The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	95673	179903	5167701	capsid,holin,integrase,tail,portal,tRNA,head,terminase,plate,protease	Shigella_phage(43.64%)	97	123376:123390	181248:181262
WP_088172157.1|95673_96411_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|96542_97877_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_021577819.1|97909_98791_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001613622.1|98893_99481_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|99536_99920_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|100224_100914_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997418.1|100961_101999_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|102205_102625_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_021577820.1|102693_103392_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082981.1|103423_106084_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_021577821.1|106197_107553_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|107598_107922_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|107918_109217_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|114991_117565_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_021577822.1|117694_118426_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|118422_119403_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|119537_120275_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|120545_120887_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|120990_121038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|121136_122297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|122339_123461_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
123376:123390	attL	AGTTCCAGACGCTTC	NA	NA	NA	NA
WP_001168032.1|123471_124542_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_024248389.1|124751_125117_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_021577824.1|125266_125785_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589826.1|127032_127515_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|127591_127939_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|127980_128748_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|128778_129327_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|129345_129594_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|129730_131092_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|131258_132050_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|132071_133358_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|133412_134006_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|134128_135007_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_021577827.1|135092_136754_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|136902_137244_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|137305_137596_-	RnfH family protein	NA	NA	NA	NA	NA
WP_021577828.1|137585_138062_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|138193_138676_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_021530618.1|139462_140494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054185.1|140545_140890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137529.1|140974_141187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904997.1|141385_141940_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	8.2e-87
WP_088172158.1|141966_142302_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021546515.1|142303_142732_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	50.7	8.1e-26
WP_063118164.1|142703_143306_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	2.7e-99
WP_072847817.1|143305_144103_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	70.7	4.2e-52
WP_000383572.1|144106_144691_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_088172159.1|144681_145740_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.6	1.8e-199
WP_000424747.1|145726_146152_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_001259084.1|146151_146700_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_020219053.1|146699_147779_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	3.4e-206
WP_063118235.1|147775_149104_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.1	1.9e-246
WP_000679479.1|149165_149696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024244102.1|149787_151620_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	97.4	9.1e-300
WP_000661054.1|151761_152031_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|152030_152387_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_054625654.1|152386_153883_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.2	9.5e-271
WP_000497751.1|153866_154037_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779296.1|154045_154606_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	100.0	6.1e-106
WP_000224835.1|154602_155109_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702395.1|155083_155494_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924829.1|155490_155814_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766100.1|155892_157122_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|157132_157735_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_015364399.1|157727_158954_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.3	4.9e-241
WP_089078575.1|159101_160598_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	3.1e-290
WP_000929180.1|160831_161326_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	6.6e-88
WP_001135210.1|161451_161802_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
WP_016159276.1|161929_162364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012599940.1|162889_163282_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
WP_021563578.1|163265_163742_-	glycoside hydrolase family protein	NA	U5P0A9	Shigella_phage	99.4	2.9e-88
WP_001120491.1|163745_164072_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	6.8e-57
WP_024225789.1|164364_164628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024225790.1|164624_165365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024225791.1|165391_165733_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	6.0e-56
WP_074613456.1|165751_166741_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_001061438.1|166748_167558_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_040074681.1|167577_167967_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_000210154.1|167963_168290_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001305610.1|168286_168940_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001305611.1|168939_169434_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|169430_170372_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|170361_170541_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|170716_171268_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|171305_171506_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|171603_172230_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549626.1|172477_172684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|172655_173090_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008235.1|173634_174171_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_063118231.1|174161_174524_+	hypothetical protein	NA	A5LH61	Enterobacteria_phage	97.4	2.0e-65
WP_001331173.1|174520_174736_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|174795_175002_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_054632495.1|174962_176159_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.3	1.8e-147
WP_044527605.1|176349_177615_+	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	29.9	9.5e-06
WP_032211342.1|177614_178301_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_088172161.1|178661_179903_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.6	9.1e-102
181248:181262	attR	AGTTCCAGACGCTTC	NA	NA	NA	NA
>prophage 2
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	2612678	2642808	5167701	transposase,integrase	Escherichia_phage(14.29%)	23	2614879:2614893	2625750:2625764
WP_085947771.1|2612678_2613840_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000560765.1|2614116_2614509_-	hypothetical protein	NA	NA	NA	NA	NA
2614879:2614893	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_001682441.1|2615793_2616585_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000845054.1|2616733_2617747_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001067858.1|2618296_2619001_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000691727.1|2621013_2622933_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_011058339.1|2622948_2623035_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|2624230_2624935_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2625357_2626218_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
2625750:2625764	attR	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_001120888.1|2626427_2627921_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_072042932.1|2627951_2628185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001456218.1|2628385_2629228_+	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_001682441.1|2629316_2630108_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_039025962.1|2631141_2632698_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.4e-104
WP_039025961.1|2632961_2633834_+	GTPase family protein	NA	NA	NA	NA	NA
WP_088172325.1|2634206_2637053_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001598214.1|2637391_2638210_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.6	1.5e-44
WP_001563926.1|2638301_2638787_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	4.0e-13
WP_001186774.1|2638802_2639279_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692353.1|2639341_2639563_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001016257.1|2639770_2640517_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2640531_2642073_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_088172326.1|2642253_2642808_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	31.8	5.1e-20
>prophage 3
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	3194287	3239973	5167701	transposase,capsid,integrase,tail,portal,lysis,head,terminase,protease	Enterobacteria_phage(57.89%)	60	3185396:3185411	3229918:3229933
3185396:3185411	attL	TGGCGTATTCCAGATT	NA	NA	NA	NA
WP_000533642.1|3194287_3195358_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|3195335_3195554_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|3195593_3195761_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|3196003_3196606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|3196816_3197038_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|3197136_3197418_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|3197428_3197620_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|3197592_3197775_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_001537863.1|3197771_3198452_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	4.6e-132
WP_000100847.1|3198448_3199234_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|3199239_3199536_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372923.1|3199611_3199755_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|3199723_3199888_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_001542699.1|3199960_3200329_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	2.9e-64
WP_001542700.1|3200511_3200712_-	restriction inhibitor protein ral	NA	A0A088CQ62	Enterobacteria_phage	98.5	1.2e-32
WP_000281856.1|3200978_3201461_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_077760542.1|3201461_3201917_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	97.6	2.3e-63
WP_032292259.1|3202462_3203149_-	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	99.6	4.4e-130
WP_000391959.1|3203257_3203488_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	100.0	1.1e-37
WP_032292260.1|3203604_3203886_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	97.8	6.3e-43
WP_000185503.1|3203920_3204820_+	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
WP_088172348.1|3205002_3206216_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_001254223.1|3207472_3207649_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|3207651_3207993_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950954.1|3207985_3208180_+	protein ninF	NA	NA	NA	NA	NA
WP_001540841.1|3208199_3208562_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000971055.1|3208558_3208699_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|3208784_3209162_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|3209317_3209842_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|3210034_3210994_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|3212263_3212479_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135261.1|3212478_3212976_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_001228702.1|3213192_3213399_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|3213427_3213580_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|3213931_3214342_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001663509.1|3214398_3214632_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453600.1|3215020_3215566_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_001027268.1|3215540_3217466_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|3217462_3217669_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|3217665_3219267_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123307.1|3219247_3220567_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.5	6.7e-236
WP_005113102.1|3220576_3220909_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	1.9e-54
WP_042033446.1|3220964_3221990_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	4.3e-190
WP_000158888.1|3222031_3222427_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.9e-54
WP_000753006.1|3222438_3222792_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_042033450.1|3222803_3223382_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.5e-78
WP_000683142.1|3223378_3223774_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_088569077.1|3223781_3224522_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479153.1|3224537_3224960_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_088172352.1|3224941_3225376_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_088172353.1|3225368_3227948_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.3	0.0e+00
WP_000847373.1|3227944_3228274_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.1e-58
WP_001152502.1|3228273_3228972_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_032200652.1|3228977_3229721_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.0e-148
WP_000090891.1|3229657_3230290_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
3229918:3229933	attR	TGGCGTATTCCAGATT	NA	NA	NA	NA
WP_088172354.1|3230350_3233848_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.7	0.0e+00
WP_001230352.1|3233918_3234518_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_088172494.1|3234582_3237984_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	34.5	1.2e-10
WP_088172355.1|3237983_3238568_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	9.2e-105
WP_088172356.1|3238641_3239973_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 4
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	4529758	4592459	5167701	transposase	Stx2-converting_phage(33.33%)	52	NA	NA
WP_085949199.1|4529758_4531031_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.6e-172
WP_001067029.1|4531894_4532620_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_001012364.1|4533213_4534260_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000351505.1|4534747_4536082_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000086499.1|4536237_4537638_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000262197.1|4537860_4539159_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677248.1|4539217_4539937_-	amino acid racemase	NA	NA	NA	NA	NA
WP_000789106.1|4540276_4541176_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_001313421.1|4542302_4542899_-	MFS transporter	NA	NA	NA	NA	NA
WP_000705006.1|4542973_4544122_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
WP_001198735.1|4544118_4544736_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_000127080.1|4544719_4545598_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_065749834.1|4545594_4546284_-	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_085967273.1|4547479_4548692_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000706914.1|4548912_4549047_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001033555.1|4551011_4552043_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_001333102.1|4552566_4553013_-	maturase	NA	NA	NA	NA	NA
WP_000598813.1|4553658_4555020_-	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_000355772.1|4555016_4556273_-	peptidase T	NA	NA	NA	NA	NA
WP_000086506.1|4557138_4558539_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_088172436.1|4560082_4561297_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066367.1|4561310_4562069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739816.1|4562125_4563091_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000656352.1|4563093_4564128_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_001221623.1|4566442_4566850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270974.1|4566837_4567239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|4567498_4568068_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_072656556.1|4568862_4570476_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	1.8e-171
WP_000624723.1|4570506_4570857_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_000422750.1|4570853_4571279_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	4.4e-48
WP_001313064.1|4572062_4572341_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|4572434_4573037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000401.1|4573995_4575531_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	9.1e-261
WP_000609174.1|4575580_4575928_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|4575924_4576308_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001313066.1|4576492_4576672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000514100.1|4577875_4579027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|4579938_4580685_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4580699_4582241_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000544732.1|4582786_4585183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|4585179_4586085_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102643.1|4586081_4587152_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775500.1|4587287_4587971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846713.1|4587986_4588397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234530.1|4588617_4589439_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860076.1|4589520_4590000_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|4590015_4590492_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4590554_4590776_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285585.1|4590849_4591218_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|4591676_4591871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|4591883_4591997_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032082634.1|4592285_4592459_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.2	1.1e-10
>prophage 5
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	4622973	4630496	5167701		Enterobacteria_phage(42.86%)	7	NA	NA
WP_033870520.1|4622973_4623516_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.9	1.7e-44
WP_033870519.1|4623520_4624399_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	3.0e-107
WP_044863830.1|4624456_4625356_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	3.3e-29
WP_033870517.1|4625355_4626441_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.3e-100
WP_000183060.1|4626812_4627706_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_053882441.1|4627948_4628944_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	4.2e-09
WP_001116129.1|4629101_4630496_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.1e-18
>prophage 6
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	4721399	4730844	5167701		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|4721399_4722536_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_021577701.1|4722532_4724536_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	98.8	0.0e+00
WP_001295429.1|4724660_4725122_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_021577702.1|4725162_4725633_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_000598641.1|4725679_4726399_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4726395_4728081_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240399.1|4728302_4729034_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|4729093_4729201_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4729181_4729913_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_021577703.1|4729917_4730844_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
>prophage 7
NZ_CP021840	Escherichia coli strain EC974 chromosome, complete genome	5167701	4937910	5031572	5167701	transposase,capsid,integrase,holin,portal,lysis,tRNA,head,terminase,protease	Enterobacteria_phage(45.59%)	112	4981992:4982007	5032098:5032113
WP_000156142.1|4937910_4938813_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	3.1e-67
WP_021577751.1|4939009_4939783_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|4939790_4940507_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965512.1|4940503_4941190_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|4941279_4942062_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748264.1|4942282_4943065_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|4943330_4943900_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|4943994_4945512_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|4945548_4946037_-	colicin V production protein	NA	NA	NA	NA	NA
WP_021577752.1|4946568_4947231_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584578.1|4947220_4948489_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|4948558_4949473_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|4949628_4950288_-	DedA family protein	NA	NA	NA	NA	NA
WP_088172450.1|4950370_4951183_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|4951182_4952196_-	USG-1 protein	NA	NA	NA	NA	NA
WP_021577753.1|4952261_4953398_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	2.6e-23
WP_000615822.1|4953496_4954492_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127774.1|4954488_4955667_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817183.1|4955941_4957162_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_021577754.1|4957320_4959327_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4959447_4959726_-	YfcL family protein	NA	NA	NA	NA	NA
WP_021577755.1|4959759_4960308_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|4960307_4961117_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043835.1|4961116_4961941_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001307917.1|4961944_4963030_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.7e-89
WP_001309606.1|4963064_4963997_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4964162_4964714_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_021577756.1|4964881_4965724_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_021577757.1|4965725_4966250_-	fimbrial protein	NA	NA	NA	NA	NA
WP_021577758.1|4966246_4966732_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001252728.1|4966728_4967220_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182874.1|4967235_4967985_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001362314.1|4968007_4970647_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|4970728_4971292_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4971935_4972421_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_021577759.1|4972623_4974768_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_021577760.1|4974767_4976078_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4976258_4976543_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001307921.1|4976914_4978255_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_088172451.1|4978619_4979702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4979883_4980639_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4980931_4981864_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4981992:4982007	attL	TTCGATTCCTGCAGGG	NA	NA	NA	NA
WP_088172452.1|4982175_4983345_+|integrase	prophage integrase IntS	integrase	Q716F9	Shigella_phage	98.7	2.3e-219
WP_088172453.1|4983412_4984495_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.9	5.8e-20
WP_060618121.1|4986897_4987407_+	HNH endonuclease	NA	A0A291AXK3	Shigella_phage	44.9	4.5e-31
WP_000287055.1|4987538_4987805_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_000749291.1|4987875_4988361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088172454.1|4988375_4990220_-	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.1	2.6e-246
WP_088172455.1|4990219_4991626_-	acyltransferase	NA	I6RSG0	Salmonella_phage	55.8	8.4e-128
WP_088172456.1|4991635_4992328_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.1	6.0e-111
WP_000614033.1|4992330_4992786_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	6.7e-87
WP_000785555.1|4992785_4993634_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	92.9	2.6e-100
WP_088172457.1|4993633_4995052_-	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.9	1.7e-274
WP_088172348.1|4995296_4996510_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_000375639.1|4996830_4997016_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_088172458.1|4997058_4998330_-|head	head protein	head	Q9AYZ7	Salmonella_phage	95.5	6.9e-230
WP_088172459.1|4998341_4999226_-|capsid	phage capsid protein	capsid	Q716H1	Shigella_phage	99.7	8.1e-145
WP_088172460.1|4999239_5001366_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.4	0.0e+00
WP_088172461.1|5001368_5002781_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	9.8e-278
WP_001436504.1|5002777_5003200_-	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000091987.1|5003223_5003403_-	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	100.0	3.7e-25
WP_000807788.1|5003404_5003647_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001139680.1|5003955_5004108_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_029701281.1|5004095_5004563_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	95.5	6.7e-74
WP_088172462.1|5004559_5005036_-	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	99.4	1.7e-88
WP_000783734.1|5005019_5005343_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_088172463.1|5005804_5006323_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.3	1.0e-94
WP_088172464.1|5006319_5006508_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
WP_001008193.1|5006504_5006867_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002244.1|5006863_5007154_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_032198668.1|5007153_5007876_-	DNA-binding protein	NA	K7PL51	Enterobacteria_phage	93.3	1.3e-121
WP_000950943.1|5007868_5008045_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
WP_125134125.1|5008037_5008406_-	DUF2591 domain-containing protein	NA	I6R9D1	Salmonella_phage	72.1	1.5e-44
WP_001254220.1|5008408_5008585_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_001752315.1|5008581_5009109_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_088172466.1|5009105_5009546_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	98.6	2.9e-79
WP_023145903.1|5009526_5009781_-	hypothetical protein	NA	A0A2I6PIF4	Escherichia_phage	96.4	2.9e-39
WP_088172467.1|5009785_5010052_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	65.7	7.8e-27
WP_088172468.1|5010063_5010312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088172469.1|5010340_5010526_-	hypothetical protein	NA	A0A1B1W2E1	Salmonella_phage	70.5	2.1e-18
WP_088172470.1|5010607_5011981_-	AAA family ATPase	NA	K7P7K2	Enterobacteria_phage	96.5	1.2e-243
WP_088172471.1|5011977_5012799_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	98.9	3.7e-152
WP_015966855.1|5012981_5013260_-	ABC transporter	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
WP_000276886.1|5013368_5013554_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|5013634_5014285_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219338.1|5014599_5014899_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_000394299.1|5014907_5015159_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_053878063.1|5015198_5015489_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	77.8	1.6e-33
WP_078398964.1|5015778_5016747_+	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_000638547.1|5016771_5016903_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|5016887_5017040_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000365291.1|5017294_5018002_+	recombinase	NA	Q716E7	Shigella_phage	100.0	7.6e-138
WP_088172472.1|5018002_5018464_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.0	1.3e-69
WP_088172473.1|5018556_5018850_+	DUF2856 family protein	NA	K7P845	Enterobacteria_phage	97.9	2.1e-49
WP_001214453.1|5018860_5019028_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_000118152.1|5019024_5019324_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_088172474.1|5019325_5019892_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	61.4	2.7e-61
WP_088172475.1|5020079_5020247_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	2.9e-27
WP_001163428.1|5020304_5020505_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_088172477.1|5020777_5022049_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.9	8.2e-74
WP_024235423.1|5022123_5023098_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	53.8	6.6e-07
WP_023203543.1|5023205_5023415_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_024235422.1|5023466_5023646_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	54.2	2.2e-09
WP_001118612.1|5023777_5023954_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_023203540.1|5023946_5024306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023203539.1|5024337_5024622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023203538.1|5024618_5025002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023203537.1|5024998_5027671_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	2.1e-58
WP_023203536.1|5028071_5028833_+|capsid	phage capsid morphogenesis protein	capsid	NA	NA	NA	NA
WP_023203535.1|5028832_5029105_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.9	6.3e-08
WP_024235421.1|5029551_5030517_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_088172478.1|5030546_5031572_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.8	2.1e-168
5032098:5032113	attR	TTCGATTCCTGCAGGG	NA	NA	NA	NA
>prophage 1
NZ_CP021841	Escherichia coli strain EC974 plasmid pEC974-1, complete sequence	118934	23521	65857	118934	integrase,transposase	Escherichia_phage(29.41%)	51	19020:19036	63110:63126
19020:19036	attL	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
WP_000845048.1|23521_24535_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067858.1|24809_25514_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000080860.1|28037_29174_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|29224_29470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|29475_29667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|30148_30691_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_072257968.1|30703_31399_-	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067858.1|31490_32195_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_157698278.1|32228_32624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|33085_34219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642771.1|34238_34523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074712.1|34693_35341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628093.1|35328_35664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139427.1|35843_36425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088172499.1|36995_37346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000715519.1|37415_38024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372173.1|38091_38874_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_000239529.1|39011_39287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|39280_39925_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103690.1|40153_41125_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340829.1|41129_41522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457523.1|41526_42798_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000109071.1|42797_43235_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|43231_43480_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_072748701.1|43897_44800_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086147.1|45184_45868_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001104881.1|45868_46090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274500.1|46103_46538_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_077249901.1|47894_48197_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271744.1|48243_48666_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027495.1|48662_48854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001434357.1|48924_49239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276107.1|49622_50150_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	3.5e-47
WP_000006020.1|50207_50441_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001145485.1|50499_52458_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_001387500.1|52512_52947_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|52943_53663_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001579745.1|53659_54118_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	9.0e-15
WP_000117611.1|54717_55218_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_000218858.1|55946_56381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000804663.1|56474_56741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833767.1|56917_57307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011264057.1|57303_58206_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	9.0e-67
WP_000150314.1|58267_58474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148285.1|58504_58756_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001599394.1|59335_60184_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_021529212.1|60270_60606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283947.1|60839_61172_+	IncI1-type relaxosome accessory protein NikA	NA	NA	NA	NA	NA
WP_011264053.1|61182_63882_+	IncI1-type relaxase NikB	NA	NA	NA	NA	NA
63110:63126	attR	ATCAGGCATGCCGTCTG	NA	NA	NA	NA
WP_088172500.1|63919_64210_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_000080193.1|64243_65857_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	2.3e-182
>prophage 1
NZ_CP021842	Escherichia coli strain EC974 plasmid pEC974-2, complete sequence	92385	1856	81190	92385	integrase,transposase	Escherichia_phage(60.87%)	59	10034:10093	81646:82466
WP_001067858.1|1856_2561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|2672_3377_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000058717.1|3869_4754_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|4785_5985_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_072109431.1|6063_6726_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|6757_7000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|7057_10024_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
10034:10093	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067858.1|10097_10802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032187889.1|10886_11192_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	88.4	4.9e-25
WP_088172348.1|11258_12472_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_001352007.1|12935_13091_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_000509940.1|14555_15065_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
WP_000035250.1|15076_15658_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
WP_072779020.1|15693_16509_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	94.5	1.1e-108
WP_000459149.1|16518_17790_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	3.0e-241
WP_088172504.1|17814_19088_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	4.7e-170
WP_000067707.1|19503_21210_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_000038866.1|21436_22438_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|22454_23651_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001154682.1|23819_24629_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	1.6e-155
WP_001113742.1|24921_25806_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001281115.1|26141_26534_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_000336812.1|26543_26684_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007763.1|26709_27132_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	97.1	9.4e-59
WP_085948178.1|31741_32954_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_076751476.1|33755_37229_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_000578338.1|38236_38971_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001089729.1|44311_45445_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|45550_45874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069067570.1|47738_49001_+	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
WP_001190711.1|50378_50600_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
WP_001216039.1|50599_50980_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
WP_000113018.1|50984_51164_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_069067567.1|51191_52235_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
WP_001351993.1|52537_52849_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
WP_000611661.1|52881_53733_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
WP_000874156.1|53843_54053_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542338.1|54657_54879_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
WP_000067537.1|54886_55918_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
WP_001224232.1|55968_56280_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
WP_000848370.1|56525_57086_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
WP_000207077.1|57172_57922_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	49.0	1.3e-66
WP_001351995.1|58077_58719_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	95.8	2.3e-109
WP_071447930.1|58821_59949_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
WP_000747845.1|59985_60234_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
WP_000224043.1|60230_60671_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_085947771.1|60790_61952_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_072778934.1|64896_68412_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.0e-98
WP_000896262.1|68781_68982_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_000222771.1|69271_69559_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_001139206.1|69555_69807_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_076751473.1|70419_73278_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_001067858.1|76065_76770_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|76881_77586_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000679427.1|77821_78169_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|78332_79124_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|79129_79420_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|79531_80029_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845048.1|80176_81190_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
81646:82466	attR	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP021843	Escherichia coli strain EC974 plasmid pEC974-3, complete sequence	78672	5678	16422	78672	transposase,integrase	Enterobacteria_phage(33.33%)	12	9191:9250	12791:13447
WP_000027057.1|5678_6539_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|8274_8832_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_020219413.1|8995_9136_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	93.8	1.3e-09
9191:9250	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067858.1|9253_9958_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015057121.1|9848_10808_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_032491824.1|10956_11748_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_000939727.1|11879_12701_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_001067858.1|12853_13558_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
12791:13447	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_011264039.1|13630_13870_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|14015_14879_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|14916_15162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|15630_16422_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
