The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	374225	394645	4855001	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|374225_374954_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|375150_375441_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|375689_376145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|376141_376747_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|376751_378497_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|378499_379132_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|379124_380240_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|380230_380590_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|380753_382301_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|382300_383230_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|383226_383589_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|383916_384639_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|384648_385692_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|385679_385889_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|385888_386842_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|386841_389196_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|389292_389421_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|389380_389698_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|389749_390274_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|390273_391701_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|391690_391888_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|391884_392340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|392499_392814_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270442.1|392826_393432_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_001226442.1|393434_393722_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|394297_394645_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	1178725	1223673	4855001	lysis,terminase,portal,integrase,protease,coat	Enterobacteria_phage(78.12%)	65	1169495:1169511	1232264:1232280
1169495:1169511	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|1178725_1179778_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|1180060_1181164_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|1181175_1182426_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|1182631_1183795_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_155675089.1|1184024_1184165_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000002104.1|1184233_1184518_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|1184510_1184795_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|1184794_1185439_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|1185425_1185659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|1185655_1186165_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|1186161_1186332_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|1186342_1186636_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|1186682_1186967_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|1186966_1187674_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000156731.1|1187803_1187992_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|1187972_1188131_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|1188215_1188530_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|1188805_1189093_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|1189126_1189771_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|1189854_1190049_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|1190262_1190850_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|1190862_1191165_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|1191528_1191732_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|1191770_1192850_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|1193014_1193704_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|1193814_1194030_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|1194140_1194422_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|1194604_1195426_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|1195422_1196799_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|1196795_1197065_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|1197138_1197576_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000113770.1|1197712_1197889_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|1197891_1198233_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|1198225_1198402_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|1198394_1199006_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|1199002_1199227_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|1199223_1199427_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|1199407_1199587_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|1199583_1200357_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|1200787_1200991_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|1200968_1201466_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|1201462_1201930_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_000877028.1|1202142_1202673_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|1202895_1203138_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|1203141_1203531_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|1203530_1203935_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|1203938_1204427_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|1204404_1205904_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|1205903_1208081_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|1208094_1209006_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|1209005_1210298_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|1210338_1210899_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|1210882_1211383_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|1211342_1212761_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|1212764_1213466_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|1213465_1213921_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|1213923_1214613_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|1214623_1216060_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|1216059_1218036_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|1218174_1218468_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|1218488_1218737_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|1218872_1220876_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|1220934_1222392_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|1222381_1223314_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|1223310_1223673_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
1232264:1232280	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 3
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	1831025	1839756	4855001	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1831025_1832144_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1832140_1834087_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1834216_1834438_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1834761_1835082_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1835112_1837389_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1837580_1838039_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1838500_1839756_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 4
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	1889819	1988625	4855001	tail,lysis,terminase,portal,tRNA,integrase,holin,protease	Salmonella_phage(42.11%)	101	1892728:1892747	1964514:1964533
WP_001154025.1|1889819_1890623_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1890615_1891938_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1891918_1892623_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1892622_1897089_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1892728:1892747	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1897433_1899275_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1899534_1900083_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1900110_1900758_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1900819_1902010_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1902194_1903286_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1903892_1905293_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1905493_1905955_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1906271_1907486_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1907730_1909167_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1909244_1910447_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1910641_1911934_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1911978_1912227_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1912267_1912507_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1912549_1913707_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_088365263.1|1913669_1916555_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.2	0.0e+00
WP_001668146.1|1916681_1916981_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1917002_1917161_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1917153_1917414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1917463_1917874_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1917993_1918233_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1918198_1918573_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1918657_1919641_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1919643_1920393_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1920403_1920751_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1920747_1921059_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_010989003.1|1921136_1921427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1921718_1921952_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1922063_1922285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1922367_1922970_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1923178_1923790_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1923786_1923933_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1923922_1924720_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1924786_1925104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1925277_1925403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1925538_1925988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1926348_1927035_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1927310_1927640_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984584.1|1927623_1928076_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_001541990.1|1928093_1928573_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1928779_1929313_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1929269_1931408_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1931404_1931611_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1931637_1933155_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1933078_1935160_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1935250_1935574_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1935566_1935866_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1935846_1936413_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1936409_1936811_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1936822_1937572_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1937617_1938016_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1938012_1938342_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_088365281.1|1938421_1941409_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1941405_1941738_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1941836_1942334_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1942450_1942984_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1943073_1943769_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1943778_1944516_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1944413_1945118_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_001541992.1|1945189_1947637_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_001687102.1|1947663_1948539_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_000178849.1|1948577_1948820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1948873_1951312_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1951311_1951893_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1952368_1953337_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1953984_1954611_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1954679_1954979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365264.1|1954963_1955650_-	virulence protein	NA	NA	NA	NA	NA
WP_000497441.1|1955920_1956112_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1956538_1959151_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1959358_1960369_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1960534_1961077_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1961073_1962183_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1962281_1964390_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1964402_1966310_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1964514:1964533	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1966324_1967578_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1967582_1969223_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1969219_1969783_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1970038_1970206_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1970305_1970824_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1970892_1972653_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1972838_1973291_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1973362_1974415_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1974771_1975281_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1975497_1976103_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1976089_1978243_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1978261_1978708_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1978831_1980886_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1980921_1981380_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1981474_1982137_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1982307_1982724_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1982768_1983086_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1983143_1984355_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1984569_1985118_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000072884.1|1985970_1986252_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1986248_1986578_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1986664_1987324_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1987944_1988625_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 5
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	2775889	2782698	4855001	tail,integrase	Salmonella_phage(33.33%)	11	2770752:2770774	2780467:2780489
2770752:2770774	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|2775889_2776771_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2777243_2777432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2777496_2777664_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2777920_2778454_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2778507_2778738_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2778927_2779422_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|2779481_2780336_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|2780709_2781063_-	YebY family protein	NA	NA	NA	NA	NA
2780467:2780489	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2781079_2781955_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2781955_2782330_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2782467_2782698_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	2886742	2897345	4855001		Morganella_phage(25.0%)	12	NA	NA
WP_001157322.1|2886742_2888173_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2888246_2888942_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2889033_2889333_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2889982_2891179_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2891439_2891628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2891638_2891851_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2892305_2893574_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2893576_2893996_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2894122_2894284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|2894764_2895562_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2895933_2896224_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2896871_2897345_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 7
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	2983339	2993845	4855001		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2983339_2984653_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2984679_2985759_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2985763_2986537_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2986533_2987526_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2987531_2988083_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2988083_2988962_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2989009_2989909_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2989908_2990994_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2991370_2992264_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2992441_2993845_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	3062153	3071324	4855001	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|3062153_3064187_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|3064427_3064886_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|3065057_3065588_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3065644_3066112_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3066158_3066878_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|3066874_3068560_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|3068782_3069514_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3069573_3069681_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|3069661_3070393_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3070376_3071324_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 9
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	3090731	3157127	4855001	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|3090731_3091427_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|3091580_3092465_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|3092641_3093361_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|3093357_3093603_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|3093807_3095049_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|3095042_3096278_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|3096352_3097363_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|3097378_3098899_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|3099032_3100031_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|3100529_3101552_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|3101701_3102844_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001540445.1|3102858_3103527_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	1.2e-55
WP_000425488.1|3103856_3104714_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|3104702_3105092_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|3105096_3106464_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|3106680_3107568_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|3107600_3108923_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|3108966_3110958_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|3111303_3112773_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|3112962_3113826_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137960.1|3113946_3114996_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|3115074_3115932_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|3115996_3117685_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|3117701_3118640_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|3118639_3119770_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|3120138_3121320_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|3121384_3122050_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|3122051_3122174_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|3122561_3122816_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|3123139_3123712_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|3123924_3124911_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|3124940_3125660_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|3126073_3126646_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|3126971_3128528_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561747.1|3128634_3130440_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|3130449_3131544_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|3131543_3132569_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|3132570_3134160_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|3134163_3134508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|3134898_3136089_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|3136116_3136812_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|3136963_3138724_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|3138848_3139133_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033437.1|3139241_3139862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|3139889_3140897_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|3141076_3141304_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|3141335_3143096_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|3143376_3143880_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|3143907_3144198_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|3144545_3146375_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|3146428_3146872_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|3147249_3147777_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|3147779_3149021_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|3149613_3149943_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|3150239_3151571_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|3151599_3151968_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|3151982_3152972_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|3153300_3155667_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|3155835_3156039_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|3156335_3157127_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	3495087	3599985	4855001	head,tail,transposase,capsid,terminase,portal,lysis,tRNA,integrase,holin,protease	Salmonella_phage(37.1%)	112	3519632:3519648	3607889:3607905
WP_000940032.1|3495087_3495819_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|3495937_3496741_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|3496885_3497764_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|3497945_3498989_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|3498992_3499811_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|3499821_3500835_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|3500835_3501822_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|3501812_3502451_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|3502576_3503854_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|3503848_3504988_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|3505183_3506437_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883149.1|3506761_3507952_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|3508133_3509678_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|3510038_3511370_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|3511452_3513597_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|3513652_3515113_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|3515161_3515500_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|3515576_3516914_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|3516910_3517675_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|3517676_3519107_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
3519632:3519648	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|3519756_3523644_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|3523665_3523899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|3523899_3525444_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|3525494_3526046_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|3526070_3526706_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|3526709_3528071_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|3528081_3528975_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|3529090_3529939_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|3529977_3530895_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|3530916_3532113_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|3532228_3533155_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|3533192_3533453_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|3533564_3533945_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|3533944_3534676_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|3534687_3535416_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|3535427_3536333_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|3536329_3537010_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|3537283_3538258_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|3538274_3540074_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|3540478_3541972_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|3542456_3542594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|3543306_3543471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|3544050_3544116_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|3544178_3544391_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|3544497_3544725_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|3544821_3545400_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|3545389_3546214_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|3546210_3548583_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|3548636_3548879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|3548917_3552280_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|3552341_3552989_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|3552886_3553624_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|3553630_3554329_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3554338_3554668_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|3554670_3557766_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|3557737_3558076_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|3558072_3558468_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|3558518_3559265_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|3559272_3559674_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|3559782_3560913_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|3560961_3561540_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|3561567_3561951_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|3561961_3562321_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|3562378_3563407_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|3563461_3563809_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|3563821_3565318_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|3565307_3566888_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|3566884_3567088_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|3567071_3569003_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|3568974_3569520_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|3569806_3570208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024135675.1|3570443_3570902_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	86.2	2.6e-62
WP_000984581.1|3570919_3571372_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|3571355_3571685_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110786.1|3571960_3572647_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	7.9e-132
WP_000657897.1|3572861_3573050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211409.1|3573556_3574120_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|3574392_3575070_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|3575066_3575207_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|3575203_3575815_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_076192923.1|3576023_3576626_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.0	2.4e-108
WP_000807548.1|3576708_3576930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3577041_3577275_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|3577566_3577857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3577934_3578246_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3578242_3578590_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3578600_3579350_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3579352_3580336_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3580420_3580795_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3580760_3581000_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3581119_3581530_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3581579_3581840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|3581832_3581991_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|3582012_3582363_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|3582489_3585417_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_071892913.1|3585379_3586537_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|3586579_3586819_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|3586859_3587144_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|3587121_3588351_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|3588848_3589328_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|3589324_3590281_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|3590280_3590931_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|3590962_3591538_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|3591534_3591699_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|3591962_3593585_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|3593569_3594307_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|3594437_3595772_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|3595789_3596689_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|3596791_3597379_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|3597440_3597824_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|3598142_3598832_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|3598947_3599985_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
3607889:3607905	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 11
NZ_CP021909	Salmonella enterica subsp. enterica strain ST1120 chromosome, complete genome	4855001	3626795	3723378	4855001	head,tail,transposase,lysis,terminase,capsid,portal,integrase,tRNA,plate	Salmonella_phage(81.63%)	90	3693803:3693818	3721825:3721840
WP_000469804.1|3626795_3627563_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3627607_3628156_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3628174_3628423_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|3628736_3630098_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3630263_3631055_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|3631074_3632361_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|3632481_3633087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3633121_3633712_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3633834_3634713_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|3634798_3636460_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|3636608_3636947_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3637112_3637403_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|3637392_3637869_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3638018_3638501_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|3639114_3650589_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|3650653_3652063_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|3652059_3654240_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|3654247_3655411_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980498.1|3655962_3656181_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_001010543.1|3656249_3657350_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.1	3.4e-193
WP_000980418.1|3657346_3657832_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	98.5	2.4e-66
WP_001282773.1|3657828_3660636_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	99.7	0.0e+00
WP_000763317.1|3660628_3660748_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_001280967.1|3660762_3661065_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_001207652.1|3661119_3661635_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_000046109.1|3661644_3662817_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001165559.1|3662919_3663477_-	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	97.8	8.0e-98
WP_010989058.1|3663446_3664526_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	92.1	5.4e-183
WP_001287105.1|3664532_3664940_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.4	2.2e-60
WP_010989059.1|3664943_3665561_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.6	4.1e-95
WP_001274647.1|3665530_3667105_-|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	60.7	2.1e-156
WP_001086807.1|3667101_3667707_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_000268333.1|3667699_3668608_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.0	7.7e-159
WP_000177403.1|3668594_3668954_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_000993751.1|3668950_3669529_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	98.4	3.3e-107
WP_000343947.1|3669597_3670044_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.0	1.9e-65
WP_001039961.1|3670036_3670468_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_001648763.1|3670563_3670992_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001069932.1|3671368_3671878_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.5e-92
WP_000171565.1|3671858_3672074_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868168.1|3672077_3672281_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_000673534.1|3672280_3672745_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000059178.1|3672838_3673492_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	4.6e-113
WP_000730755.1|3673495_3674578_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_000216276.1|3674594_3675428_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098444.1|3675570_3677337_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.3	0.0e+00
WP_001292071.1|3677336_3678377_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.0	2.4e-188
WP_071892914.1|3678462_3680214_-	AIPR family protein	NA	NA	NA	NA	NA
WP_014344476.1|3680427_3681105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3681218_3681452_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|3681462_3681651_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000301161.1|3681803_3684233_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.8	0.0e+00
WP_000104125.1|3684223_3685081_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.4	2.7e-129
WP_000785509.1|3685077_3685305_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_001244234.1|3685304_3685538_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000963195.1|3685605_3685947_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_000166366.1|3686166_3686625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957775.1|3686572_3686806_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000460862.1|3686813_3687323_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	5.1e-83
WP_000102104.1|3687358_3687598_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_000052560.1|3687714_3688347_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_001536726.1|3688350_3689376_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_001542208.1|3689704_3690769_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|3690782_3690950_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|3690996_3691590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|3691979_3693173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|3693507_3694335_-	hypothetical protein	NA	NA	NA	NA	NA
3693803:3693818	attL	ACAAACATATATTCTT	NA	NA	NA	NA
WP_000701821.1|3694785_3695001_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|3695036_3697106_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|3697608_3698892_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|3698936_3699755_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|3699908_3700265_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|3700359_3700644_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|3700756_3701278_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|3701274_3701649_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|3701645_3702626_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|3702636_3703650_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|3703944_3705147_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|3705220_3705856_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|3705879_3706443_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|3706442_3707285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|3707414_3708956_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|3709178_3710858_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|3711974_3712850_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|3713015_3714890_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|3715149_3716433_-	membrane protein	NA	NA	NA	NA	NA
WP_001682341.1|3717010_3717607_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_000061088.1|3719320_3719959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|3719955_3721938_-	AAA family ATPase	NA	NA	NA	NA	NA
3721825:3721840	attR	AAGAATATATGTTTGT	NA	NA	NA	NA
WP_085983317.1|3722216_3723378_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
