1|112317_113589_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001617892.1|113585_115142_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|115324_115546_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|115545_115926_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|115930_116110_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|116137_116497_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|116783_117101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|117328_118345_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
>prophage 5
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	124217	126220	134899		Salmonella_phage(50.0%)	2	NA	NA
WP_000361610.1|124217_125195_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|125479_126220_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
>prophage 6
NZ_CP021871	Escherichia coli strain H105 plasmid pH105, complete sequence	134899	133933	134716	134899		Escherichia_phage(100.0%)	1	NA	NA
WP_001300609.1|133933_134716_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
