The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	820287	832610	4716739	integrase,tRNA	Enterobacteria_phage(25.0%)	13	815869:815882	826284:826297
815869:815882	attL	AAACGCTGCTGGCT	NA	NA	NA	NA
WP_000003339.1|820287_821805_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_000133994.1|821880_822426_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244328.1|822690_823449_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_088137008.1|823766_824981_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	3.5e-138
WP_088137009.1|825126_826098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137010.1|826205_826403_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
826284:826297	attR	AGCCAGCAGCGTTT	NA	NA	NA	NA
WP_088137011.1|826474_827275_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.6	8.4e-24
WP_088137012.1|827267_827825_+	transporter	NA	A0A1W6JPH8	Morganella_phage	57.5	2.5e-51
WP_088137013.1|827817_828402_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	50.0	5.2e-31
WP_088137015.1|829734_829950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137016.1|829946_830150_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	56.5	7.5e-14
WP_079918350.1|830160_830475_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_088137017.1|830471_832610_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.3	1.1e-166
>prophage 2
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	1634182	1643353	4716739	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1634182_1635130_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1635113_1635845_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1635825_1635933_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1635992_1636724_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272847.1|1636946_1638632_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.8e-278
WP_000598637.1|1638628_1639348_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|1639394_1639862_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001221797.1|1639918_1640449_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1640620_1641079_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_065348281.1|1641319_1643353_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	2.1e-55
>prophage 3
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	1805867	1813134	4716739		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1805867_1806287_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457654.1|1806289_1807558_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1808012_1808225_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1808235_1808424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023217297.1|1808682_1809894_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	2.0e-109
WP_000107432.1|1810543_1810843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1810934_1811630_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001633536.1|1811703_1813134_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	58.1	7.8e-105
>prophage 4
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	1917055	1923684	4716739	integrase	Pectobacterium_phage(16.67%)	11	1911498:1911512	1922407:1922421
1911498:1911512	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856225.1|1917055_1917286_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001633679.1|1917423_1917798_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001633680.1|1917798_1918674_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1918690_1919044_+	YebY family protein	NA	NA	NA	NA	NA
WP_001633682.1|1919436_1920516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.3e-100
WP_001530910.1|1920512_1921619_-	exodeoxyribonuclease 8 (exodeoxyribonuclease viii)	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_001014089.1|1921649_1921937_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
WP_001633683.1|1921933_1922467_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
1922407:1922421	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|1922723_1922891_-	lytic enzyme	NA	NA	NA	NA	NA
WP_024134652.1|1922955_1923138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348550.1|1923192_1923684_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
>prophage 5
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	2100807	2107469	4716739		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2100807_2101614_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2101615_2102608_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|2102607_2103498_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001605114.1|2104320_2105043_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_001096568.1|2105513_2105696_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
WP_001605117.1|2105945_2106086_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_001605118.1|2106124_2106424_+	putative pertussis-like toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
WP_000727928.1|2106350_2106776_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2107154_2107469_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	2487219	2531857	4716739	integrase,tail,portal,plate,terminase,holin,head,tRNA,capsid,lysis	Enterobacteria_phage(65.71%)	59	2486346:2486370	2524546:2524570
2486346:2486370	attL	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_078016033.1|2487219_2488152_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	47.6	4.6e-74
WP_071683110.1|2488241_2488553_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	46.4	2.0e-18
WP_069722074.1|2488647_2488926_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_088137044.1|2489074_2489479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071645647.1|2489475_2489892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137045.1|2489888_2490146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137046.1|2490146_2490410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624447.1|2490595_2490838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719413.1|2490843_2491047_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_088137047.1|2491016_2491208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137048.1|2491283_2491727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001624306.1|2491798_2491981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058111863.1|2491968_2492502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058106653.1|2492498_2492738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624444.1|2492734_2493667_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	48.6	1.1e-64
WP_071645641.1|2493663_2494224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137049.1|2494220_2494826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137160.1|2494888_2497327_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	49.3	2.3e-173
WP_088137050.1|2497319_2497736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069722061.1|2498060_2498681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069722060.1|2498684_2499065_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_069722059.1|2499590_2500115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069722058.1|2500130_2501186_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.1	2.1e-152
WP_088137051.1|2501185_2502919_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.8	2.6e-264
WP_069722056.1|2503076_2503913_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	2.2e-99
WP_088137052.1|2503936_2505022_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	8.4e-136
WP_088137053.1|2505068_2505893_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	74.9	4.2e-95
WP_071624432.1|2505993_2506488_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	58.9	3.8e-51
WP_000864914.1|2506487_2506688_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	80.0	1.3e-21
WP_071624431.1|2506714_2507053_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_088137054.1|2507049_2507493_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	66.7	3.0e-47
WP_088137055.1|2507499_2507982_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	53.5	5.6e-31
WP_088137056.1|2507981_2510246_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	52.4	1.2e-179
WP_071624790.1|2510232_2510709_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	52.9	4.5e-41
WP_088137057.1|2510705_2511341_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	56.5	2.8e-62
WP_088137058.1|2511337_2511928_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	67.0	3.8e-66
WP_071624793.1|2511924_2512293_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	67.8	1.2e-36
WP_088137059.1|2512279_2513176_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	67.4	7.5e-106
WP_071624795.1|2513168_2513696_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	58.8	1.3e-54
WP_088137060.1|2513701_2515318_+	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	61.2	1.3e-169
WP_071645679.1|2515317_2516046_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	67.2	2.7e-45
WP_088137061.1|2516165_2516654_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.4	3.3e-71
WP_088137062.1|2516666_2519612_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	48.8	4.8e-234
WP_071624532.1|2519598_2519757_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	77.6	9.0e-15
WP_071624533.1|2519762_2520107_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	53.6	1.9e-17
WP_088137063.1|2520150_2520663_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	69.2	4.9e-62
WP_088137064.1|2520663_2521851_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.5	2.2e-185
WP_088137065.1|2522009_2523155_+	hypothetical protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.2	6.3e-150
WP_024153979.1|2523200_2523482_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_023170313.1|2523700_2523841_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	73.9	5.7e-13
WP_023229131.1|2524196_2524337_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	71.7	3.1e-11
WP_001229266.1|2524690_2524990_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2524546:2524570	attR	AAAGAAAAAAGGCCGCAATGCGGCC	NA	NA	NA	NA
WP_000672403.1|2524994_2527382_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|2527397_2528381_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2528517_2528562_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2528682_2529039_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2529089_2529287_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|2529382_2529925_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144226.1|2529928_2531857_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
>prophage 7
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	2611665	2619210	4716739	transposase	Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2611665_2611905_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2612115_2612280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2612777_2613587_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2613659_2614037_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2614184_2614727_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_065348541.1|2614919_2615648_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.3e-60
WP_023217438.1|2615664_2616078_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_075995179.1|2617123_2618248_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_075995180.1|2618751_2619210_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	7.7e-14
>prophage 8
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	2860676	2945101	4716739	integrase,plate,tail,portal,terminase,holin,capsid,lysis,protease,tRNA	Vibrio_phage(28.3%)	86	2852397:2852413	2950627:2950643
2852397:2852413	attL	GCTTTATTACCTTTTTC	NA	NA	NA	NA
WP_000886697.1|2860676_2861969_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067786.1|2862227_2863571_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.3e-80
WP_001519746.1|2863580_2864192_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_079948966.1|2864334_2868255_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_000228469.1|2868389_2868884_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|2869430_2870399_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_001044531.1|2870513_2872280_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_001202249.1|2872280_2874002_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.9e-12
WP_001241640.1|2874046_2874751_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001604059.1|2874751_2875135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040187.1|2875062_2875281_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597928.1|2875371_2876283_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|2876391_2877252_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|2877271_2877949_+	hydrolase	NA	NA	NA	NA	NA
WP_000934064.1|2878559_2880836_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2880866_2881187_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2881510_2881732_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125891.1|2881861_2883808_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023217515.1|2883804_2884923_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_065348327.1|2885068_2886019_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_001633263.1|2886015_2887674_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001633262.1|2887874_2888774_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458785.1|2888917_2890570_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001538209.1|2890581_2891550_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815322.1|2891707_2893426_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.9e-29
WP_000566346.1|2893464_2894466_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000079017.1|2894476_2895910_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866907.1|2896005_2897019_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202293.1|2897015_2897846_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|2897842_2898166_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088137068.1|2899122_2900436_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	3.0e-18
WP_023213123.1|2900909_2902181_+	MFS transporter	NA	NA	NA	NA	NA
WP_088137069.1|2902926_2903499_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.6	4.5e-80
WP_088137070.1|2903513_2904323_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	85.0	4.5e-118
WP_088137161.1|2904319_2905468_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	49.1	3.8e-62
WP_071624724.1|2906182_2906764_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	33.3	4.5e-19
WP_071624723.1|2906756_2907881_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	45.0	2.5e-90
WP_071624722.1|2907877_2908201_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.5	1.6e-13
WP_079918670.1|2908197_2908665_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071624720.1|2908661_2909282_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	57.0	1.2e-33
WP_071624719.1|2909282_2910284_-	late control D family protein	NA	A0A0C5AJ59	Bacteriophage	36.9	2.7e-56
WP_001623395.1|2910273_2910492_-	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	3.2e-10
WP_077909340.1|2910484_2912389_-|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.5	5.6e-42
WP_001623392.1|2913095_2913377_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001623391.1|2913386_2913908_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_057516512.1|2913920_2915390_-	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	54.7	1.5e-148
WP_088137071.1|2915389_2915689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023220971.1|2915688_2916174_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	6.4e-19
WP_021000629.1|2916170_2916515_-	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	44.9	1.2e-19
WP_071678380.1|2916521_2916977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071645722.1|2916977_2918021_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	45.2	6.3e-72
WP_021000632.1|2918036_2918423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071645723.1|2918433_2919498_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.6	7.6e-81
WP_088137072.1|2919490_2921053_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	63.6	1.1e-189
WP_021000635.1|2921049_2921289_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_088137073.1|2921300_2923160_-|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.4	1.8e-231
WP_020844527.1|2923165_2923711_-	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	37.2	2.6e-16
WP_020844528.1|2923710_2924301_-	hypothetical protein	NA	A0A067ZI74	Vibrio_phage	53.7	1.4e-36
WP_088137162.1|2924848_2925568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023212991.1|2925843_2926137_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	62.2	3.5e-28
WP_088137074.1|2926563_2927019_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	51.0	7.3e-25
WP_071624952.1|2927532_2928063_-	lysozyme	NA	H6WRZ4	Salmonella_phage	57.5	4.2e-56
WP_023212987.1|2928065_2928305_-|holin	Putative bacteriophage holin protein	holin	NA	NA	NA	NA
WP_157719415.1|2928864_2930187_-	phosphoribosylglycinamide formyltransferase	NA	A0A2H4J4K4	uncultured_Caudovirales_phage	51.0	6.4e-37
WP_071645857.1|2930132_2932208_-	SAM-dependent DNA methyltransferase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	34.3	7.6e-77
WP_071624971.1|2932825_2933248_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.1	1.5e-56
WP_071624972.1|2933247_2934219_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	80.7	4.7e-154
WP_088137075.1|2934215_2935832_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	74.1	1.4e-243
WP_071624974.1|2935842_2936217_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	46.7	2.8e-22
WP_071624976.1|2936778_2936994_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023212979.1|2937104_2937764_+	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	70.8	2.4e-93
WP_071624977.1|2937945_2938158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719416.1|2938158_2938305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624978.1|2938485_2938695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624979.1|2938675_2939032_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	47.1	9.5e-20
WP_071624980.1|2939031_2939229_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	56.9	1.6e-13
WP_023212972.1|2939225_2939633_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	67.2	2.2e-44
WP_071624981.1|2939644_2940397_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	78.5	1.7e-103
WP_088137076.1|2940393_2940960_+	hypothetical protein	NA	A0A067ZJ30	Vibrio_phage	31.1	6.3e-10
WP_071624983.1|2940956_2941202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160534.1|2941210_2941456_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052031950.1|2941497_2941782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023212965.1|2941939_2942182_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	8.1e-23
WP_088137077.1|2942207_2943533_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	64.5	8.1e-165
WP_001270726.1|2943628_2944144_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|2944372_2945101_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
2950627:2950643	attR	GAAAAAGGTAATAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	2965091	2974309	4716739	integrase,tail	Salmonella_phage(80.0%)	12	2962710:2962723	2981755:2981768
2962710:2962723	attL	TCAAGCTGACCGAT	NA	NA	NA	NA
WP_031603936.1|2965091_2965547_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	7.5e-62
WP_023212958.1|2967539_2968412_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	76.6	3.3e-114
WP_001633063.1|2968380_2968704_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	45.9	6.2e-10
WP_001633062.1|2968700_2968928_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	88.0	2.4e-32
WP_023212957.1|2968920_2969139_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	93.8	9.2e-26
WP_023212956.1|2969206_2969548_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	95.6	4.8e-53
WP_071785514.1|2969592_2969712_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	94.9	2.5e-17
WP_023212955.1|2969719_2970229_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	88.2	2.9e-78
WP_023212954.1|2970261_2970483_-	regulator for prophage	NA	NA	NA	NA	NA
WP_001633058.1|2970578_2971169_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.3	6.1e-40
WP_023212953.1|2971196_2973185_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001633054.1|2973265_2974309_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.6	5.5e-100
2981755:2981768	attR	ATCGGTCAGCTTGA	NA	NA	NA	NA
>prophage 10
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	3050029	3085206	4716739	integrase,tail,plate,transposase,terminase,head	Pseudomonas_phage(24.0%)	51	3045083:3045097	3065013:3065027
3045083:3045097	attL	TCGGCGGAGGGCATG	NA	NA	NA	NA
WP_088137080.1|3050029_3052066_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	48.1	3.9e-166
WP_088137081.1|3052075_3053023_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	37.5	1.2e-48
WP_079932772.1|3053071_3053296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137082.1|3053310_3053586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719418.1|3053642_3053894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137084.1|3053907_3054093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079932797.1|3054119_3054764_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	68.8	1.1e-74
WP_088137085.1|3054765_3055002_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088137087.1|3055267_3055543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069721023.1|3056350_3056569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069721024.1|3056565_3056790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137088.1|3056786_3057062_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	46.9	7.8e-14
WP_088137090.1|3057372_3058011_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	57.7	2.4e-53
WP_157719419.1|3058011_3058158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137091.1|3058234_3058657_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	60.9	1.3e-39
WP_088137092.1|3058687_3059215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137093.1|3059329_3059797_+	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	36.4	1.8e-18
WP_088137094.1|3059824_3060112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020843502.1|3060188_3060386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137095.1|3060459_3060996_+	lysozyme	NA	NA	NA	NA	NA
WP_079932613.1|3060980_3061538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137096.1|3061515_3061752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160573.1|3061751_3062252_+	DUF1804 family protein	NA	I6PBD1	Pseudomonas_phage	51.2	8.0e-41
WP_023213345.1|3062238_3062457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137097.1|3062467_3062710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137098.1|3062770_3062962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137099.1|3063001_3063532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137100.1|3063630_3065268_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	62.7	2.9e-188
3065013:3065027	attR	CATGCCCTCCGCCGA	NA	NA	NA	NA
WP_088137101.1|3065276_3066845_+	DUF935 domain-containing protein	NA	A0A125RNC0	Pseudomonas_phage	44.5	1.1e-117
WP_157719420.1|3066831_3068004_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	47.4	1.3e-60
WP_080206272.1|3068003_3068555_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	34.7	1.9e-22
WP_088137103.1|3068769_3069930_+	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	43.3	9.2e-64
WP_069721040.1|3069929_3070328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137104.1|3070338_3071250_+|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	61.3	2.9e-105
WP_088137105.1|3071249_3071648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137106.1|3071659_3072088_+	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	36.8	7.6e-16
WP_088137165.1|3072093_3072738_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_088137107.1|3072734_3072956_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_088137108.1|3072952_3074389_+|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	47.5	4.1e-106
WP_023213361.1|3074399_3074774_+	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	55.4	3.1e-29
WP_088137166.1|3074794_3075160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137109.1|3075308_3077573_+|tail	tail length tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	33.0	7.5e-62
WP_088137110.1|3077569_3078988_+	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_088137111.1|3078971_3080207_+|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	38.5	4.8e-71
WP_088137167.1|3080206_3080860_+|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	47.8	1.6e-49
WP_079932589.1|3080913_3081264_+	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.1	3.1e-31
WP_088137112.1|3081264_3082323_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	45.6	6.0e-78
WP_023213369.1|3082319_3082889_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_088137113.1|3082892_3083819_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	74.7	2.6e-45
WP_088137114.1|3083815_3084622_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	86.3	4.2e-124
WP_088137115.1|3084636_3085206_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.1	5.9e-80
>prophage 11
NZ_CP017720	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 chromosome, complete genome	4716739	3521421	3571516	4716739	terminase,tail,integrase	Salmonella_phage(38.78%)	66	3521123:3521168	3567625:3567670
3521123:3521168	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_071624806.1|3521421_3521799_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	40.5	3.3e-15
WP_088137168.1|3521930_3524213_-	sialate O-acetylesterase	NA	Q08JA2	Stx2-converting_phage	53.1	2.4e-177
WP_088137123.1|3524272_3525007_-	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	71.9	6.5e-47
WP_088137124.1|3525021_3525831_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	87.4	3.7e-120
WP_071678821.1|3525827_3527150_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	69.1	2.5e-89
WP_023136425.1|3527146_3527773_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.2	1.3e-91
WP_079900739.1|3527756_3528983_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.6	9.5e-152
WP_001261467.1|3528979_3529312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080167992.1|3529308_3530025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137125.1|3530021_3531065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116517.1|3531064_3531340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137126.1|3531336_3532053_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.0	3.8e-28
WP_088137127.1|3532052_3533939_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	36.2	3.4e-15
WP_023181119.1|3534062_3534650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|3534649_3535087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137128.1|3535090_3536485_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.4	3.8e-72
WP_088137129.1|3536489_3537431_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	38.6	2.2e-52
WP_071624574.1|3537414_3537849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137130.1|3537845_3538274_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	38.4	3.9e-20
WP_080096499.1|3538270_3538753_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	32.8	1.9e-10
WP_088137131.1|3538821_3539853_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.9	8.4e-77
WP_088137132.1|3539869_3540730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137133.1|3540745_3542362_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_071624569.1|3542374_3543199_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	36.7	3.3e-39
WP_071624568.1|3543195_3544617_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	2.9e-88
WP_088137134.1|3544628_3545960_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	8.4e-154
WP_088137135.1|3545961_3547005_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	52.4	4.8e-72
WP_057393648.1|3547066_3547480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137169.1|3547469_3548015_-	DUF2514 family protein	NA	A0A193GYI0	Enterobacter_phage	34.5	1.3e-12
WP_088137136.1|3547996_3548536_-	lysozyme	NA	H6WRZ4	Salmonella_phage	98.3	1.3e-100
WP_001189445.1|3548538_3548853_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	100.0	2.4e-51
WP_088137137.1|3549059_3549599_-	hypothetical protein	NA	Q8HA44	Vibrio_phage	48.3	1.4e-30
WP_088137138.1|3549865_3550543_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	8.6e-62
WP_023224313.1|3550539_3550680_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	84.2	8.5e-09
WP_088137139.1|3550676_3551318_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	99.1	3.7e-115
WP_079945832.1|3551320_3551527_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	79.4	2.1e-27
WP_000929790.1|3551526_3552129_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|3552163_3552412_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217668.1|3552528_3552762_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	4.7e-36
WP_058799674.1|3552993_3553491_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_016156674.1|3553501_3553681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079825420.1|3554167_3554434_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	98.9	4.4e-46
WP_088137140.1|3554495_3555098_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	63.1	3.2e-28
WP_088137141.1|3555574_3555970_-	ead/Ea22-like family protein	NA	B9UDM4	Salmonella_phage	51.8	4.9e-33
WP_071645664.1|3555966_3556629_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	48.4	5.4e-53
WP_088137142.1|3556642_3557335_-	phage replication protein	NA	G8C7U6	Escherichia_phage	58.9	3.3e-77
WP_088137143.1|3557331_3558066_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	58.0	7.4e-43
WP_071624552.1|3558028_3558238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074421601.1|3558329_3558704_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000992434.1|3558669_3558906_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230958.1|3559010_3559406_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	2.7e-47
WP_046093611.1|3559556_3560114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046093612.1|3560110_3560863_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_088137144.1|3560887_3561094_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	2.8e-16
WP_000648615.1|3561467_3561668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023181101.1|3561667_3561865_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088137145.1|3561875_3562148_+	hypothetical protein	NA	S4TU79	Salmonella_phage	58.9	3.7e-24
WP_079820536.1|3562231_3562528_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	92.9	6.0e-44
WP_088137146.1|3562533_3563037_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	31.5	2.2e-14
WP_088137147.1|3563033_3563657_+	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	47.6	6.7e-45
WP_088137148.1|3563653_3565936_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	47.0	4.4e-187
WP_052938283.1|3565941_3566181_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	97.5	7.4e-37
WP_088137149.1|3566446_3567610_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.5	1.9e-154
WP_000893218.1|3567815_3569066_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	4.7e-98
3567625:3567670	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3569077_3570181_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3570463_3571516_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP017721	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence	280421	9584	79645	280421	integrase,tail,transposase	Stx2-converting_phage(30.0%)	41	35430:35448	87216:87234
WP_071624750.1|9584_10241_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	58.0	2.1e-65
WP_088137324.1|12397_13414_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_125882789.1|13812_14019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137325.1|14695_15883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071624702.1|16246_17443_+	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	1.4e-22
WP_071624701.1|17492_18791_+	transporter	NA	NA	NA	NA	NA
WP_071624700.1|18805_19987_+	acetate kinase	NA	NA	NA	NA	NA
WP_088137179.1|20019_22314_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	3.6e-160
WP_088137180.1|22393_23965_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	3.4e-170
WP_088137181.1|23984_24332_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	73.8	8.3e-45
WP_071624698.1|25330_25609_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_088137182.1|25750_26077_-	nucleoside transporter	NA	NA	NA	NA	NA
WP_088137183.1|26094_26793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088137184.1|26785_27304_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088137185.1|27805_28294_-	DUF2919 family protein	NA	NA	NA	NA	NA
WP_088137186.1|30402_45360_-	hypothetical protein	NA	NA	NA	NA	NA
35430:35448	attL	CAGTAATGCTGACCGTTCC	NA	NA	NA	NA
WP_088137187.1|45488_47285_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_088137188.1|47571_47856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624738.1|48524_49196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624739.1|49200_50031_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	49.8	2.0e-65
WP_071624740.1|50033_50600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137189.1|50795_51998_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	69.4	1.2e-74
WP_088137328.1|52311_52500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624923.1|54892_55141_-|tail	phage tail protein	tail	E5G6P1	Salmonella_phage	74.7	5.7e-24
WP_088137190.1|55308_55917_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	41.3	2.6e-17
WP_088137191.1|55913_56261_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	70.4	7.8e-43
WP_071624922.1|58183_58402_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_071624921.1|58403_58709_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_088137192.1|58710_59001_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_071624929.1|59504_60287_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
WP_060634124.1|60519_61383_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	46.6	9.5e-66
WP_088137194.1|62847_64103_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.3	2.6e-27
WP_071624636.1|65281_66448_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	92.5	1.8e-216
WP_071624637.1|66447_67428_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	74.2	1.7e-135
WP_088137195.1|70399_70825_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	78.4	1.3e-36
WP_088137196.1|70821_71172_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.8e-39
WP_088137197.1|71202_72795_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	4.2e-168
WP_088137198.1|72808_73105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137199.1|74044_75379_-	group II intron reverse transcriptase/maturase	NA	H7BUU7	unidentified_phage	26.3	8.0e-11
WP_088137200.1|76001_76625_+	resolvase	NA	NA	NA	NA	NA
WP_088137201.1|76654_79645_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	45.2	1.2e-245
87216:87234	attR	CAGTAATGCTGACCGTTCC	NA	NA	NA	NA
>prophage 2
NZ_CP017721	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence	280421	168945	223537	280421	transposase,integrase,tRNA	Escherichia_phage(40.0%)	49	188715:188732	213862:213879
WP_071624913.1|168945_169344_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_088137267.1|169343_169574_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_088137268.1|169652_174923_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_088137269.1|174942_175689_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.9	1.2e-08
WP_088137270.1|175743_176304_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_071686284.1|176441_176654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719433.1|176839_177361_+	endonuclease	NA	A0A0R6PHV6	Moraxella_phage	36.4	3.7e-20
WP_088137272.1|177405_177615_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_071624945.1|178033_178183_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_071624946.1|178467_178746_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_088137330.1|178964_179039_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_088137273.1|179019_179895_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_157719434.1|181266_182043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624688.1|182329_182893_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	49.5	1.3e-47
WP_088137274.1|184903_185599_+	aquaporin Z	NA	NA	NA	NA	NA
WP_071624678.1|186136_186475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125872218.1|186614_187130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719435.1|187216_187459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719436.1|187448_187847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023213509.1|188000_188549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	1.2e-50
WP_088137278.1|188529_189411_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
188715:188732	attL	CGCTGAAACTGAAACAGG	NA	NA	NA	NA
WP_157719437.1|189478_189844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624683.1|189746_191048_-	amidohydrolase	NA	NA	NA	NA	NA
WP_088137280.1|191258_192347_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_088137281.1|193564_194959_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071624764.1|197121_198633_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	6.3e-89
WP_024160607.1|198868_200167_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_088137283.1|200194_202330_+	lysine decarboxylase	NA	NA	NA	NA	NA
WP_071624750.1|203497_204154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	58.0	2.1e-65
WP_088137284.1|204472_205009_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088137285.1|205081_205630_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088137286.1|205665_206397_+	molecular chaperone	NA	NA	NA	NA	NA
WP_157719438.1|206738_207317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137175.1|207655_210313_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_088137174.1|210420_211515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137173.1|211555_212146_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_157719424.1|212142_212688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157719439.1|212802_213531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137289.1|213590_214856_+	hypothetical protein	NA	NA	NA	NA	NA
213862:213879	attR	CGCTGAAACTGAAACAGG	NA	NA	NA	NA
WP_088137290.1|214877_215390_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_157719440.1|215572_216001_+	hypothetical protein	NA	A0A2L1IV08	Escherichia_phage	35.3	5.1e-20
WP_088137291.1|216011_216515_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_088137292.1|217509_217689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088137293.1|217825_218767_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.6	6.7e-73
WP_088137332.1|218958_219678_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	37.7	8.0e-26
WP_088137331.1|219763_220717_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_088137294.1|220800_221391_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_088137295.1|221526_222099_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	36.6	1.1e-17
WP_088137296.1|222133_223537_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017721	Salmonella enterica subsp. enterica serovar Minnesota strain CFSAN017963 plasmid pCFSAN017963_01, complete sequence	280421	264566	276338	280421	transposase	uncultured_Caudovirales_phage(44.44%)	12	NA	NA
WP_088137312.1|264566_264974_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.0	1.5e-13
WP_088137313.1|265467_265917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624755.1|266310_266793_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088137314.1|266783_267068_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_088137316.1|267949_268648_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	1.3e-89
WP_088137317.1|268734_269055_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	1.1e-19
WP_088137318.1|269100_270390_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	4.2e-166
WP_088137319.1|270402_270828_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.6e-50
WP_088137320.1|270845_271427_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.0	7.4e-22
WP_088137321.1|271586_274571_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	1.9e-302
WP_032442682.1|275746_276076_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|276056_276338_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
