The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	17141	29206	2116773		Microbacterium_phage(14.29%)	8	NA	NA
WP_001042263.1|17141_20867_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	1.6e-40
WP_000220677.1|21100_22555_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	4.9e-54
WP_001291325.1|22582_23605_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.6	9.6e-65
WP_000685111.1|23772_24324_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.8e-25
WP_000780020.1|24343_25096_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166558.1|25115_26663_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.9	2.5e-77
WP_017647783.1|26855_27755_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783424.1|27901_29206_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	81734	128083	2116773	tail,portal,holin,terminase,integrase	Streptococcus_phage(58.49%)	62	81637:81654	122267:122284
81637:81654	attL	TTTTTTGTTATAATATAA	NA	NA	NA	NA
WP_000570848.1|81734_82832_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	97.8	2.1e-203
WP_053515021.1|83005_83692_-	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	95.6	1.2e-116
WP_053515022.1|83700_84078_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	93.6	6.0e-65
WP_053515023.1|84061_84403_-	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	87.6	1.9e-49
WP_053515024.1|84598_84811_+	helix-turn-helix transcriptional regulator	NA	J7KBP9	Streptococcus_phage	98.6	6.4e-32
WP_053515025.1|84839_85565_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	69.9	3.6e-90
WP_017647876.1|85597_85756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104373.1|85752_86046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001191791.1|86174_86432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172798516.1|86461_86605_+	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	88.6	1.8e-09
WP_001058282.1|86680_86881_+	hypothetical protein	NA	J7KK69	Streptococcus_phage	100.0	9.3e-33
WP_000650504.1|86877_87168_+	hypothetical protein	NA	J7KDN2	Streptococcus_phage	100.0	8.2e-38
WP_000704951.1|87154_87838_+	AAA family ATPase	NA	J7KC09	Streptococcus_phage	98.2	4.6e-124
WP_079747930.1|87873_89280_+	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	71.9	5.3e-191
WP_053515027.1|89292_89775_+	DUF669 domain-containing protein	NA	A0A1P8BMD4	Lactococcus_phage	68.8	9.1e-58
WP_053515028.1|89792_91346_+	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.0	1.6e-209
WP_053515029.1|91590_92457_+	bifunctional DNA primase/polymerase	NA	A0A1P8BM70	Lactococcus_phage	66.1	9.5e-106
WP_079747931.1|92416_92767_+	VRR-NUC domain-containing protein	NA	A0A0B5A5Y0	Streptococcus_phage	85.0	1.6e-43
WP_000763916.1|92845_93142_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	100.0	1.4e-48
WP_017646174.1|93125_93284_+	hypothetical protein	NA	J7KJ16	Streptococcus_phage	100.0	1.2e-22
WP_053515030.1|93280_93661_+	hypothetical protein	NA	J7KIZ4	Streptococcus_phage	64.0	9.1e-37
WP_000159367.1|93657_93822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053515031.1|93818_94088_+	hypothetical protein	NA	A7J287	Streptococcus_phage	69.7	8.1e-24
WP_053515032.1|94077_94440_+	HNH endonuclease	NA	Q7Y4J8	Streptococcus_phage	68.5	3.8e-40
WP_053515033.1|94443_94926_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	87.5	2.1e-83
WP_053515034.1|95128_95692_+	DUF1642 domain-containing protein	NA	J7KK91	Streptococcus_phage	78.1	3.0e-76
WP_053515035.1|95678_95996_+	hypothetical protein	NA	J7KDM7	Streptococcus_phage	100.0	5.6e-56
WP_053515036.1|96013_96232_+	hypothetical protein	NA	J7KDL2	Streptococcus_phage	100.0	1.6e-38
WP_000142570.1|96921_97356_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	95.1	6.5e-71
WP_158472040.1|97532_97670_-	hypothetical protein	NA	J7KJ02	Streptococcus_phage	93.3	1.6e-15
WP_000090087.1|98559_98940_+	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	98.4	1.9e-63
WP_000634503.1|98929_100204_+|terminase	PBSX family phage terminase large subunit	terminase	A0A097PAV9	Streptococcus_pyogenes_phage	99.5	4.2e-251
WP_065367292.1|100203_101529_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	96.0	2.5e-235
WP_053515038.1|102557_102884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053515039.1|102997_103567_+	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	92.1	3.8e-63
WP_053515040.1|103585_104476_+	hypothetical protein	NA	A0A097PAW2	Streptococcus_pyogenes_phage	98.8	3.3e-85
WP_053515041.1|104488_104782_+	Rho termination factor N-terminal domain-containing protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	96.9	4.1e-45
WP_053515042.1|104795_105140_+	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	98.2	9.7e-54
WP_053515043.1|105136_105448_+	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	97.1	3.8e-49
WP_053515044.1|105444_105840_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	95.6	3.7e-57
WP_053515045.1|105841_106252_+	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	98.5	2.3e-70
WP_053515046.1|106263_106770_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	99.3	1.3e-78
WP_053515047.1|106782_107100_+	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	98.1	1.1e-51
WP_053515048.1|107072_107531_+	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	92.1	7.0e-76
WP_053515049.1|107523_109722_+	hypothetical protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	44.8	1.1e-110
WP_053515074.1|109732_111241_+|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	82.4	2.1e-241
WP_053515050.1|111231_116199_+|tail	phage tail protein	tail	J7KBT9	Streptococcus_phage	65.5	0.0e+00
WP_053515051.1|116199_118203_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	76.8	1.3e-294
WP_000889196.1|118214_118607_+	DUF1366 domain-containing protein	NA	J7KKA3	Streptococcus_phage	39.6	8.0e-12
WP_017647841.1|118766_119069_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	68.8	9.5e-29
WP_000609111.1|119061_119289_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	1.7e-30
WP_017647840.1|119414_120749_+	lysin	NA	Q8HA43	Streptococcus_phage	93.5	4.1e-249
WP_000455662.1|120892_121144_-	hypothetical protein	NA	A3F666	Streptococcus_phage	96.3	2.4e-41
WP_001030869.1|121284_121431_-	hypothetical protein	NA	A3F667	Streptococcus_phage	87.5	4.9e-15
WP_000424774.1|121580_121790_+	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	84.1	8.8e-26
WP_017647839.1|121912_122095_+	hypothetical protein	NA	A3F673	Streptococcus_phage	71.7	1.9e-16
WP_000049272.1|122307_123000_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
122267:122284	attR	TTTTTTGTTATAATATAA	NA	NA	NA	NA
WP_000739808.1|122996_123749_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_001231504.1|123745_124321_+	N-acetylmuramoyl-L-alanine amidase	NA	H7BV84	unidentified_phage	31.4	4.2e-09
WP_000335310.1|124415_125498_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_001865751.1|125500_126073_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000034648.1|126253_128083_+	molecular chaperone DnaK	NA	A0A167RF67	Powai_lake_megavirus	46.7	1.5e-132
>prophage 3
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	607451	615005	2116773	transposase,integrase	Streptococcus_phage(50.0%)	11	600796:600811	618285:618300
600796:600811	attL	GAAAATAAATAAAATT	NA	NA	NA	NA
WP_000595708.1|607451_608648_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
WP_001068667.1|609227_609575_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071659971.1|609719_610334_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|610336_610603_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|610602_611007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|611168_611369_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001872364.1|611393_611651_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.5	5.8e-11
WP_001867107.1|611776_611986_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|612158_612320_-	NINE protein	NA	NA	NA	NA	NA
WP_000594360.1|613061_614339_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|614348_615005_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
618285:618300	attR	GAAAATAAATAAAATT	NA	NA	NA	NA
>prophage 4
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	1145445	1295382	2116773	integrase,tail,tRNA,portal,holin,capsid,protease,terminase,transposase	Streptococcus_phage(60.53%)	154	1244575:1244593	1285621:1285639
WP_088181596.1|1145445_1146251_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017647708.1|1146327_1146981_-	uracil-DNA glycosylase	NA	A0A0S1TKU8	Elephant_endotheliotropic_herpesvirus	42.0	1.0e-35
WP_001209318.1|1147079_1147565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000802346.1|1147678_1148920_-	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000727597.1|1148930_1149560_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000717643.1|1149556_1150711_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_000262522.1|1150787_1151813_-	N-acetylneuraminate synthase	NA	A0A1B1IVE2	uncultured_Mediterranean_phage	37.1	2.0e-33
WP_017647707.1|1151812_1153213_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000181212.1|1153209_1154166_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000591737.1|1154249_1155197_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.4	7.6e-08
WP_000660893.1|1155230_1156199_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	2.3e-12
WP_001233887.1|1156195_1157341_-	capsule biosynthesis protein CapK	NA	NA	NA	NA	NA
WP_000578448.1|1157337_1157811_-	multidrug MFS transporter	NA	NA	NA	NA	NA
WP_000686634.1|1157810_1158260_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_017647706.1|1158283_1159672_-	sugar transferase	NA	NA	NA	NA	NA
WP_017647705.1|1159684_1160383_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	48.6	3.0e-54
WP_017647704.1|1160393_1161086_-	capsular polysaccharide biosynthesis protein CpsC	NA	A0A1X9I5E1	Streptococcus_phage	48.5	5.5e-48
WP_000565383.1|1161094_1161826_-	tyrosine-protein phosphatase CpsB	NA	NA	NA	NA	NA
WP_000064993.1|1161831_1163289_-	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	51.9	1.1e-114
WP_001222599.1|1163477_1164401_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	36.1	1.2e-05
WP_000129272.1|1164425_1165193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022113.1|1165201_1165912_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017647703.1|1165895_1167152_-	chloride channel protein	NA	NA	NA	NA	NA
WP_017647702.1|1167153_1167963_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000416961.1|1168001_1168409_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	53.0	1.0e-33
WP_017647745.1|1168459_1169671_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000343883.1|1169727_1170399_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_001259488.1|1170636_1171347_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_000863783.1|1171436_1172225_-	esterase family protein	NA	NA	NA	NA	NA
WP_001280070.1|1172281_1173943_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000245079.1|1174239_1175001_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	4.1e-12
WP_000587303.1|1175000_1175864_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000790854.1|1175876_1176881_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006720.1|1177238_1178894_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_017647746.1|1178947_1179667_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140346.1|1179680_1181363_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934876.1|1181472_1182699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081540.1|1182688_1183879_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796045.1|1183970_1184432_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163512.1|1184421_1184904_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_017647839.1|1185111_1185294_-	hypothetical protein	NA	A3F673	Streptococcus_phage	71.7	1.9e-16
WP_000424774.1|1185416_1185626_-	helix-turn-helix transcriptional regulator	NA	A3F668	Streptococcus_phage	84.1	8.8e-26
WP_001030869.1|1185775_1185922_+	hypothetical protein	NA	A3F667	Streptococcus_phage	87.5	4.9e-15
WP_000455662.1|1186062_1186314_+	hypothetical protein	NA	A3F666	Streptococcus_phage	96.3	2.4e-41
WP_017647840.1|1186457_1187792_-	lysin	NA	Q8HA43	Streptococcus_phage	93.5	4.1e-249
WP_000609111.1|1187917_1188145_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	97.3	1.7e-30
WP_017647841.1|1188137_1188440_-	hypothetical protein	NA	J7KH30	Streptococcus_phage	68.8	9.5e-29
WP_000889196.1|1188599_1188992_-	DUF1366 domain-containing protein	NA	J7KKA3	Streptococcus_phage	39.6	8.0e-12
WP_053515051.1|1189003_1191007_-	hypothetical protein	NA	J7KC14	Streptococcus_phage	76.8	1.3e-294
WP_053515064.1|1191007_1195129_-|tail	phage tail protein	tail	J7KBT9	Streptococcus_phage	77.4	0.0e+00
WP_172792770.1|1195129_1196617_-|tail	phage tail family protein	tail	J7KH53	Streptococcus_phage	73.6	4.6e-201
WP_053515065.1|1196655_1198668_-	PblA	NA	Q9F4J3	Streptococcus_phage	61.1	1.3e-12
WP_000916437.1|1198667_1199039_-	DUF5361 domain-containing protein	NA	A0A1P8BMT6	Lactococcus_phage	54.0	9.5e-31
WP_000858406.1|1199053_1199299_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.3	9.7e-16
WP_000226353.1|1199298_1199856_-|tail	tail protein	tail	M1PKG8	Streptococcus_phage	65.8	3.4e-64
WP_000573598.1|1199865_1200201_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_000032787.1|1200201_1200438_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_025194588.1|1200430_1200769_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.9	8.1e-45
WP_000180798.1|1200728_1201151_-	phage Gp19/Gp15/Gp42 family protein	NA	A0A0B5A2F6	Streptococcus_phage	68.6	2.4e-46
WP_000640308.1|1201164_1201380_-	hypothetical protein	NA	M1PRX2	Streptococcus_phage	49.3	3.2e-07
WP_000841023.1|1201376_1202279_-|capsid	phage major capsid protein	capsid	A0A0B5A5W3	Streptococcus_phage	86.0	9.7e-146
WP_001288695.1|1202281_1202746_-	DUF4355 domain-containing protein	NA	A0A0B5A7G6	Streptococcus_phage	51.3	1.7e-40
WP_000256853.1|1202826_1204242_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.8	6.3e-216
WP_000421992.1|1204350_1204539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227332.1|1204538_1205759_-	hypothetical protein	NA	Q7Y4I9	Streptococcus_phage	66.3	2.1e-114
WP_001108671.1|1205751_1207020_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	77.1	1.1e-187
WP_000725957.1|1207016_1207373_-	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	49.6	5.9e-22
WP_000225343.1|1207524_1207902_-	HNH endonuclease	NA	Q7Y4J1	Streptococcus_phage	71.3	9.3e-42
WP_000533372.1|1208195_1208621_-	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	50.0	2.9e-31
WP_017647858.1|1209009_1209276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105090.1|1209293_1209593_-	hypothetical protein	NA	M1PFH6	Streptococcus_phage	45.4	1.3e-17
WP_017647942.1|1209613_1210141_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	41.2	6.1e-23
WP_017285439.1|1210144_1210636_-	hypothetical protein	NA	U4KJB3	Streptococcus_phage	44.5	4.3e-31
WP_017647943.1|1210640_1211126_-	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	88.8	6.7e-85
WP_017647862.1|1211128_1211398_-	hypothetical protein	NA	A7J287	Streptococcus_phage	70.8	3.7e-24
WP_017647863.1|1211394_1211559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017647864.1|1211555_1211939_-	hypothetical protein	NA	J7KIZ4	Streptococcus_phage	66.7	2.9e-38
WP_017647865.1|1211935_1212094_-	hypothetical protein	NA	J7KJ16	Streptococcus_phage	96.2	9.9e-22
WP_017647866.1|1212077_1212374_-	DUF1599 domain-containing protein	NA	J7KDH9	Streptococcus_phage	100.0	1.1e-48
WP_017647944.1|1212385_1212733_-	hypothetical protein	NA	J7KK12	Streptococcus_phage	100.0	1.4e-60
WP_017647868.1|1212722_1213199_-	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	100.0	5.1e-61
WP_017647869.1|1213188_1213386_-	hypothetical protein	NA	J7KIX6	Streptococcus_phage	96.9	2.6e-27
WP_017647870.1|1213548_1214346_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	81.9	4.4e-126
WP_000064172.1|1214342_1215296_-	recombinase RecT	NA	J7KDK3	Streptococcus_phage	71.0	5.1e-121
WP_053515066.1|1215296_1215545_-	hypothetical protein	NA	J7KDI4	Streptococcus_phage	98.1	3.0e-20
WP_017647873.1|1215531_1215807_-	hypothetical protein	NA	J7KJY6	Streptococcus_phage	56.0	1.3e-21
WP_017647874.1|1215799_1215943_-	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	89.1	7.4e-16
WP_000600244.1|1215933_1216716_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	88.8	3.1e-132
WP_000546751.1|1216702_1217461_-	replication initiator protein A	NA	A0A097PBE7	Streptococcus_pyogenes_phage	64.4	1.7e-71
WP_017647875.1|1217489_1217633_-	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	82.9	1.9e-08
WP_001191791.1|1217662_1217920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104373.1|1218048_1218342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017647876.1|1218338_1218497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017647877.1|1218529_1219258_-	phage antirepressor KilAC domain-containing protein	NA	Q938N5	Temperate_phage	79.8	1.5e-109
WP_001875236.1|1219305_1219506_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	67.7	3.8e-18
WP_000207087.1|1219694_1220054_+	helix-turn-helix domain-containing protein	NA	M1PRN5	Streptococcus_phage	66.7	3.3e-36
WP_000686776.1|1220043_1220424_+	ImmA/IrrE family metallo-endopeptidase	NA	J7KBR5	Streptococcus_phage	84.9	6.5e-59
WP_000520183.1|1220476_1220686_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	50.0	5.0e-05
WP_000570848.1|1220862_1221960_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	97.8	2.1e-203
WP_017647747.1|1222238_1225457_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000134282.1|1225508_1226555_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	1.9e-68
WP_000139163.1|1226761_1227355_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_000676114.1|1227354_1228224_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.2	2.7e-100
WP_000716829.1|1228282_1229386_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000647415.1|1229394_1230183_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000365673.1|1230172_1230856_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221657.1|1230959_1231640_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1231757_1232276_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_017647748.1|1232398_1234963_-	GBS Bsp-like repeat-containing protein	NA	NA	NA	NA	NA
WP_000622242.1|1235114_1237313_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.2e-72
WP_000124588.1|1237309_1238071_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405388.1|1238072_1239002_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568323.1|1239043_1239691_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_001226483.1|1241011_1241902_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1242012_1242189_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_000800370.1|1242230_1243148_-	TDT family transporter	NA	NA	NA	NA	NA
WP_017647749.1|1243281_1247040_-	pullulanase	NA	NA	NA	NA	NA
1244575:1244593	attL	AATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
WP_017647750.1|1247208_1247943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130593.1|1247957_1248542_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150956.1|1248638_1250045_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_000670189.1|1250091_1250694_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_017647751.1|1250863_1252645_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	25.0	9.3e-07
WP_001003953.1|1252686_1254468_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567585.1|1254626_1255394_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285046.1|1255452_1256793_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017647752.1|1256892_1257309_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1257312_1257810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162275.1|1258031_1258628_+	Ltp family lipoprotein	NA	NA	NA	NA	NA
WP_088187514.1|1258816_1259921_+|transposase	IS3-like element ISSag2 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	48.5	1.1e-69
WP_000754577.1|1261755_1264224_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000715197.1|1264236_1265157_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_017647700.1|1265392_1268845_-	C5a peptidase ScpA/B	NA	A0A218KC60	Bacillus_phage	39.4	7.6e-05
WP_161517632.1|1269380_1270538_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_000007459.1|1271857_1273672_-	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	31.9	5.0e-32
WP_000248013.1|1274087_1275323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284550.1|1275524_1276706_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000198709.1|1276723_1276957_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_021075483.1|1277661_1277970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001933943.1|1277966_1278275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000581744.1|1278276_1278786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000161972.1|1278849_1279353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857661.1|1279352_1279667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017647821.1|1279901_1281107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129984.1|1281158_1281650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974945.1|1281663_1285275_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	24.3	1.9e-06
WP_001196976.1|1285515_1285881_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
1285621:1285639	attR	AATAGCTTTAGCTTCTTTA	NA	NA	NA	NA
WP_001287285.1|1285944_1286445_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000002804.1|1286878_1288987_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.4	8.2e-119
WP_000532330.1|1289080_1290025_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_017647820.1|1290029_1291406_-	amino acid permease	NA	NA	NA	NA	NA
WP_000120090.1|1291535_1292186_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_000140673.1|1292938_1293568_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000796925.1|1293548_1294145_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_000918412.1|1294155_1295382_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.0	8.1e-135
>prophage 5
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	1542640	1553373	2116773		Streptococcus_phage(84.62%)	14	NA	NA
WP_000767486.1|1542640_1543468_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	1.1e-124
WP_000287943.1|1543508_1543865_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966769.1|1543866_1544343_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	1.6e-38
WP_000232154.1|1544398_1545580_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.3	9.1e-168
WP_001198082.1|1545641_1546190_-	GNAT family acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.9	1.4e-54
WP_000158397.1|1546258_1547350_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	78.0	3.9e-165
WP_000603271.1|1547482_1548118_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425866.1|1548387_1549257_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	4.1e-109
WP_000358198.1|1549256_1549583_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364568.1|1549613_1550477_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	50.0	2.5e-74
WP_000715592.1|1550496_1551132_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_001144242.1|1551220_1551880_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.5	8.0e-65
WP_000178150.1|1551898_1552609_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
WP_017647958.1|1552608_1553373_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.8	3.4e-14
>prophage 6
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	2043805	2058369	2116773	integrase	Streptococcus_phage(66.67%)	22	2041840:2041859	2055772:2055791
2041840:2041859	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_000661535.1|2043805_2044294_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	1.2e-46
WP_001258774.1|2044378_2044984_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	46.8	7.0e-39
WP_000694577.1|2045167_2045341_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_017647733.1|2045600_2047103_-	DNA primase family protein	NA	Q9AZI5	Lactococcus_phage	36.9	3.8e-62
WP_017647732.1|2047122_2047980_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	71.7	3.7e-118
WP_000492120.1|2047980_2048253_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	69.8	2.5e-28
WP_000174504.1|2048245_2048587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206024.1|2048583_2048946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007346.1|2048957_2049155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017644535.1|2049135_2049276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877492.1|2049272_2049605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000648621.1|2049859_2050102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017647731.1|2050128_2050749_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	41.8	2.7e-38
WP_017644534.1|2050802_2050964_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000906796.1|2051129_2051822_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IV68	Lactobacillus_phage	49.2	4.3e-08
WP_001137532.1|2051926_2052136_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_000350953.1|2052828_2053170_+	hypothetical protein	NA	A0A1S5SDB5	Streptococcus_phage	59.7	2.2e-13
WP_000429449.1|2053196_2054162_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
WP_011324955.1|2054500_2055667_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.4	3.3e-154
WP_000092759.1|2055773_2056385_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2055772:2055791	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_001278152.1|2056714_2057002_-	Veg family protein	NA	NA	NA	NA	NA
WP_000852645.1|2057013_2058369_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
>prophage 7
NZ_CP021866	Streptococcus agalactiae strain SG-M29 chromosome, complete genome	2116773	2066689	2073893	2116773		uncultured_Caudovirales_phage(16.67%)	8	NA	NA
WP_001042660.1|2066689_2067394_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J6C5	uncultured_Caudovirales_phage	56.6	3.2e-27
WP_000029067.1|2067499_2068039_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	46.4	3.0e-17
WP_000359358.1|2068254_2069049_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000510606.1|2069041_2069884_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.0e-15
WP_000181757.1|2069859_2070699_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.0	3.5e-20
WP_000239224.1|2070698_2071241_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000217765.1|2071363_2072647_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.6	1.6e-05
WP_000706190.1|2072648_2073893_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	41.5	1.7e-87
