The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	419710	436237	4209445	lysis,tail,holin	Escherichia_phage(21.43%)	21	NA	NA
WP_004243609.1|419710_420328_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|420331_421108_+	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|421223_421766_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|422334_422514_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_088206624.1|422592_423996_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	45.9	7.5e-28
WP_017628011.1|424001_424658_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|424654_425842_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|425834_426179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|426175_426868_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|426870_427683_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|427651_427972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|427984_428473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206625.1|428475_430779_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	4.1e-15
WP_004243627.1|430861_431320_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|431379_431832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|431842_433330_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_004248364.1|433338_433851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206626.1|433887_434337_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_049203170.1|434333_434738_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.0	4.2e-24
WP_004248367.1|434740_435040_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_036918599.1|435421_436237_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	2.1e-54
>prophage 2
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	523758	589936	4209445	coat,portal,tail,integrase,tRNA,holin,lysis,terminase	Salmonella_phage(27.27%)	79	581218:581234	602401:602417
WP_088207252.1|523758_524589_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004243737.1|524627_525638_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_064505712.1|525682_526810_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	2.0e-23
WP_004248400.1|526958_527744_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004248401.1|527865_528786_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004243743.1|529354_530566_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_088206635.1|530770_532810_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_004248403.1|532897_533446_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004243747.1|533547_534444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243748.1|534765_535038_-	YfcL family protein	NA	NA	NA	NA	NA
WP_004243749.1|535174_535729_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_004243750.1|535745_536546_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004243753.1|536718_537804_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.5	8.2e-91
WP_004243756.1|537892_538825_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_049208153.1|539219_539774_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_004243759.1|539926_540469_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_049203530.1|540511_540997_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_017827874.1|541430_543599_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_004243765.1|543598_544903_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004243769.1|545139_545436_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_088206636.1|545781_547152_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004248410.1|547227_547971_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004243775.1|549292_549988_+	fimbrial protein	NA	NA	NA	NA	NA
WP_088206637.1|550781_551753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206638.1|551843_554150_-	hypothetical protein	NA	A5VW57	Enterobacteria_phage	59.9	8.8e-50
WP_088206639.1|554262_556479_-	DNA transfer protein	NA	Q716G2	Shigella_phage	57.4	1.3e-146
WP_088206640.1|556489_557971_-	DNA transfer protein	NA	A0A1R3Y5Q4	Salmonella_virus	41.9	1.1e-82
WP_088207253.1|557980_558598_-	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	67.3	1.0e-61
WP_071233435.1|558627_559092_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.3	4.2e-60
WP_088206641.1|559091_559790_-|tail	phage tail protein	tail	Q9AYZ3	Salmonella_phage	41.2	1.2e-34
WP_088207254.1|559789_561028_-	hypothetical protein	NA	Q9T1S0	Acyrthosiphon_pisum_secondary_endosymbiont_phage	68.4	1.7e-145
WP_088206642.1|561542_562040_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	61.9	7.4e-47
WP_088206643.1|562017_562221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206644.1|562273_563557_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	66.9	5.4e-166
WP_088206645.1|563556_564471_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.8	8.2e-92
WP_088206646.1|564485_566576_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.2	8.6e-238
WP_071233444.1|566578_568075_-|terminase	terminase	terminase	A0A0M4S5Z3	Salmonella_phage	85.1	3.1e-266
WP_036976889.1|568049_568541_-	DNA-packaging protein	NA	I6S1J2	Salmonella_phage	79.1	5.6e-71
WP_088206647.1|568549_568909_-	hypothetical protein	NA	R9VYK9	Serratia_phage	40.5	9.5e-20
WP_088206648.1|568963_569191_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	54.1	3.9e-11
WP_088206649.1|569402_569858_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	81.4	1.4e-55
WP_088206650.1|569854_570259_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.3	7.7e-26
WP_049221519.1|570251_570599_-|holin	holin	holin	NA	NA	NA	NA
WP_071425416.1|570752_571520_-	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_088206651.1|571838_572594_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	48.8	4.2e-49
WP_088206652.1|572793_573414_-	hypothetical protein	NA	A0A2I7RAC0	Vibrio_phage	54.1	1.6e-46
WP_088206653.1|573525_574188_-	serine/threonine-protein phosphatase	NA	K7P721	Enterobacteria_phage	61.9	9.5e-74
WP_088206654.1|574184_574397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036963872.1|574587_575037_-	hypothetical protein	NA	A0A2I7R9W3	Vibrio_phage	35.1	6.4e-13
WP_088206656.1|575060_575453_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	60.4	1.4e-45
WP_088206657.1|575449_575695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049203713.1|575681_575975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207255.1|575994_577362_-	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	64.2	2.5e-161
WP_088206658.1|577365_578202_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	52.3	1.2e-60
WP_070486784.1|578462_578843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206659.1|578977_579163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206660.1|579270_579972_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	45.8	4.4e-45
WP_088206661.1|580002_580308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064506001.1|580827_581100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049216805.1|581114_581432_+	hypothetical protein	NA	NA	NA	NA	NA
581218:581234	attL	ATGATATTTTAGAATTA	NA	NA	NA	NA
WP_061064261.1|581443_581980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206662.1|582146_582335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207256.1|582399_582588_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	54.8	4.7e-10
WP_157677989.1|582589_582733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206663.1|582807_583749_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	47.3	4.6e-21
WP_063693270.1|583971_584247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206664.1|584392_584713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206665.1|584714_585329_+	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	77.5	1.7e-85
WP_088206666.1|585328_585856_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.4	9.6e-53
WP_153274246.1|585858_586020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900985.1|586059_586260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155731339.1|586295_586469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206667.1|586478_586793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206668.1|586785_587022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206669.1|587179_587545_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_088206670.1|587548_587767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206671.1|587756_588302_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	61.5	1.8e-57
WP_036905342.1|588591_588783_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_088206673.1|588760_589936_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	76.5	5.8e-183
602401:602417	attR	ATGATATTTTAGAATTA	NA	NA	NA	NA
>prophage 3
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	674946	746980	4209445	head,protease,tRNA,holin,lysis,terminase	Pectobacterium_phage(20.93%)	82	NA	NA
WP_004248453.1|674946_675477_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_036895334.1|676028_676274_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_088206681.1|676298_676565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557908.1|676643_677381_+	glycosyltransferase family 25 protein	NA	A0A1V0SKJ4	Klosneuvirus	31.5	1.3e-07
WP_088206682.1|677414_678782_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	36.1	2.9e-16
WP_004250603.1|678787_679444_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_088206683.1|679440_680628_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	8.8e-70
WP_004250600.1|680620_680965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049221471.1|680961_681654_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.7	1.2e-29
WP_087740814.1|681656_682472_-	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.3	1.1e-10
WP_020945489.1|682437_682755_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_087740815.1|682754_683282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740816.1|683283_685635_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.8	2.6e-17
WP_004250588.1|685718_686177_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_004250586.1|686217_686670_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_088206684.1|686680_688168_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.9	6.6e-83
WP_088206685.1|688176_688692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945484.1|688678_689050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206686.1|689049_689508_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	1.1e-12
WP_088206687.1|689507_689939_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	2.6e-11
WP_004250579.1|689941_690283_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	2.7e-08
WP_004250578.1|690352_691420_-	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_036908136.1|691419_691917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036896149.1|693170_693884_-|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.7	1.1e-32
WP_088206688.1|693921_695424_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.0	6.0e-100
WP_088206689.1|695427_696825_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	2.1e-83
WP_088206690.1|697023_698043_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.9	8.4e-37
WP_088206691.1|698533_698980_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_088207258.1|698985_699339_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	79.8	5.1e-42
WP_088207259.1|699370_699676_-|holin	holin	holin	F1C5D1	Cronobacter_phage	52.4	5.1e-22
WP_088206692.1|699967_700537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207260.1|700850_701885_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.1	3.7e-141
WP_004250554.1|702039_702237_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
WP_049211165.1|702399_702933_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	51.9	6.1e-39
WP_049211163.1|702920_703232_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	5.9e-34
WP_049211162.1|703243_703837_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
WP_049211160.1|703973_704837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049211158.1|704898_705237_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.0	1.3e-29
WP_049211157.1|705292_706711_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	61.2	1.8e-170
WP_053087953.1|706700_707531_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
WP_004250533.1|707532_707757_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_020945464.1|707774_708230_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250529.1|708270_708528_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004250527.1|708632_709391_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_049199468.1|709847_710180_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.6e-05
WP_088206693.1|710192_712160_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	1.7e-118
WP_020945462.1|712159_712660_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	3.6e-41
WP_004250516.1|712707_712887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908179.1|713327_713525_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	44.4	1.2e-05
WP_036908181.1|713499_713712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049211155.1|713713_714889_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.2	2.7e-31
WP_049211154.1|715077_715950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206694.1|716596_717223_+	LysE family translocator	NA	NA	NA	NA	NA
WP_004247030.1|717335_717914_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_004247028.1|718513_718762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206695.1|718763_719510_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004247024.1|720761_721256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247023.1|721401_722157_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004247022.1|722421_723348_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	65.5	2.7e-98
WP_004247021.1|723803_724016_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	81.4	1.1e-26
WP_004247020.1|724430_725288_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247019.1|725581_725914_-	lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004247018.1|726265_727162_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026090480.1|727240_728737_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_036908191.1|729298_730102_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	39.1	1.1e-42
WP_036971038.1|730158_731055_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004247011.1|731199_731505_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_004247010.1|731504_732449_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	45.3	1.3e-07
WP_036908195.1|732804_733137_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_063215315.1|733139_733484_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_004247007.1|733717_734248_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004244693.1|734706_735036_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_088206696.1|735038_735323_-	acylphosphatase	NA	NA	NA	NA	NA
WP_036896040.1|735525_735843_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_088206697.1|735906_736320_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_004244689.1|736459_736918_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_088206698.1|736922_738974_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	5.1e-17
WP_036920066.1|741392_742007_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_004247687.1|742233_742788_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_004247686.1|743136_744225_+	porin OmpA	NA	NA	NA	NA	NA
WP_004244682.1|744389_744857_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_049210227.1|745237_746980_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	794841	872711	4209445	plate,tRNA,protease	Bacillus_phage(18.75%)	57	NA	NA
WP_004244624.1|794841_795273_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012367723.1|795280_797056_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244621.1|797019_798057_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_036932298.1|798061_799330_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|799331_799883_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_017628433.1|799875_801243_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_088206704.1|801235_801991_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_088206705.1|801999_804711_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	2.4e-83
WP_004244614.1|804714_805503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244612.1|805504_806155_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244611.1|806160_807624_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244610.1|807626_811175_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244609.1|811212_812568_+	membrane protein	NA	NA	NA	NA	NA
WP_004244608.1|812560_814297_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244607.1|814387_814861_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247640.1|814953_815604_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244605.1|815653_816202_-	YcbK family protein	NA	NA	NA	NA	NA
WP_004251995.1|816533_818249_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004247637.1|818605_819319_-	class B acid phosphatase	NA	NA	NA	NA	NA
WP_088206706.1|819542_824006_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247634.1|824002_824734_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004244597.1|824714_826037_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247633.1|826046_826820_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004247632.1|827199_828030_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244594.1|828152_828914_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004244593.1|828918_829098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247631.1|829512_829728_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_046335154.1|830223_831225_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004244589.1|831221_832967_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_088206707.1|833003_835373_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	30.5	3.6e-22
WP_004244587.1|835804_836092_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_004244586.1|836156_837830_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244585.1|838011_838689_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004252010.1|838977_840264_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244582.1|840460_841549_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_088206708.1|841685_843092_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	23.9	1.1e-05
WP_088206709.1|843228_844494_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244579.1|844568_845606_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_036971369.1|845833_847591_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244577.1|848260_849115_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_004244576.1|849169_851452_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244575.1|851559_852300_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244574.1|852657_853563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049236236.1|853635_854685_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244572.1|855085_855418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244571.1|855597_856887_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_012367706.1|857020_858370_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244569.1|858380_858986_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_088206710.1|859098_862932_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244566.1|863059_863554_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004252032.1|864096_865056_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_088206711.1|865197_866967_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004244562.1|866969_868721_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_004247616.1|868722_869415_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244560.1|869734_869953_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004244559.1|870071_872366_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244558.1|872396_872711_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
>prophage 5
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	1037873	1093293	4209445	bacteriocin,tail,integrase,tRNA,lysis,terminase	Cronobacter_phage(20.93%)	76	1039579:1039597	1093362:1093380
WP_012367653.1|1037873_1039541_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
1039579:1039597	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_088206732.1|1039785_1040016_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	9.1e-32
WP_046335368.1|1040375_1040630_-	cloacin	NA	NA	NA	NA	NA
WP_036969576.1|1040847_1041105_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_088206733.1|1041107_1043180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049202079.1|1043369_1043636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206734.1|1043632_1044319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|1044318_1044651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334564.1|1048885_1049473_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.4	2.9e-58
WP_088206735.1|1049469_1050180_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	65.5	6.8e-86
WP_088206736.1|1050176_1050920_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	6.5e-87
WP_004247516.1|1050916_1051258_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_046334562.1|1051401_1051602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245945.1|1051621_1051912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206737.1|1051923_1054854_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.9	1.8e-132
WP_088206738.1|1054914_1055736_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	52.8	3.6e-22
WP_088206739.1|1055853_1057029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206740.1|1057033_1058236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207262.1|1058478_1059231_-	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	42.8	8.4e-42
WP_088206741.1|1059350_1059923_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	53.1	2.3e-28
WP_088206742.1|1060250_1060964_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080978927.1|1061037_1061316_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.7e-13
WP_004245960.1|1061342_1061648_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_088206743.1|1061699_1062356_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.2	1.9e-58
WP_088206744.1|1062401_1062803_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_088206745.1|1062799_1063381_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	6.7e-47
WP_088206746.1|1063382_1063733_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	1.7e-21
WP_088206747.1|1063735_1064215_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.3	2.1e-30
WP_115353767.1|1064253_1064538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206748.1|1064540_1065494_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.4e-126
WP_088206749.1|1065507_1066281_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.7	7.7e-67
WP_129111976.1|1066407_1066608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206751.1|1066626_1067751_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	3.0e-104
WP_088206752.1|1067747_1069118_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.4	3.7e-120
WP_088206753.1|1069117_1070692_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	86.7	2.3e-283
WP_046334543.1|1070688_1071255_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	64.1	1.8e-57
WP_046334542.1|1071280_1071550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|1071761_1071968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334540.1|1072893_1073355_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	34.1	2.8e-08
WP_088206754.1|1073497_1073968_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.2	2.6e-49
WP_046334538.1|1073967_1074237_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_046334537.1|1074303_1074726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334536.1|1074869_1075277_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_088206755.1|1075925_1076138_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	77.1	3.4e-25
WP_063109079.1|1076718_1077177_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004247487.1|1077416_1078049_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	7.3e-23
WP_004245983.1|1078048_1078405_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245984.1|1078401_1078692_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_049195179.1|1078770_1079220_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_088206756.1|1079245_1080631_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.8e-114
WP_088206757.1|1080630_1081377_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	33.6	1.5e-22
WP_004247478.1|1081642_1081990_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004247477.1|1082135_1082345_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247476.1|1082450_1083095_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	64.5	9.6e-79
WP_004245991.1|1083103_1083445_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_060554529.1|1083565_1083826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060554528.1|1083822_1084311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206758.1|1084739_1085057_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	50.5	1.8e-17
WP_088206759.1|1085065_1085281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060554526.1|1085277_1085493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|1085678_1085831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|1085827_1086013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049206628.1|1086176_1086452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247466.1|1086574_1086802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628822.1|1087053_1087308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628824.1|1087453_1087774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628825.1|1087775_1088660_+	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	52.0	1.9e-61
WP_088206760.1|1088649_1089189_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	59.7	8.1e-55
WP_088206762.1|1089449_1089905_+	ASCH domain-containing protein	NA	M1F3E2	Salmonella_phage	25.4	3.5e-11
WP_049199156.1|1089967_1090222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206763.1|1090292_1090547_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	64.3	3.8e-23
WP_088206764.1|1090539_1090785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154599060.1|1090943_1091105_+	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	100.0	2.6e-25
WP_088206765.1|1091097_1091466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246013.1|1092089_1092335_+	excisionase	NA	NA	NA	NA	NA
WP_026164649.1|1092291_1093293_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
1093362:1093380	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 6
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	1129229	1140574	4209445		Mycobacterium_phage(25.0%)	12	NA	NA
WP_088206769.1|1129229_1130441_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.8	3.3e-104
WP_026090527.1|1130639_1130903_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|1131254_1131899_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|1132000_1132966_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|1132981_1133356_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246068.1|1133814_1134024_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|1134221_1134695_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|1134976_1135201_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|1135212_1135617_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_088206770.1|1135645_1137772_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.5	4.0e-206
WP_004247427.1|1137797_1138766_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004247426.1|1139374_1140574_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 7
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	1238076	1292872	4209445	protease,transposase,tRNA	Bacillus_phage(33.33%)	41	NA	NA
WP_004244835.1|1238076_1238796_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_004247375.1|1239011_1240052_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004244837.1|1240082_1240355_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_004244838.1|1240417_1241488_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A1P8CWQ1	Bacillus_phage	38.1	4.9e-11
WP_004247373.1|1242160_1242409_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	38.5	2.9e-07
WP_036905867.1|1242628_1242901_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004252392.1|1243127_1243397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919898.1|1243400_1243979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107034653.1|1245103_1245211_+	DUF2618 domain-containing protein	NA	NA	NA	NA	NA
WP_004252399.1|1245584_1247747_+	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_088207263.1|1247810_1249139_+	putrescine-ornithine antiporter	NA	NA	NA	NA	NA
WP_088206777.1|1249268_1249946_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036919897.1|1250213_1251473_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088206778.1|1251492_1253655_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.8	3.6e-29
WP_017827585.1|1253679_1254933_-	transporter	NA	NA	NA	NA	NA
WP_157677995.1|1255037_1261235_-	RTX toxin	NA	NA	NA	NA	NA
WP_088206779.1|1261311_1261623_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004244871.1|1262264_1263056_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004244872.1|1263029_1263887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004247356.1|1264225_1265377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206780.1|1265389_1265926_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004252417.1|1265925_1266459_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088206781.1|1266451_1266880_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004247352.1|1266911_1267643_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088206782.1|1267678_1270201_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_036919880.1|1270261_1270834_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247349.1|1271022_1271583_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004247348.1|1271732_1272017_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088206783.1|1272658_1273483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036969813.1|1273479_1273932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206784.1|1274094_1275063_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_004247346.1|1275181_1276603_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_088206785.1|1276628_1279346_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_004252426.1|1279338_1279983_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_004247343.1|1280037_1281423_+	glycoporin	NA	NA	NA	NA	NA
WP_004247342.1|1281791_1283048_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004244894.1|1283041_1283926_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088206786.1|1284392_1286342_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_088206787.1|1286647_1288612_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_088206788.1|1288842_1290906_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_004244908.1|1291396_1292872_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	2084452	2182885	4209445	head,capsid,portal,tail,protease,plate,integrase,tRNA,holin,lysis,terminase	Salmonella_phage(35.9%)	99	2138051:2138098	2169241:2169288
WP_088206898.1|2084452_2085550_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_004249699.1|2085671_2086073_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004246383.1|2086072_2086753_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_004246384.1|2086953_2088351_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004249700.1|2088342_2089260_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004246386.1|2089497_2090880_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_004246387.1|2090972_2092184_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_004246388.1|2092248_2093022_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_088206899.1|2093042_2094047_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_004249702.1|2094147_2095311_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004246391.1|2095402_2097127_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
WP_004246392.1|2097691_2098513_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_004246394.1|2098509_2098959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246396.1|2098958_2100140_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004246397.1|2100216_2101230_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004246398.1|2101999_2103502_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
WP_060555804.1|2103512_2104943_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.4	2.8e-62
WP_004249704.1|2104982_2105966_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004246402.1|2106022_2108659_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004246404.1|2109131_2109293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246405.1|2109371_2109890_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_088206900.1|2110012_2112451_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_004249706.1|2112460_2113621_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004246409.1|2113906_2114224_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_088206901.1|2114296_2115601_-	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_004246411.1|2115993_2116206_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004249709.1|2116409_2118611_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_004249710.1|2118863_2119895_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_004246415.1|2119965_2120760_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004246416.1|2120870_2121401_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004246417.1|2121413_2122754_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004249712.1|2122852_2123770_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246419.1|2123878_2124397_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_012368679.1|2124490_2124733_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246421.1|2125029_2125845_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_004246422.1|2125887_2127420_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246423.1|2127529_2128714_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_087740961.1|2129052_2129799_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_012368677.1|2129859_2130288_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_049217755.1|2130399_2131035_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_088206902.1|2131141_2131912_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_088206903.1|2132007_2133012_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004246429.1|2133305_2134283_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036895948.1|2134816_2135572_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004249719.1|2135690_2136839_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088206904.1|2136887_2137949_-	glycosyltransferase	NA	NA	NA	NA	NA
2138051:2138098	attL	AAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_088206905.1|2138293_2138998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206906.1|2139044_2139698_+	DCL family protein	NA	NA	NA	NA	NA
WP_012368178.1|2139751_2139970_-	positive regulator of phage late gene transcription	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_088206907.1|2140022_2141120_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.1	3.8e-112
WP_036907694.1|2141119_2141584_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_088206908.1|2141583_2144418_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.4	9.0e-113
WP_075204427.1|2144410_2144584_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_088206909.1|2144544_2144892_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.4	1.2e-19
WP_088206910.1|2144911_2145427_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.9	4.5e-55
WP_088206911.1|2145430_2146603_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.9	6.5e-166
WP_088206912.1|2146698_2148330_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	72.4	1.8e-57
WP_036907674.1|2148319_2148931_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	1.1e-76
WP_088206913.1|2148923_2149832_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.3e-108
WP_071233987.1|2149833_2150172_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.5	3.8e-26
WP_088206914.1|2150168_2150795_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.3	2.0e-57
WP_088206915.1|2150860_2151496_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	7.6e-28
WP_088206916.1|2151485_2151923_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	49.3	9.2e-33
WP_088206917.1|2151897_2152401_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.9e-05
WP_088206918.1|2152397_2152802_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	7.9e-39
WP_012368194.1|2152794_2153109_-|holin	holin	holin	NA	NA	NA	NA
WP_088206919.1|2153128_2153335_-|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	52.9	8.1e-16
WP_049220085.1|2153334_2153790_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_088206920.1|2153867_2154536_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.2	2.1e-44
WP_088206921.1|2154535_2155681_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	8.9e-128
WP_012368199.1|2155696_2156506_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	49.1	8.9e-66
WP_088206922.1|2156678_2158433_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.2	8.8e-260
WP_088206923.1|2158432_2159461_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.2	5.5e-137
WP_088206925.1|2159872_2160337_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088206926.1|2160371_2161013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088206927.1|2161017_2162016_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_088206928.1|2164660_2164984_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_088206929.1|2164983_2165811_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	5.2e-61
WP_088206930.1|2165812_2166034_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	50.7	2.6e-12
WP_012368209.1|2166026_2166284_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_049220105.1|2166301_2166697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908537.1|2166746_2167022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|2167031_2167184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220106.1|2167180_2167369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908542.1|2167370_2167661_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	1.1e-31
WP_036908544.1|2167765_2168071_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
WP_036908546.1|2168137_2169109_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	1.6e-117
WP_004249721.1|2169385_2169952_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
2169241:2169288	attR	AAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_004246432.1|2170135_2170834_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004246433.1|2170846_2172235_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_088206931.1|2173477_2174236_+	DUF707 domain-containing protein	NA	NA	NA	NA	NA
WP_157677997.1|2174732_2176145_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_088206933.1|2176148_2177324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206934.1|2177331_2178381_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088206935.1|2178383_2179190_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_088206936.1|2179261_2180020_+	glycosyltransferase	NA	A0A1V0SAG8	Catovirus	28.6	2.0e-06
WP_088206937.1|2180022_2180970_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_049213610.1|2181203_2182370_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	5.0e-118
WP_004246449.1|2182381_2182885_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	2728249	2786044	4209445	head,portal,tail,holin,integrase,tRNA,capsid,terminase	Cronobacter_phage(60.61%)	60	2737664:2737681	2780446:2780463
WP_004245894.1|2728249_2729284_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004245893.1|2729716_2730781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245892.1|2730943_2732281_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
WP_004245891.1|2732724_2733840_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004250112.1|2733823_2734684_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245888.1|2734680_2735460_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004245887.1|2735576_2736620_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245886.1|2736752_2737070_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004250113.1|2737096_2738170_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
2737664:2737681	attL	TTTATCTGTCACCACAAA	NA	NA	NA	NA
WP_036895723.1|2738169_2738688_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088206997.1|2740157_2741189_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.7	2.4e-124
WP_036907222.1|2741193_2741616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124619.1|2741630_2742221_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	34.3	1.6e-27
WP_036907225.1|2742370_2742595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206998.1|2742624_2743134_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	50.3	1.7e-38
WP_088206999.1|2743298_2743646_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	41.8	2.5e-17
WP_036907235.1|2743722_2743974_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_088207000.1|2743975_2746168_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.4	1.4e-206
WP_036907243.1|2746486_2746669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907246.1|2746670_2746979_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	60.4	2.1e-28
WP_088207266.1|2746975_2747947_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.8	1.5e-128
WP_036907251.1|2748009_2749797_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.8	2.6e-227
WP_071233403.1|2749958_2750795_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	41.3	9.6e-47
WP_036907256.1|2750805_2751837_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	69.9	1.7e-130
WP_049212293.1|2751842_2752547_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	54.3	1.3e-65
WP_036907264.1|2752881_2753334_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	2.4e-36
WP_088207002.1|2753330_2753807_+|tail	phage tail protein	tail	Q1I0Z6	Pasteurella_virus	25.3	1.0e-08
WP_071233401.1|2753803_2754502_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.7	1.5e-64
WP_071233400.1|2754516_2755635_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	64.9	1.8e-133
WP_036907273.1|2755634_2756087_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
WP_036907276.1|2756101_2756395_+|holin	holin	holin	S4TP56	Salmonella_phage	51.2	1.1e-16
WP_071233399.1|2756391_2756817_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	48.9	1.9e-27
WP_071233398.1|2756813_2757188_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.2	1.3e-22
WP_036907284.1|2757296_2757566_+	phage gene	NA	A5X9I7	Aeromonas_virus	49.4	1.3e-16
WP_088207003.1|2757753_2760270_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	44.5	5.2e-128
WP_049219617.1|2760280_2760616_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	69.0	7.0e-33
WP_071233396.1|2760605_2761790_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	66.1	1.2e-151
WP_049212312.1|2761782_2762340_+	protein phage	NA	F1BUK5	Cronobacter_phage	64.1	2.8e-66
WP_088207004.1|2762343_2764296_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	61.0	2.4e-109
WP_088207005.1|2764299_2765022_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.2	1.2e-34
WP_088207006.1|2764993_2765578_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.6	1.1e-41
WP_088207007.1|2765581_2767228_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	52.7	2.7e-146
WP_071233392.1|2767239_2767458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071233391.1|2767450_2767654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207008.1|2768587_2769820_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004245879.1|2769856_2770534_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004245878.1|2770632_2771193_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004245877.1|2772062_2772998_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_004250120.1|2773186_2774461_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
WP_004245875.1|2774891_2775485_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017827350.1|2775505_2776366_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245872.1|2776365_2776884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249182.1|2777467_2777746_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245870.1|2777766_2778051_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245869.1|2778065_2778344_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004249183.1|2778411_2780064_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_004245867.1|2780090_2780354_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_004245865.1|2780361_2781510_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
2780446:2780463	attR	TTTGTGGTGACAGATAAA	NA	NA	NA	NA
WP_088207009.1|2781561_2784990_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_004245863.1|2785093_2786044_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 10
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	3075837	3084687	4209445		Caulobacter_phage(50.0%)	9	NA	NA
WP_012368339.1|3075837_3076983_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	26.9	3.5e-31
WP_004250201.1|3077375_3077960_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_088207047.1|3077960_3079103_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245607.1|3079127_3079583_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004249445.1|3079617_3080643_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|3080710_3081289_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|3081365_3081941_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004245602.1|3082037_3082718_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245601.1|3083118_3084687_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 11
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	3318449	3389073	4209445	head,capsid,portal,tail,protease,integrase,tRNA,holin,transposase,lysis,terminase	Proteus_phage(20.0%)	76	3345807:3345830	3389099:3389122
WP_088207071.1|3318449_3319658_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.8e-187
WP_004244272.1|3319873_3321538_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004248647.1|3321661_3322141_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_088207072.1|3322188_3322998_-	polysaccharide biosynthesis protein GumN	NA	NA	NA	NA	NA
WP_088207073.1|3323123_3324653_-	adhesin	NA	NA	NA	NA	NA
WP_088207074.1|3324988_3327943_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.5	1.5e-115
WP_004244266.1|3328077_3328479_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004250295.1|3328444_3328966_-	NfeD family protein	NA	NA	NA	NA	NA
WP_004244263.1|3328968_3329892_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004244262.1|3329931_3330789_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_060555668.1|3330874_3331660_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.4	2.9e-05
WP_036907491.1|3331710_3332340_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004250296.1|3332310_3332997_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-31
WP_060555667.1|3332993_3335435_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004244256.1|3335534_3336560_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_004250299.1|3336637_3337906_-	MFS transporter	NA	NA	NA	NA	NA
WP_088207075.1|3338029_3339097_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004248640.1|3339093_3339615_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004244250.1|3339747_3340470_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004244249.1|3340482_3340977_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004244247.1|3341368_3342760_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
WP_004248638.1|3342825_3343767_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244244.1|3344403_3344616_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004248636.1|3344619_3345492_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.8	7.4e-34
3345807:3345830	attL	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
WP_088207076.1|3345835_3346024_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088207078.1|3346254_3346788_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	34.8	3.7e-20
WP_088207079.1|3346787_3347540_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	61.7	9.4e-86
WP_088207080.1|3347549_3348035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207267.1|3348031_3348241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207081.1|3348224_3348578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207082.1|3348652_3349075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207083.1|3349118_3349370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207084.1|3349369_3349771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207086.1|3350128_3350335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071425828.1|3350711_3351761_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	57.3	2.4e-111
WP_088207087.1|3351757_3352216_-	hypothetical protein	NA	G9L674	Escherichia_phage	69.1	1.2e-51
WP_088207088.1|3352320_3352662_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	63.7	5.6e-38
WP_075673927.1|3352670_3353315_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	70.8	2.4e-77
WP_088207089.1|3353419_3353692_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	67.7	1.4e-18
WP_083629123.1|3353684_3353933_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	4.0e-17
WP_088207090.1|3354189_3355755_+	helicase	NA	A0A286N2P9	Klebsiella_phage	68.3	2.2e-217
WP_088207091.1|3355751_3356726_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	54.5	1.0e-103
WP_075673909.1|3356725_3357109_+	antitermination protein	NA	A0A088CD47	Shigella_phage	72.2	4.2e-50
WP_036934641.1|3357349_3358516_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	8.6e-86
WP_036934638.1|3359158_3359476_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	61.0	1.3e-31
WP_036934635.1|3359468_3359888_+	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.4	5.7e-24
WP_036934633.1|3360087_3360666_+	antirepressor	NA	A0A0H4IQ87	Shigella_phage	67.7	1.9e-70
WP_081355115.1|3360736_3361111_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	40.2	1.1e-13
WP_036934630.1|3362104_3362608_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	52.7	2.2e-22
WP_088207092.1|3362611_3362950_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	69.7	2.9e-42
WP_006537822.1|3363067_3363535_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_088207093.1|3363488_3365231_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.1	5.0e-146
WP_072071165.1|3365231_3366554_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	77.0	9.1e-201
WP_072071164.1|3366559_3367411_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	84.3	3.5e-129
WP_072071163.1|3367422_3368637_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	89.4	1.9e-200
WP_072071162.1|3368682_3368877_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	73.5	2.0e-11
WP_058336093.1|3368876_3369203_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	75.0	5.8e-40
WP_072071161.1|3369211_3369541_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	37.8	3.3e-11
WP_072062637.1|3369530_3370004_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	1.1e-10
WP_088207094.1|3370009_3370351_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_072071178.1|3370360_3371026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900961.1|3371089_3371506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072071177.1|3371502_3371781_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_072071176.1|3371821_3375109_+|tail	phage tail tape measure protein	tail	Q8W6T6	Burkholderia_virus	40.2	9.6e-50
WP_088207095.1|3375109_3375706_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	1.6e-51
WP_004251702.1|3375705_3376287_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	4.0e-52
WP_088207096.1|3376304_3376856_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	43.8	1.4e-30
WP_088207097.1|3376924_3377323_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	3.2e-32
WP_088207098.1|3377322_3380505_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	50.8	3.9e-197
WP_088207099.1|3380508_3381510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919964.1|3381532_3381838_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020946065.1|3381938_3383021_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_088207100.1|3383030_3385565_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_041701675.1|3385574_3386300_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_088207101.1|3386365_3386911_-	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
WP_036935173.1|3387846_3389073_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.9	3.3e-35
3389099:3389122	attR	TGCGGGTCAAGTAACGGGTCAAGT	NA	NA	NA	NA
>prophage 12
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	3670581	3721854	4209445	head,integrase,tRNA,holin,lysis,terminase	Burkholderia_phage(23.08%)	65	3681563:3681579	3723288:3723304
WP_004243900.1|3670581_3671340_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_088207131.1|3671640_3672219_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_004243897.1|3672220_3672880_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004243896.1|3672928_3673900_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004243895.1|3673912_3674377_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_004243894.1|3674697_3676494_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_004248458.1|3676508_3677480_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004248457.1|3677675_3678356_+	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004243892.1|3678352_3679261_+	GTPase Era	NA	NA	NA	NA	NA
WP_004248456.1|3679273_3680014_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_017827085.1|3680083_3680815_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017827086.1|3680814_3681195_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004250506.1|3681224_3681485_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.8	2.7e-16
3681563:3681579	attL	TGTGTTTTTATACAGTA	NA	NA	NA	NA
WP_004250508.1|3681701_3683102_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004250509.1|3683098_3683374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895412.1|3683987_3684167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895410.1|3684214_3684715_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	1.6e-41
WP_049211156.1|3684714_3686682_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.6	5.8e-119
WP_004250523.1|3686694_3686955_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_088207132.1|3686954_3687287_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	37.1	6.1e-05
WP_088207133.1|3687767_3688460_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.8	3.1e-51
WP_049219173.1|3688566_3688812_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_036895397.1|3688860_3689316_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.4	5.8e-30
WP_004250533.1|3689333_3689558_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_088207134.1|3689559_3690411_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	55.3	1.4e-32
WP_036895392.1|3690403_3690997_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_101495146.1|3690986_3692363_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_036908161.1|3692556_3693225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207135.1|3693238_3694450_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_004250549.1|3694524_3695118_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.5e-57
WP_071425521.1|3695129_3695441_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.0e-33
WP_088207136.1|3695475_3696024_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	6.3e-31
WP_020945472.1|3696151_3696472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335182.1|3696606_3696804_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	63.5	9.2e-09
WP_088207269.1|3696958_3697996_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.7	7.5e-142
WP_049221519.1|3698263_3698611_+|holin	holin	holin	NA	NA	NA	NA
WP_088207137.1|3698603_3699008_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	8.5e-25
WP_088207138.1|3699004_3699442_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.7	6.6e-23
WP_088207139.1|3699438_3699915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207140.1|3699904_3700402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207141.1|3700444_3700828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088207142.1|3701217_3702237_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.9	8.4e-37
WP_088207143.1|3702435_3703833_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.0	4.8e-83
WP_088206688.1|3703836_3705339_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.0	6.0e-100
WP_036896149.1|3705376_3706090_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.7	1.1e-32
WP_088207144.1|3706086_3707346_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_036908136.1|3707345_3707843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740818.1|3707842_3708910_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	8.8e-53
WP_060556539.1|3708979_3709321_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.2e-08
WP_080047799.1|3709323_3709755_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
WP_004250581.1|3709754_3710213_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|3710212_3710584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557411.1|3710570_3711086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206684.1|3711094_3712582_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.9	6.6e-83
WP_004250586.1|3712592_3713045_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|3713085_3713544_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_087740816.1|3713627_3715979_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.8	2.6e-17
WP_087740815.1|3715980_3716508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|3716507_3716825_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_087740814.1|3716790_3717606_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.3	1.1e-10
WP_036908120.1|3717608_3718301_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|3718297_3718642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740813.1|3718634_3719822_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.3	1.1e-69
WP_004250603.1|3719818_3720475_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_087740812.1|3720480_3721854_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	38.0	2.2e-16
3723288:3723304	attR	TGTGTTTTTATACAGTA	NA	NA	NA	NA
>prophage 13
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	3799324	3873678	4209445	head,portal,tail,integrase,protease,tRNA,capsid,transposase,lysis,terminase	Salmonella_phage(25.58%)	87	3793432:3793448	3840806:3840822
3793432:3793448	attL	TATTTATCAAATGATAA	NA	NA	NA	NA
WP_004247117.1|3799324_3800428_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|3800532_3800985_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|3800977_3801607_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|3801745_3802999_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|3803119_3804247_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|3804227_3804470_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|3804531_3805062_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|3805118_3805946_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_088207155.1|3806011_3806386_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_049255036.1|3806593_3806797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900926.1|3807049_3807793_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_036900929.1|3807779_3808715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049213205.1|3808796_3809471_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	75.6	1.1e-88
WP_036900931.1|3809566_3809794_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	1.8e-11
WP_004251663.1|3809832_3810495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251662.1|3810510_3810969_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	48.2	6.9e-31
WP_004251656.1|3811224_3811404_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.8e-11
WP_004251644.1|3811416_3812508_+	hypothetical protein	NA	H2DE83	Erwinia_phage	54.4	5.3e-29
WP_004247134.1|3812676_3813384_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_088207156.1|3813383_3814409_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	3.7e-85
WP_049211559.1|3814436_3815117_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	50.0	3.6e-52
WP_126656782.1|3815293_3815473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251614.1|3815987_3816410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251611.1|3816462_3816732_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	52.3	6.7e-18
WP_088207157.1|3816731_3817202_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	7.5e-49
WP_004250565.1|3817344_3817806_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_088207158.1|3818454_3818967_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	60.6	8.2e-57
WP_049212505.1|3819049_3819334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207159.1|3819377_3819728_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.0	3.9e-58
WP_049212502.1|3819724_3820126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207160.1|3820312_3820807_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	74.4	9.9e-68
WP_088207161.1|3820803_3822534_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	81.6	2.3e-292
WP_049212495.1|3822543_3822723_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	54.7	1.7e-09
WP_049212492.1|3822722_3823952_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	72.7	1.9e-176
WP_088207162.1|3823923_3824574_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.1	4.8e-94
WP_088207163.1|3824587_3825796_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	69.8	6.2e-156
WP_049212482.1|3825877_3826186_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.2	4.8e-12
WP_088207164.1|3826182_3826512_+|head	phage head closure protein	head	A0A0R6PHN1	Moraxella_phage	30.9	7.9e-05
WP_088207165.1|3826501_3826975_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	32.1	8.7e-13
WP_088207166.1|3826980_3827322_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251580.1|3827331_3827997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207167.1|3828061_3828478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336097.1|3828474_3828750_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_088207168.1|3828790_3832078_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	47.0	5.4e-53
WP_088207169.1|3832078_3832675_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	9.2e-52
WP_049206482.1|3832674_3833256_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	5.3e-52
WP_049206484.1|3833274_3833823_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	38.4	5.2e-25
WP_088207170.1|3833891_3834290_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	2.4e-32
WP_017627865.1|3837965_3838298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|3838297_3838984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049202079.1|3838980_3839247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|3839263_3839524_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905765.1|3840227_3840533_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157673314.1|3841622_3842903_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
3840806:3840822	attR	TATTTATCAAATGATAA	NA	NA	NA	NA
WP_004247902.1|3844419_3844584_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_157677999.1|3844978_3845116_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	81.4	7.8e-15
WP_088207171.1|3845290_3846004_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036969579.1|3847066_3847225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088207172.1|3847543_3848749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207173.1|3849007_3850213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247906.1|3851497_3852622_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|3853061_3853274_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_004242516.1|3853605_3854064_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004242517.1|3854554_3855016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247909.1|3855138_3855513_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004242519.1|3855602_3856451_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004242521.1|3856691_3856889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251489.1|3856912_3857455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090443.1|3858295_3858610_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012367820.1|3858985_3859246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247912.1|3859254_3859896_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004251487.1|3859908_3861135_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
WP_004247914.1|3861692_3862355_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012367822.1|3862917_3863274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088207174.1|3863931_3864927_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004242534.1|3865811_3866033_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|3866458_3866740_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_062814330.1|3867108_3867522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|3867549_3867792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247920.1|3867854_3868415_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|3868790_3868988_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|3869005_3869782_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|3870016_3870400_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004247922.1|3870542_3871406_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|3871516_3871948_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_088207175.1|3872066_3872483_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.2e-44
WP_088207176.1|3872505_3873678_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	78.8	3.9e-179
>prophage 14
NZ_CP021852	Proteus mirabilis strain AR_0156 chromosome, complete genome	4209445	4093652	4103644	4209445		Escherichia_phage(66.67%)	8	NA	NA
WP_004242885.1|4093652_4095710_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_088207217.1|4095721_4097422_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|4097757_4098444_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_049203322.1|4098443_4098905_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	33.8	2.6e-14
WP_088207218.1|4098957_4099569_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	5.6e-28
WP_088207219.1|4099708_4100569_-	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	2.8e-25
WP_004242892.1|4100570_4101188_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|4101199_4103644_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 1
NZ_CP021853	Proteus mirabilis strain AR_0156 plasmid unitig_1, complete sequence	180262	62654	96996	180262	integrase,transposase	Escherichia_phage(46.67%)	29	62603:62662	88523:89344
62603:62662	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|62654_63359_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
62603:62662	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_088207272.1|63370_63910_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	95.8	7.7e-82
WP_004152391.1|65024_66740_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|66849_69879_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|69985_71011_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|71007_71787_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|72173_73055_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|73304_74624_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_032640602.1|77669_78638_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_088207273.1|78918_79923_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|80001_80559_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|80552_80924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|80920_81421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|81417_81744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|81998_82355_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|82621_83326_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002075255.1|83423_84437_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
83319:84138	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGCCCTACCTCTCACTAGTGAGGGGCGGCAGCGCATCAAGCGGTGAGCGCACTCCGGCACCGCCAACTTTCAGCACATGCGTGTAAATCATCGTCGTAGAGACGTCGGAATGGCCGAGCAGATCCTGCACGGTTCGAATGTCGTAACCGCTGCGGAGCAAGGCCGTCGCGAACGAGTGGCGGAGGGTGTGCGGTGTGGCGGGCTTCGTGATGCCTGCTTGTTCTACGGCACGTTTGAAGGCGCGCTGAAAGGTCTGGTCATACATGTGATGGCGACGCACGACACCGCTCCGTGGATCGGTCGAATGCGTGTGCTGCGCAAAAACCCAGAACCACGGCCAGGAATGCCCGGCGCGCGGATACTTCCGCTCAAGGGCGTCGGGAAGCGCAACGCCGCTGCGGCCCTCGGCCTGGTCCTTCAGCCACCATGCCCGTGCACGCGACAGCTGCTCGCGCAGGCTGGGTGCCAAGCTCTCGGGTAACATCAAGGCCCGATCCTTGGAGCCCTTGCCCTCCCGCACGATGATCGTGCCGTGATCGAAATCCAGATCCTTGACCCGCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGGATGCGAACCACTTCATCCGGGGTCAGCACCACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTCCTGAAGC	NA	NA	NA	NA
WP_032488579.1|84637_85192_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
83319:84138	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGCCCTACCTCTCACTAGTGAGGGGCGGCAGCGCATCAAGCGGTGAGCGCACTCCGGCACCGCCAACTTTCAGCACATGCGTGTAAATCATCGTCGTAGAGACGTCGGAATGGCCGAGCAGATCCTGCACGGTTCGAATGTCGTAACCGCTGCGGAGCAAGGCCGTCGCGAACGAGTGGCGGAGGGTGTGCGGTGTGGCGGGCTTCGTGATGCCTGCTTGTTCTACGGCACGTTTGAAGGCGCGCTGAAAGGTCTGGTCATACATGTGATGGCGACGCACGACACCGCTCCGTGGATCGGTCGAATGCGTGTGCTGCGCAAAAACCCAGAACCACGGCCAGGAATGCCCGGCGCGCGGATACTTCCGCTCAAGGGCGTCGGGAAGCGCAACGCCGCTGCGGCCCTCGGCCTGGTCCTTCAGCCACCATGCCCGTGCACGCGACAGCTGCTCGCGCAGGCTGGGTGCCAAGCTCTCGGGTAACATCAAGGCCCGATCCTTGGAGCCCTTGCCCTCCCGCACGATGATCGTGCCGTGATCGAAATCCAGATCCTTGACCCGCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGGATGCGAACCACTTCATCCGGGGTCAGCACCACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTCCTGAAGC	NA	NA	NA	NA
WP_012695455.1|85419_86160_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_077249983.1|86146_87655_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_001067855.1|87814_88519_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|88530_89187_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|89282_90467_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|90561_91671_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|92160_92865_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_064717956.1|92889_93627_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214119.1|93843_95058_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	4.2e-19
WP_001255015.1|95085_95391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|95502_96996_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
