The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	284964	325402	3425977	tail,transposase,terminase,head	Sinorhizobium_phage(58.82%)	54	NA	NA
WP_088203129.1|284964_286098_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	39.1	2.0e-63
WP_088203130.1|286336_286552_+	hypothetical protein	NA	A0A076G6Y4	Sinorhizobium_phage	71.8	1.3e-08
WP_088203131.1|286887_287283_+	hypothetical protein	NA	M9Q2G6	Clostridium_phage	40.3	9.2e-08
WP_088203132.1|287224_288001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203133.1|287997_288399_+	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_088203134.1|288411_289017_+	hypothetical protein	NA	A0A076G6H3	Sinorhizobium_phage	46.7	1.7e-16
WP_088203135.1|289155_289383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203136.1|289452_289704_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_017265617.1|289745_289931_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_017265615.1|290201_290477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014529537.1|290499_291000_+|terminase	terminase small subunit	terminase	A0A076GD11	Sinorhizobium_phage	44.4	3.2e-29
WP_038439132.1|291003_292335_+	DNA-packaging protein	NA	Q1WDG8	Streptomyces_phage	32.8	5.8e-38
WP_088203137.1|292343_293726_+	DUF1073 domain-containing protein	NA	L7TRA1	Rhizobium_phage	51.3	1.7e-128
WP_088203138.1|293712_294279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203139.1|294334_295480_+	DUF2213 domain-containing protein	NA	A0A2R3UA67	Siphoviridae_environmental_samples	47.4	5.0e-78
WP_088203140.1|295492_295963_+	hypothetical protein	NA	A0A2H4J1G1	uncultured_Caudovirales_phage	60.6	1.0e-37
WP_088203141.1|295988_296957_+	DUF2184 domain-containing protein	NA	A0A2H4J526	uncultured_Caudovirales_phage	75.9	3.8e-140
WP_088203142.1|296971_297313_+	hypothetical protein	NA	A0A2H4J908	uncultured_Caudovirales_phage	52.5	8.0e-08
WP_088203143.1|297364_297859_+	hypothetical protein	NA	A0A059VG19	Pseudomonas_phage	42.8	6.5e-19
WP_088203389.1|297882_298044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203144.1|298124_298490_+	hypothetical protein	NA	A0A076G8G5	Sinorhizobium_phage	76.8	7.4e-44
WP_088203145.1|298787_299297_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	36.2	5.7e-18
WP_088203146.1|299375_300413_+|head	head morphogenesis protein	head	A0A076G6I6	Sinorhizobium_phage	50.0	2.2e-77
WP_088203147.1|300412_300859_+	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	37.1	1.6e-16
WP_088203148.1|301065_301491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017272431.1|301492_301978_+	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	30.7	9.3e-10
WP_017272432.1|301992_302394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017272451.1|302489_302723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203149.1|302719_303394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203150.1|303514_303910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203151.1|303970_306067_+|tail	phage tail tape-measure protein	tail	A0A076G7H2	Sinorhizobium_phage	63.2	6.8e-17
WP_014529559.1|306063_306459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017275434.1|306522_307176_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	56.0	3.0e-56
WP_088194463.1|307172_307763_+	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	69.0	3.2e-73
WP_088203152.1|307862_308267_+	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	71.6	1.6e-47
WP_088203153.1|308273_311021_+|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	60.6	1.3e-254
WP_088203154.1|311020_312541_+	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	80.6	6.9e-245
WP_088203155.1|312552_314574_+|tail	tail fiber domain-containing protein	tail	A0A2L2R219	Sinorhizobium_phage	31.1	1.8e-54
WP_127570040.1|314725_315172_-	hypothetical protein	NA	A0A291AUP2	Sinorhizobium_phage	59.8	2.0e-27
WP_017266899.1|315919_316180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203157.1|316275_316545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203158.1|316722_317691_+	glycoside hydrolase family 19 protein	NA	A0A076G6J8	Sinorhizobium_phage	87.3	3.1e-166
WP_088203159.1|317690_318008_+	ammonia monooxygenase	NA	A0A291AUV3	Sinorhizobium_phage	65.1	1.9e-35
WP_088203160.1|318007_318292_+	hypothetical protein	NA	A0A076G8H8	Sinorhizobium_phage	62.8	1.9e-26
WP_088203161.1|318182_318437_+	hypothetical protein	NA	A0A076G7I0	Sinorhizobium_phage	73.5	2.4e-25
WP_088203162.1|318495_318861_+	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	71.7	9.0e-42
WP_088203391.1|319505_319709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203163.1|320522_320696_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_088203164.1|320839_321208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203165.1|321404_322439_+	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	69.6	1.2e-128
WP_088203166.1|322447_322867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010969659.1|323463_323925_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	43.4	2.6e-17
WP_088203393.1|323929_324118_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PJD4	Moraxella_phage	58.3	3.1e-14
WP_088203167.1|324183_325402_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	53.5	9.3e-75
>prophage 2
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	865189	876438	3425977	tRNA	uncultured_Mediterranean_phage(80.0%)	12	NA	NA
WP_010969286.1|865189_866728_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	32.8	1.0e-14
WP_010969285.1|867051_867705_-	biotin transport regulator	NA	NA	NA	NA	NA
WP_014526709.1|867876_868530_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.6	2.6e-15
WP_010969283.1|868526_869297_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.9	1.5e-22
WP_003534571.1|869324_870608_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.0	8.0e-101
WP_003534569.1|870744_871587_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.2	1.7e-43
WP_010969282.1|871583_872231_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003534564.1|872304_872511_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.9	8.2e-08
WP_010969280.1|872605_873715_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.4e-29
WP_010969279.1|873779_874499_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.2	9.8e-40
WP_086017693.1|874491_875310_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.7	1.7e-32
WP_010969277.1|875403_876438_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	2.0e-22
>prophage 3
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	1374931	1380029	3425977		Sinorhizobium_phage(50.0%)	7	NA	NA
WP_010969011.1|1374931_1375228_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	49.0	6.7e-19
WP_010969010.1|1375241_1375550_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.6	1.9e-08
WP_088203195.1|1376129_1377164_-	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	66.7	1.1e-124
WP_088203197.1|1377370_1377739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014526862.1|1378273_1378639_-	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	71.7	1.2e-41
WP_088203198.1|1378697_1378940_-	hypothetical protein	NA	J7F8X5	Agrobacterium_phage	61.2	1.3e-15
WP_088203199.1|1379060_1380029_-	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	88.6	1.1e-166
>prophage 4
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	1385086	1424760	3425977	tail,terminase,head	Sinorhizobium_phage(78.38%)	54	NA	NA
WP_088203205.1|1385086_1387681_-	hypothetical protein	NA	A0A076G8H4	Sinorhizobium_phage	62.7	2.0e-239
WP_088203206.1|1387677_1388097_-	hypothetical protein	NA	A0A076G6J4	Sinorhizobium_phage	51.9	1.4e-35
WP_088203207.1|1388099_1388705_-	hypothetical protein	NA	A0A076G707	Sinorhizobium_phage	72.9	4.2e-84
WP_088203208.1|1388704_1389439_-	hypothetical protein	NA	A0A076GD29	Sinorhizobium_phage	68.4	2.6e-96
WP_088203209.1|1389442_1392319_-|tail	phage tail tape measure protein	tail	A0A076G7H2	Sinorhizobium_phage	56.1	4.6e-258
WP_088203210.1|1392325_1392571_-	hypothetical protein	NA	A0A076G6J1	Sinorhizobium_phage	79.5	7.4e-32
WP_027991937.1|1392666_1393080_-	hypothetical protein	NA	A0A076G701	Sinorhizobium_phage	81.3	1.2e-53
WP_088203211.1|1393079_1393817_-	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	84.1	4.4e-112
WP_088203212.1|1393873_1394317_-	hypothetical protein	NA	A0A076G7G6	Sinorhizobium_phage	52.4	6.2e-37
WP_027991940.1|1394492_1394975_-	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	76.9	7.7e-65
WP_088203396.1|1394974_1395973_-|head	head morphogenesis protein	head	A0A076G6I6	Sinorhizobium_phage	85.5	5.0e-159
WP_088203213.1|1396030_1396294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203214.1|1396795_1397161_-	hypothetical protein	NA	A0A076G8G5	Sinorhizobium_phage	83.3	1.5e-52
WP_088203215.1|1397290_1397728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203216.1|1397728_1398220_-	hypothetical protein	NA	A0A076G6I4	Sinorhizobium_phage	84.0	3.2e-74
WP_015007394.1|1398223_1398547_-	hypothetical protein	NA	A0A076G6Z4	Sinorhizobium_phage	57.0	1.2e-26
WP_003528159.1|1398603_1399653_-	hypothetical protein	NA	A0A076GD16	Sinorhizobium_phage	74.1	4.9e-149
WP_088203217.1|1399667_1400120_-	hypothetical protein	NA	A0A076G7F5	Sinorhizobium_phage	70.0	4.1e-52
WP_015007393.1|1400122_1401238_-	hypothetical protein	NA	A0A076G8G2	Sinorhizobium_phage	74.3	3.5e-145
WP_088203218.1|1401234_1402605_-	DUF1073 domain-containing protein	NA	A0A076G6H8	Sinorhizobium_phage	73.6	1.4e-199
WP_088203219.1|1402601_1404014_-|terminase	phage terminase large subunit	terminase	A0A0S4KXH6	Pseudomonas_phage	37.6	1.3e-80
WP_088203220.1|1404000_1404465_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	50.0	2.0e-30
WP_153497550.1|1404483_1405110_-	hypothetical protein	NA	F1C5D5	Cronobacter_phage	43.7	1.2e-41
WP_088203223.1|1405447_1405594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203224.1|1406043_1406655_-	hypothetical protein	NA	A0A076G6H3	Sinorhizobium_phage	39.0	1.3e-32
WP_088203225.1|1406788_1407316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203226.1|1407312_1407741_-	GcrA cell cycle regulator	NA	NA	NA	NA	NA
WP_088203227.1|1407737_1408514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203228.1|1408455_1409349_-	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	67.8	7.9e-47
WP_088203229.1|1409272_1410487_-	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	80.5	7.8e-199
WP_088203230.1|1410483_1410837_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_088203231.1|1410833_1413335_-	DNA methylase N-4	NA	A0A1J0GPR3	Mycobacterium_phage	63.4	0.0e+00
WP_088203232.1|1413331_1414099_-	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	68.9	4.2e-89
WP_086017944.1|1414095_1414500_-	hypothetical protein	NA	A0A076G6G6	Sinorhizobium_phage	80.6	2.0e-50
WP_088203234.1|1415079_1416036_-	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	87.7	4.5e-32
WP_088203235.1|1416632_1416881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015007369.1|1416883_1417081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015007368.1|1417175_1417928_+	helix-turn-helix domain-containing protein	NA	A0A291AUK0	Sinorhizobium_phage	57.7	2.3e-68
WP_015007367.1|1417937_1418219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203236.1|1418812_1419127_+	hypothetical protein	NA	A0A076GCZ5	Sinorhizobium_phage	56.0	3.4e-21
WP_088203237.1|1419123_1419447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203238.1|1419443_1419887_+	hypothetical protein	NA	F8TUU3	EBPR_podovirus	55.4	7.6e-19
WP_088197251.1|1419895_1420162_+	hypothetical protein	NA	A0A076GCZ2	Sinorhizobium_phage	81.8	5.9e-35
WP_088203239.1|1420158_1420395_+	hypothetical protein	NA	A0A076G7C7	Sinorhizobium_phage	61.5	8.2e-20
WP_088203240.1|1420396_1420927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203241.1|1420929_1421901_+	phage recombination protein Bet	NA	NA	NA	NA	NA
WP_088203242.1|1421902_1422424_+	hypothetical protein	NA	B0VK83	Azospirillum_phage	44.3	1.6e-31
WP_088203243.1|1422420_1422672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013844161.1|1422668_1422887_+	hypothetical protein	NA	A0A076G6F8	Sinorhizobium_phage	62.0	2.5e-15
WP_088203244.1|1422883_1423096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203245.1|1423092_1423521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203246.1|1423517_1423856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203247.1|1423852_1424218_+	hypothetical protein	NA	Q8W6F3	Sinorhizobium_phage	74.2	1.6e-46
WP_088203248.1|1424214_1424760_+	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	48.3	1.3e-23
>prophage 5
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	1596985	1634163	3425977	portal,head,integrase,protease,tail	Sinorhizobium_phage(40.0%)	41	1632504:1632527	1642056:1642079
WP_013844108.1|1596985_1598401_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_010968898.1|1598504_1599704_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010968897.1|1599837_1600518_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	8.2e-12
WP_010968896.1|1600511_1601117_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_010968895.1|1601148_1601712_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_013844107.1|1601716_1603213_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	1.2e-15
WP_014526637.1|1603196_1604390_+	thiolase family protein	NA	NA	NA	NA	NA
WP_010968892.1|1604377_1604779_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010968891.1|1604792_1605761_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010968890.1|1605823_1606753_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	4.8e-47
WP_003535810.1|1606756_1607008_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003535807.1|1607224_1608148_+	pirin family protein	NA	NA	NA	NA	NA
WP_010968889.1|1608344_1610282_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_013844547.1|1611548_1611905_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	84.7	1.5e-46
WP_013844548.1|1611907_1612459_-	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	83.0	1.1e-46
WP_028004745.1|1612484_1613390_-	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	86.4	1.3e-145
WP_088203260.1|1613386_1615111_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	84.6	4.7e-290
WP_028004743.1|1615107_1615344_-|head,tail	head-to-tail joining protein	head,tail	A0A291AUL5	Sinorhizobium_phage	78.2	4.9e-25
WP_017274500.1|1617698_1618445_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	83.5	4.3e-115
WP_017267129.1|1618612_1619407_-	hypothetical protein	NA	R9TRT9	Rhizobium_phage	44.8	1.5e-52
WP_017273558.1|1619684_1621493_-	primase	NA	A0A0P0IX98	Lactobacillus_phage	37.9	6.2e-51
WP_017267131.1|1621494_1622724_-	hypothetical protein	NA	R9TNC4	Rhizobium_phage	48.7	7.6e-101
WP_013843977.1|1622720_1623056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013843976.1|1623055_1623568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017267132.1|1623581_1623953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026030356.1|1623949_1624219_-	hypothetical protein	NA	R9TRS8	Rhizobium_phage	76.3	3.1e-07
WP_013843974.1|1624215_1624395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127570023.1|1624391_1624670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017267134.1|1624666_1624918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013843972.1|1625262_1625472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013843971.1|1625554_1626250_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013843969.1|1626654_1626891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017267135.1|1627095_1627776_+	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	46.3	1.9e-40
WP_017267136.1|1627779_1628274_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	57.9	7.7e-44
WP_013843965.1|1628285_1628705_+	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	66.7	9.4e-35
WP_013843964.1|1628704_1629070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203261.1|1629062_1630181_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	37.8	1.9e-66
WP_017267138.1|1630190_1630694_+	hypothetical protein	NA	A0A218M329	Acidovorax_phage	35.5	1.6e-12
WP_017273560.1|1630690_1631059_+	HNH endonuclease	NA	A0A291AUJ4	Sinorhizobium_phage	81.3	3.8e-56
WP_017267140.1|1631237_1632395_+|integrase	integrase	integrase	A0A067XRF8	Caulobacter_phage	29.1	2.1e-07
1632504:1632527	attL	GTTCAAATCTCTCTAGCAGCACCA	NA	NA	NA	NA
WP_157719031.1|1632618_1634163_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157719031.1|1632618_1634163_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1642056:1642079	attR	GTTCAAATCTCTCTAGCAGCACCA	NA	NA	NA	NA
>prophage 6
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	2613840	2669760	3425977	portal,head,transposase,integrase,terminase,tail,capsid	Sinorhizobium_phage(68.42%)	59	2613007:2613052	2661412:2661457
2613007:2613052	attL	TGGTGATCCCGGCGCGATTCGAACGCGCGACCCCCAGATTAGGAAT	NA	NA	NA	NA
WP_088203400.1|2613840_2614974_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	31.4	7.0e-08
WP_088203306.1|2615075_2615306_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088203307.1|2615926_2616862_-	DUF2303 family protein	NA	A0A291AUR3	Sinorhizobium_phage	56.6	3.1e-94
WP_018010655.1|2616892_2617237_-	hypothetical protein	NA	R9TQI8	Rhizobium_phage	63.2	1.0e-31
WP_088203308.1|2617249_2617729_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	58.8	4.6e-46
WP_088203309.1|2617732_2618413_-	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	49.0	2.4e-43
WP_088203310.1|2618415_2618607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203311.1|2618609_2618798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203312.1|2619043_2619685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088203313.1|2619779_2620028_+	hypothetical protein	NA	R9TNB3	Rhizobium_phage	48.8	1.1e-14
WP_088203314.1|2620261_2620759_+	hypothetical protein	NA	A0A068CCD6	Rhizobium_phage	54.2	4.8e-38
WP_088203315.1|2620855_2621263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203316.1|2621262_2621772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203317.1|2621768_2622119_+	hypothetical protein	NA	R9TQK2	Rhizobium_phage	42.4	7.1e-12
WP_088203318.1|2622115_2623369_+	hypothetical protein	NA	R9TNC4	Rhizobium_phage	57.8	8.3e-127
WP_088203319.1|2623365_2625396_+	hypothetical protein	NA	R9TSC7	Rhizobium_phage	63.6	8.4e-238
WP_088203320.1|2625828_2626623_+	hypothetical protein	NA	R9TRT9	Rhizobium_phage	48.2	5.0e-61
WP_088203321.1|2626792_2627539_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	83.5	1.3e-114
WP_088203322.1|2627703_2628324_+	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	70.5	2.4e-71
WP_088203323.1|2628320_2630363_+|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	89.2	0.0e+00
WP_088203324.1|2630373_2630610_+|tail	phage tail protein	tail	A0A291AUL5	Sinorhizobium_phage	79.5	7.6e-26
WP_088203325.1|2630606_2632331_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	84.2	7.5e-288
WP_088203326.1|2632327_2633233_+	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	85.4	3.1e-144
WP_088203327.1|2633258_2633801_+	hypothetical protein	NA	A0A291AUL6	Sinorhizobium_phage	78.6	2.8e-39
WP_088203328.1|2633803_2634160_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	81.4	7.7e-46
WP_088203329.1|2634185_2635217_+|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	85.9	9.3e-177
WP_088203330.1|2635291_2635690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203331.1|2635686_2636013_+	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	69.8	1.1e-33
WP_013844543.1|2636015_2636312_+	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	63.9	5.1e-27
WP_088203332.1|2636313_2636778_+	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	63.6	5.7e-49
WP_088203333.1|2636870_2637281_+|tail	phage tail protein	tail	A0A291AUM5	Sinorhizobium_phage	76.5	1.7e-52
WP_088203334.1|2637295_2637697_+	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	77.5	1.7e-49
WP_088203335.1|2637690_2637936_+|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	67.1	8.8e-25
WP_088203336.1|2638209_2640081_+|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	59.2	3.8e-184
WP_088203337.1|2640080_2640731_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	69.6	3.3e-79
WP_088203338.1|2640727_2641318_+	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	72.6	1.8e-76
WP_011976009.1|2641450_2641723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203339.1|2641792_2642197_+	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	71.6	5.5e-48
WP_088203340.1|2642203_2644957_+|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	61.7	2.4e-259
WP_088203341.1|2644956_2646471_+	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	87.8	6.0e-265
WP_088203342.1|2646482_2648507_+|tail	tail fiber domain-containing protein	tail	A0A2L2R219	Sinorhizobium_phage	31.1	2.7e-55
WP_014529428.1|2649042_2649234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011976001.1|2649442_2649661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088203343.1|2649843_2650812_+	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	87.7	2.6e-165
WP_088203344.1|2650808_2651090_+	hypothetical protein	NA	A0A076G8H8	Sinorhizobium_phage	60.2	5.5e-23
WP_003528213.1|2651293_2651659_+	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	71.7	3.1e-42
WP_014529434.1|2652524_2652704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203345.1|2652891_2654058_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_014529436.1|2654491_2655229_-	necrosis-inducing protein	NA	NA	NA	NA	NA
WP_014529437.1|2655513_2655876_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_018009369.1|2656886_2657549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203401.1|2657611_2658562_+	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_011975773.1|2659264_2659774_+	nucleoside kinase	NA	NA	NA	NA	NA
WP_088203346.1|2660454_2661135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010970334.1|2661678_2662575_+	ROK family protein	NA	NA	NA	NA	NA
2661412:2661457	attR	TGGTGATCCCGGCGCGATTCGAACGCGCGACCCCCAGATTAGGAAT	NA	NA	NA	NA
WP_010970333.1|2662650_2663145_+	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_013844887.1|2663161_2664319_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_010970331.1|2664496_2668270_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	55.7	1.1e-12
WP_088203347.1|2668563_2669760_+|transposase	IS256-like element ISRm5 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.6	5.9e-74
>prophage 7
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	3296906	3328869	3425977	transposase,protease,holin	Leptospira_phage(16.67%)	25	NA	NA
WP_011970797.1|3296906_3297853_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_088203378.1|3298082_3299780_-	adenine deaminase	NA	NA	NA	NA	NA
WP_010969917.1|3299867_3301196_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010969916.1|3301285_3301819_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_013844758.1|3301964_3302309_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013844757.1|3302427_3303171_-	HugZ family protein	NA	NA	NA	NA	NA
WP_010969913.1|3303204_3304254_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.7	1.9e-20
WP_013844756.1|3304250_3305096_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_010969911.1|3305252_3306209_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_010969910.1|3306495_3307083_+	thymidine kinase	NA	A0A0K2FHC3	Enterobacter_phage	54.7	4.1e-52
WP_003535848.1|3307243_3308332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529834.1|3308393_3309542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969907.1|3309545_3311462_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010969906.1|3311574_3311979_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003537933.1|3312156_3313320_-|transposase	IS4-like element ISRm16 family transposase	transposase	NA	NA	NA	NA
WP_010969905.1|3313503_3314793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010969904.1|3314796_3316020_+	DUF2333 family protein	NA	NA	NA	NA	NA
WP_010969903.1|3316110_3317790_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_014529145.1|3317950_3318937_-	extensin family protein	NA	NA	NA	NA	NA
WP_088203379.1|3319060_3321286_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010969900.1|3321559_3323749_+	anthranilate synthase	NA	NA	NA	NA	NA
WP_010969899.1|3323917_3324838_+	cation transporter	NA	NA	NA	NA	NA
WP_010969898.1|3324834_3325299_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	47.1	1.1e-28
WP_010969897.1|3325330_3326242_+	aminoglycoside phosphotransferase APH(3')	NA	Q75ZG1	Hepacivirus	30.2	8.6e-17
WP_003534438.1|3328281_3328869_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	37.3	1.1e-28
>prophage 8
NZ_CP021800	Sinorhizobium meliloti strain USDA1021 chromosome, complete genome	3425977	3384522	3394157	3425977		Vibrio_phage(33.33%)	7	NA	NA
WP_003532937.1|3384522_3384972_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.4	3.0e-15
WP_010969855.1|3385205_3387209_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.5	3.5e-87
WP_010969854.1|3387254_3389165_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	35.7	1.1e-74
WP_088203404.1|3389424_3390612_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.8	2.0e-34
WP_013844736.1|3390635_3391670_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	68.6	4.1e-15
WP_107010522.1|3391888_3392014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003532953.1|3392102_3394157_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.6	1.1e-35
>prophage 1
NZ_CP021803	Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence	297816	7497	65210	297816	integrase,transposase	Bacillus_phage(22.22%)	29	16479:16538	49199:49398
WP_088204019.1|7497_8616_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088204020.1|9797_10850_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088204022.1|11787_13431_+	MFS transporter	NA	NA	NA	NA	NA
16479:16538	attL	CAGCGGCACAGCCCTCAGGTGCAAAATTATTGGGGTTAGAGAAGTGGAATTGAAAGCTAC	NA	NA	NA	NA
WP_153497509.1|16521_20832_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	23.6	2.9e-14
WP_088204024.1|20785_24010_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_088204025.1|24401_25571_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_088204026.1|25567_26308_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_088204027.1|26291_26765_+	RidA family protein	NA	NA	NA	NA	NA
WP_088204028.1|26768_27974_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088204029.1|28139_28610_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_088204030.1|28812_29820_-|integrase	site-specific integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.4	7.1e-12
WP_088204031.1|29816_30731_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010967204.1|30924_32127_+|transposase	IS256-like element ISRm3 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.0e-41
WP_088204033.1|33541_34423_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.9	2.7e-31
WP_088204034.1|34430_35627_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_011970372.1|36230_36794_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_088204035.1|37052_38171_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088204036.1|39998_41222_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_088204037.1|41329_46030_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_088204039.1|46145_47555_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_088204040.1|48049_48418_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	40.7	1.0e-16
WP_088204020.1|49966_51019_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
49199:49398	attR	CAGCGGCACAGCCCTCAGGTGCAAAATTATTGGGGTTAGAGAAGTGGAATTGAAAGCTACAGAACTTGCACTGAATTCATCGCAGGAACGAATGTGCTTTTTGAACGCGGTTGATCCGCGACGCAAGGATCTAAACATATGCTGCGCGGTGGAAATGGCAACCCGGATGTCGACTCGGCATCTGCATGAAGCGCTCCTAG	NA	NA	NA	NA
WP_088204041.1|53391_54141_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	29.0	1.9e-14
WP_088204043.1|55288_56320_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088204149.1|56322_57387_+	uridylate kinase	NA	NA	NA	NA	NA
WP_088204044.1|57595_58768_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.4	4.1e-19
WP_088204045.1|58760_59459_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	5.2e-30
WP_088204046.1|59958_61293_+|transposase	ISNCY-like element ISRm17 family transposase	transposase	NA	NA	NA	NA
WP_014528618.1|63836_65210_+|transposase	ISNCY family transposase	transposase	Q4VFZ2	Porcine_endogenous_retrovirus	27.7	1.4e-05
>prophage 2
NZ_CP021803	Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence	297816	107364	155650	297816	transposase,protease	Bacillus_virus(15.38%)	44	NA	NA
WP_014531051.1|107364_108402_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003537129.1|108836_109088_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_153497608.1|109516_109831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028005888.1|109892_110618_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.8	1.1e-11
WP_014531048.1|110769_112248_+	DUF1254 domain-containing protein	NA	A0A1J0FA30	Only_Syngen_Nebraska_virus	22.0	2.6e-10
WP_127570099.1|112337_112619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014531047.1|112672_113128_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017265675.1|113497_114106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088204066.1|115025_115718_-	stachydrine N-demethylase Stc3	NA	NA	NA	NA	NA
WP_013845279.1|118857_119307_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.5	7.2e-17
WP_088204067.1|120999_122418_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_086018117.1|122969_123527_-	NUDIX hydrolase	NA	A0A2H4IB87	Erwinia_phage	34.5	3.1e-09
WP_086018104.1|123589_123787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003535606.1|124047_124251_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	51.7	1.1e-07
WP_013845275.1|124691_124880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013845273.1|125535_126057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013845271.1|126445_126685_-	hypothetical protein	NA	J7F8X5	Agrobacterium_phage	61.8	8.6e-17
WP_014531029.1|127943_128165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041915217.1|130664_130817_+	ATP-dependent DNA ligase	NA	A0A076GD42	Sinorhizobium_phage	62.8	1.6e-08
WP_003532548.1|130946_131270_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.5	3.6e-18
WP_015241580.1|131642_132050_+	cytochrome P450	NA	NA	NA	NA	NA
WP_003532552.1|132027_132594_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014531026.1|132590_132761_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003532558.1|132995_134051_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013845267.1|135120_135318_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_014528039.1|135321_135501_+	thiazole biosynthesis family protein	NA	NA	NA	NA	NA
WP_088204068.1|135545_136647_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	29.5	2.0e-12
WP_088204069.1|137035_138154_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017267885.1|138272_138650_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003532569.1|138825_139302_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012881248.1|139445_140465_+	1-aminocyclopropane-1-carboxylate deaminase	NA	NA	NA	NA	NA
WP_014531014.1|141246_141465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127642796.1|141467_141719_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_157719039.1|141846_142128_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_088204070.1|142179_143292_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.4	2.5e-26
WP_088204071.1|143436_145242_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.9	5.3e-18
WP_088204072.1|146354_146945_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_088204073.1|147073_147595_-|protease	serine protease	protease	NA	NA	NA	NA
WP_088204074.1|147655_148396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003532595.1|148547_149324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088204075.1|150501_151266_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015241666.1|152116_153319_+|transposase	IS256-like element ISRm3 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.0e-41
WP_088204076.1|153604_154570_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_015061231.1|154897_155650_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.2	9.2e-41
>prophage 3
NZ_CP021803	Sinorhizobium meliloti strain USDA1021 plasmid accessoryA, complete sequence	297816	174541	229184	297816	integrase,transposase	Pseudomonas_phage(33.33%)	39	208073:208091	231359:231377
WP_088204085.1|174541_175739_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	53.5	1.2e-74
WP_088204086.1|176275_177892_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_088204087.1|177898_178780_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088204088.1|178757_179636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088204089.1|179702_181052_-|transposase	ISNCY-like element ISRm17 family transposase	transposase	NA	NA	NA	NA
WP_003537730.1|181337_181772_+	helix-turn-helix transcriptional regulator	NA	Q8W6G2	Sinorhizobium_phage	47.4	2.7e-24
WP_088204090.1|182929_184579_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_088204091.1|184645_185788_+	pectate lyase	NA	A0A076FMJ8	Aureococcus_anophage	32.4	2.0e-15
WP_013845864.1|186031_186781_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_127570062.1|186934_187198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013851149.1|188192_189605_+	PhoPQ-activated pathogenicity	NA	NA	NA	NA	NA
WP_013851150.1|190196_190628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013851151.1|190624_191998_+	Y4yA family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_013851152.1|191998_193009_+	cysteine synthase family protein	NA	NA	NA	NA	NA
WP_088204092.1|193005_194145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088204093.1|194141_196031_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_013851155.1|196027_197254_+	MFS transporter	NA	NA	NA	NA	NA
WP_013851156.1|197250_198417_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088204094.1|198888_201030_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_088204095.1|201531_204045_-	DNA helicase	NA	NA	NA	NA	NA
WP_011970797.1|204086_205033_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_088204096.1|205109_206279_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_088204097.1|206271_207219_-	aminotransferase	NA	NA	NA	NA	NA
WP_013845644.1|207597_207942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088204098.1|207941_209045_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
208073:208091	attL	AGCCGAACGCCTCTTCGAT	NA	NA	NA	NA
WP_088203552.1|209909_210673_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.5	9.4e-25
WP_088204100.1|210991_211441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127570237.1|211451_212204_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157719041.1|212724_214071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088204103.1|214072_216142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088204104.1|216138_217194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088204105.1|217377_219111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203450.1|219603_220938_+|transposase	ISNCY-like element ISRm17 family transposase	transposase	NA	NA	NA	NA
WP_015241552.1|221550_221871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094183246.1|221872_223540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088204106.1|223680_225090_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.0	2.8e-30
WP_086019130.1|227177_227519_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_011970304.1|227515_227917_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_088204152.1|228008_229184_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
231359:231377	attR	AGCCGAACGCCTCTTCGAT	NA	NA	NA	NA
>prophage 1
NZ_CP021801	Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence	1412628	208984	277821	1412628	transposase	Stx2-converting_phage(42.86%)	51	NA	NA
WP_011970797.1|208984_209930_+|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_014531962.1|210091_210526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014989757.1|210736_211534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203432.1|212113_212860_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014989759.1|213334_213808_+	RidA family protein	NA	NA	NA	NA	NA
WP_014989760.1|213832_214588_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	7.1e-33
WP_003526797.1|214602_215271_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_088203433.1|215281_215932_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_088203434.1|215970_216816_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088203435.1|216988_219070_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_014528848.1|219093_220731_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_088203436.1|220804_222010_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_014989765.1|222088_222994_+	5-dehydro-4-deoxyglucarate dehydratase	NA	NA	NA	NA	NA
WP_088203437.1|223078_224512_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088203438.1|225634_226564_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014528843.1|226730_227786_+	DUF4392 domain-containing protein	NA	NA	NA	NA	NA
WP_014528842.1|227782_228757_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_088203439.1|228828_229302_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_088203440.1|229321_230830_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_014528839.1|230968_231361_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_088203637.1|231743_232481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203442.1|233092_234124_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088203443.1|235497_240474_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_088203444.1|240524_241151_-	porin family protein	NA	NA	NA	NA	NA
WP_088203445.1|241354_242395_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014531845.1|242657_243053_+	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	56.8	1.1e-05
WP_014531844.1|243049_243397_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	64.5	4.0e-39
WP_088199240.1|243442_245077_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.9	6.4e-103
WP_088203638.1|245131_245368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203446.1|246081_246702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010970069.1|247674_249009_-|transposase	ISNCY-like element ISRm17 family transposase	transposase	NA	NA	NA	NA
WP_013845060.1|249871_250264_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013845059.1|250285_251065_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_013845056.1|251857_252961_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_013845055.1|253044_253524_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_014531960.1|253677_254235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014531959.1|254350_256240_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_088203639.1|257542_259411_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_015008426.1|262423_262810_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_003537853.1|262806_263151_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088203448.1|263226_264846_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	35.4	5.9e-77
WP_014531948.1|265912_266848_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014531947.1|266844_267645_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014531946.1|267682_268144_-	membrane protein	NA	NA	NA	NA	NA
WP_014531945.1|268252_269230_-	alpha/beta hydrolase	NA	A0A0M4S5M2	Mycobacterium_phage	31.8	1.5e-14
WP_014531944.1|269340_269889_-	transporter	NA	NA	NA	NA	NA
WP_088203449.1|269985_272673_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014531941.1|272919_273201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014531940.1|273368_274166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127570190.1|274712_275942_-	sulfite oxidase	NA	NA	NA	NA	NA
WP_088203450.1|276486_277821_-|transposase	ISNCY-like element ISRm17 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP021802	Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence	2011522	696360	705555	2011522	tail,terminase,portal,head,capsid,integrase	Burkholderia_virus(25.0%)	13	694575:694591	700119:700135
694575:694591	attL	CCTTCTTCGGCGACGGC	NA	NA	NA	NA
WP_088203737.1|696360_698193_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088203739.1|698607_699810_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	34.3	1.7e-49
WP_088203740.1|699806_700106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203741.1|700102_700513_+	gene transfer agent family protein	NA	NA	NA	NA	NA
700119:700135	attR	CCTTCTTCGGCGACGGC	NA	NA	NA	NA
WP_088203742.1|700509_702057_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	34.2	5.4e-43
WP_088203743.1|702060_702687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088203744.1|702683_703037_+	HNH endonuclease	NA	Q38456	Bacillus_phage	47.1	9.4e-20
WP_088203745.1|703033_703624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020479440.1|703631_703997_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_088203746.1|703986_704424_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	34.8	2.8e-05
WP_088203747.1|704420_704834_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_088203748.1|704833_705151_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_088203749.1|705147_705555_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 2
NZ_CP021802	Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence	2011522	812258	868151	2011522	tail,tRNA,transposase	Sinorhizobium_phage(68.18%)	52	NA	NA
WP_013844094.1|812258_813029_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003533284.1|813167_814034_+	S49 family peptidase	NA	A0A2I7REP4	Vibrio_phage	27.4	1.1e-08
WP_003533286.1|814179_814371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014529086.1|814470_815433_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010968863.1|815433_815679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011970797.1|815703_816649_-|transposase	IS630-like element ISRm2011-2 family transposase	transposase	S5VXX4	Leptospira_phage	24.7	1.0e-12
WP_010968864.1|816960_817509_+	LemA family protein	NA	NA	NA	NA	NA
WP_010968865.1|817628_819563_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_010968866.1|819654_821820_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010968867.1|821879_822398_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_013844097.1|822527_823010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010968869.1|823126_824398_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_010968870.1|824524_826897_-	phosphodiesterase	NA	G3MA91	Bacillus_virus	29.9	3.6e-14
WP_010968871.1|826893_827934_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003533308.1|828040_829237_-	MFS transporter	NA	NA	NA	NA	NA
WP_003533310.1|829349_830165_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010968872.1|830535_831342_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010968873.1|831414_832371_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_010968874.1|832450_833017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017265803.1|833391_835701_+	DUF1217 domain-containing protein	NA	NA	NA	NA	NA
WP_010968876.1|835748_837191_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010968877.1|837238_838213_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.9	1.2e-35
WP_010968878.1|838278_838872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010968879.1|839509_840754_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_010968880.1|840756_841851_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010968881.1|841852_842878_-	glycoside hydrolase family 25 protein	NA	NA	NA	NA	NA
WP_010968882.1|843173_843587_+	BA14K family protein	NA	NA	NA	NA	NA
WP_010968883.1|844058_845048_-	transporter	NA	NA	NA	NA	NA
WP_010968884.1|845225_847007_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010968885.1|847016_847769_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017265910.1|847820_848060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080567514.1|848025_850149_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.1	1.4e-06
WP_010968887.1|850230_851478_-	RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	24.7	6.3e-18
WP_028004746.1|852148_852616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028004747.1|852612_852939_+	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	70.8	1.2e-34
WP_028004748.1|852941_853238_+	hypothetical protein	NA	A0A291AUM3	Sinorhizobium_phage	64.9	4.6e-28
WP_017274986.1|853239_853704_+	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	66.2	8.8e-50
WP_011975792.1|853796_854207_+|tail	tail protein	tail	A0A291AUM5	Sinorhizobium_phage	76.5	3.7e-52
WP_028004749.1|854220_854622_+	hypothetical protein	NA	A0A291AUM7	Sinorhizobium_phage	79.2	3.4e-50
WP_086021768.1|854618_854864_+|tail	phage tail assembly chaperone	tail	A0A291AUN4	Sinorhizobium_phage	68.4	3.9e-25
WP_088203764.1|855242_857114_+|tail	tail tape measure protein	tail	A0A291AUM6	Sinorhizobium_phage	69.6	7.0e-223
WP_028004751.1|857113_857764_+	hypothetical protein	NA	A0A291AUM9	Sinorhizobium_phage	70.0	4.3e-79
WP_028004752.1|857760_858351_+	DUF2163 domain-containing protein	NA	A0A291AUM8	Sinorhizobium_phage	72.1	2.0e-75
WP_013843999.1|858497_858770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028004753.1|858841_859246_+	hypothetical protein	NA	A0A291AUN0	Sinorhizobium_phage	73.1	1.9e-48
WP_028004754.1|859252_862000_+|tail	phage tail protein	tail	A0A291AUN1	Sinorhizobium_phage	61.4	7.6e-258
WP_017274117.1|862238_863753_+	hypothetical protein	NA	A0A2D2W219	Sinorhizobium_phage	84.2	3.9e-256
WP_017274118.1|863764_865789_+|tail	tail fiber domain-containing protein	tail	A0A2L2R219	Sinorhizobium_phage	30.9	4.1e-51
WP_028004756.1|866018_866222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028004757.1|866425_867394_+	chitinase	NA	A0A076G6J8	Sinorhizobium_phage	86.4	2.5e-163
WP_028004758.1|867504_867729_+	hypothetical protein	NA	J7F8X5	Agrobacterium_phage	60.3	4.1e-13
WP_028004759.1|867785_868151_+	hypothetical protein	NA	A0A076GD39	Sinorhizobium_phage	73.3	3.7e-43
