The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	682811	691177	4086692		Synechococcus_phage(50.0%)	8	NA	NA
WP_003233955.1|682811_684107_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_014479060.1|684180_684906_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|684898_685153_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003243954.1|685149_685833_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_088272200.1|685816_688045_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.3	2.9e-159
WP_003233947.1|688020_689451_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_014479061.1|689552_690593_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	1.7e-64
WP_088272201.1|690589_691177_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.5	6.3e-29
>prophage 2
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	707520	766288	4086692	coat,tRNA,transposase	Erysipelothrix_phage(18.18%)	42	NA	NA
WP_087614160.1|707520_708670_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_072592588.1|708856_709867_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_010886431.1|709904_710603_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
WP_003242814.1|710708_712187_-	proline transporter OpuE	NA	NA	NA	NA	NA
WP_003219442.1|712600_712891_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003233901.1|712906_714364_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003219444.1|714377_715808_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017695625.1|715844_716693_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157673330.1|716824_719962_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	1.0e-64
WP_003233894.1|720113_721025_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_088272206.1|721280_722663_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.6	1.8e-111
WP_087614399.1|723069_724320_+	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	44.1	1.4e-65
WP_088272207.1|724374_725574_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_087614401.1|725630_725834_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	74.2	2.8e-21
WP_088272208.1|729289_730729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272209.1|730725_731826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003240078.1|732304_732502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017695620.1|733838_734105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072557181.1|734610_735066_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_088272210.1|735085_737095_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.2	6.3e-145
WP_088272211.1|737307_738330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272212.1|738473_739604_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	46.2	7.5e-87
WP_003242557.1|739593_739767_+	phosphatase RapH inhibitor PhrH	NA	NA	NA	NA	NA
WP_003233863.1|739926_740646_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_088272213.1|740779_741388_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014479093.1|741502_742087_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014479094.1|742263_742512_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_014479095.1|742495_742759_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_014479096.1|742773_743343_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_014479097.1|743467_744010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031600250.1|744449_745079_+	YesL family protein	NA	NA	NA	NA	NA
WP_014479101.1|745075_746809_+	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.5	6.9e-23
WP_014479104.1|748011_749295_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014479105.1|749291_750221_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_049832635.1|750978_752817_+	rhamnogalacturonan lyase	NA	NA	NA	NA	NA
WP_003233813.1|752975_753629_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_088272215.1|758325_759834_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_014479122.1|759888_760845_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_014479123.1|760858_761746_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_088272216.1|761754_763098_+	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_014479125.1|763172_763868_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_031600262.1|765040_766288_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 3
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	1243572	1299626	4086692	coat,tRNA,transposase	Bacillus_phage(50.0%)	52	NA	NA
WP_014479464.1|1243572_1244022_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479466.1|1244788_1245271_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_014479467.1|1245355_1245676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479468.1|1245715_1246102_-|coat	spore coat protein V	coat	NA	NA	NA	NA
WP_014476457.1|1246261_1246618_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_014479470.1|1246899_1247106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232872.1|1247187_1247337_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_014479471.1|1247469_1247724_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_014479472.1|1247797_1250077_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
WP_003232866.1|1250193_1250448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|1250559_1251709_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_014479473.1|1251811_1252234_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232861.1|1252237_1252753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245358.1|1252789_1253512_-	esterase family protein	NA	NA	NA	NA	NA
WP_003232857.1|1253867_1254989_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_014479474.1|1254981_1256154_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_014479475.1|1256186_1256732_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014479476.1|1256801_1257992_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_010329852.1|1260029_1260377_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	8.6e-18
WP_014479480.1|1260389_1260911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479481.1|1261273_1261645_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.8	5.1e-16
WP_106610850.1|1261810_1262086_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014479483.1|1263025_1264195_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	41.8	2.0e-87
WP_031600382.1|1265891_1267409_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_014479487.1|1267474_1267690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041351552.1|1270144_1270528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052478204.1|1270546_1271713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041351553.1|1271776_1272004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041351555.1|1273781_1275548_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.0	4.0e-127
WP_041351557.1|1275561_1276026_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_088272286.1|1276328_1277576_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.3	1.0e-23
WP_088272287.1|1277577_1277814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697622.1|1278179_1278404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041351656.1|1278444_1278726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041351654.1|1278773_1279001_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041351650.1|1279511_1279904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041351648.1|1282030_1282573_+	membrane protein	NA	NA	NA	NA	NA
WP_014476481.1|1283753_1284269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697615.1|1284397_1284598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015252322.1|1285743_1286061_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_021479515.1|1286297_1287053_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041335706.1|1287200_1287548_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_014479505.1|1288109_1290056_+	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_014479507.1|1292170_1293118_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_072592525.1|1293287_1293779_+	YjdF family protein	NA	NA	NA	NA	NA
WP_014479509.1|1295193_1295700_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009967031.1|1295918_1296314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479511.1|1296542_1297022_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003232825.1|1297061_1297256_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_014479512.1|1297387_1297717_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_082201004.1|1298265_1299255_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_015715704.1|1299377_1299626_-|coat	spore coat protein CotT	coat	NA	NA	NA	NA
>prophage 4
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	1332666	1370798	4086692	tail,terminase,plate,holin,portal,transposase	uncultured_Caudovirales_phage(31.43%)	47	NA	NA
WP_014478984.1|1332666_1334019_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_014479541.1|1334161_1334626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087614160.1|1335916_1337067_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_015252291.1|1337479_1338616_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	4.9e-94
WP_003245487.1|1338605_1338740_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_014479545.1|1339137_1340091_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.8	1.6e-66
WP_014479546.1|1340130_1340508_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	7.9e-17
WP_014479547.1|1340612_1341215_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.7	1.4e-44
WP_003245071.1|1341291_1342128_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1342171_1342768_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_017695142.1|1342930_1343272_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.6	4.5e-19
WP_015715728.1|1343450_1343630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272291.1|1343616_1344453_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.8	2.3e-24
WP_080009791.1|1344352_1345153_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	3.8e-61
WP_003245588.1|1345152_1345320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479479.1|1345404_1345755_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_088272292.1|1345751_1345958_+	phage-like element PBSX protein XtrA	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.4	7.9e-11
WP_043857330.1|1346073_1346583_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.0	1.9e-21
WP_088272293.1|1346700_1347498_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.5	4.2e-60
WP_019712462.1|1347494_1348796_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	1.1e-153
WP_088272294.1|1348799_1350287_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_017695135.1|1350306_1351134_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.7	3.6e-54
WP_003232690.1|1351159_1352095_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_088272295.1|1352116_1352500_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_088272296.1|1352496_1352853_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_088272297.1|1352849_1353335_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	3.6e-38
WP_041351211.1|1353347_1353788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1353791_1354010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272298.1|1354006_1355407_+|tail	phage tail sheath protein	tail	A0A0A7S087	Clostridium_phage	39.3	1.8e-77
WP_003232677.1|1355408_1355852_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_014479556.1|1355943_1356390_+	hypothetical protein	NA	A0A0A7RTY8	Clostridium_phage	36.8	1.0e-10
WP_014479557.1|1356431_1356572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600410.1|1356572_1361576_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JA91	uncultured_Caudovirales_phage	44.8	6.4e-37
WP_014479559.1|1361568_1362228_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1362243_1363221_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_033884959.1|1363220_1363487_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.5	7.6e-06
WP_088272299.1|1363544_1363970_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	5.6e-11
WP_088272300.1|1363962_1365009_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	7.5e-73
WP_041333879.1|1364992_1365571_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	2.3e-15
WP_003232665.1|1365567_1365840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479561.1|1365842_1367906_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	34.5	2.6e-29
WP_014479562.1|1367917_1368247_+	hypothetical protein	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	1.3e-15
WP_088272301.1|1368243_1368408_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.5e-15
WP_014479564.1|1368454_1369294_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_014479565.1|1369346_1369616_+	phage-like element PBSX protein XhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	1.4e-23
WP_014479566.1|1369628_1369892_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_014479567.1|1369904_1370798_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.2	5.2e-83
>prophage 5
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	1793200	1895817	4086692	tail,terminase,plate,capsid,portal,integrase,tRNA,holin,protease,coat,head,transposase	Bacillus_phage(62.96%)	115	1808570:1808589	1891206:1891225
WP_003231833.1|1793200_1793746_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_014479821.1|1793878_1796455_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_041516431.1|1796470_1798354_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.3	7.6e-68
WP_088272327.1|1798753_1799209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017694906.1|1799363_1799921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964162.1|1800041_1800656_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003231786.1|1800791_1801148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592535.1|1801226_1802051_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_033881122.1|1802161_1803490_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.6	1.2e-27
WP_014476869.1|1803714_1803948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479835.1|1804227_1804935_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_014479836.1|1805004_1805457_+	OsmC family protein	NA	NA	NA	NA	NA
WP_014479837.1|1805470_1805824_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1805837_1806155_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_088272328.1|1806289_1806604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072592536.1|1806692_1807106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479840.1|1807205_1808150_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1808189_1808411_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
1808570:1808589	attL	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_014479841.1|1808605_1808878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1808959_1809190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1809432_1809825_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1809784_1811887_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1811904_1812894_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1812943_1813564_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014479843.1|1813627_1814395_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	1.2e-51
WP_003231746.1|1815035_1816004_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_015483254.1|1816136_1817399_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014479845.1|1817416_1818682_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003238341.1|1818791_1819199_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_031600540.1|1819257_1820592_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_088272329.1|1820704_1821862_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.9	8.3e-65
WP_105778744.1|1821877_1822933_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	24.2	1.7e-08
WP_014479849.1|1822916_1823303_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	31.4	9.0e-08
WP_033881118.1|1823427_1823646_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	63.2	2.1e-17
WP_014479850.1|1823760_1824525_+	hypothetical protein	NA	A8ATN0	Listeria_phage	49.1	1.0e-47
WP_014479851.1|1824540_1824852_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105778750.1|1824912_1825104_+	hypothetical protein	NA	Q9ZXD0	Bacillus_phage	53.1	7.1e-06
WP_014479853.1|1825100_1825376_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	47.1	1.2e-19
WP_014479855.1|1825571_1826126_+	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	96.2	3.1e-94
WP_014479856.1|1826129_1827065_+	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	96.5	2.0e-170
WP_014479857.1|1827054_1827369_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	99.0	1.5e-53
WP_014479858.1|1827389_1827827_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	97.2	1.3e-79
WP_014479859.1|1827887_1830305_+	hypothetical protein	NA	D6R422	Bacillus_phage	88.7	0.0e+00
WP_014479860.1|1830503_1830941_+	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	91.7	4.8e-74
WP_046159987.1|1830937_1831477_+	nuclease	NA	Q9ZXC2	Bacillus_phage	95.5	6.7e-94
WP_088272330.1|1831510_1832026_+	hypothetical protein	NA	D6R425	Bacillus_phage	96.5	1.7e-94
WP_046159989.1|1832026_1832218_+	hypothetical protein	NA	D6R426	Bacillus_phage	80.4	8.1e-18
WP_082090345.1|1832183_1832639_+	hypothetical protein	NA	D9J0I1	Brochothrix_phage	41.2	1.1e-15
WP_046159991.1|1832635_1832839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072693035.1|1832924_1833338_+	ArpU family transcriptional regulator	NA	D6R428	Bacillus_phage	99.2	1.2e-63
WP_063695037.1|1833785_1834343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063695036.1|1834515_1835130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272332.1|1835455_1836418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272333.1|1836436_1837162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063695032.1|1837311_1837956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063695031.1|1838199_1838565_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	1.5e-28
WP_088272334.1|1838791_1839307_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	1.7e-33
WP_088272335.1|1839303_1841013_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.2	6.7e-204
WP_088272336.1|1841025_1841217_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_088272337.1|1841217_1842528_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.4	9.3e-105
WP_088272338.1|1842472_1843204_+|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	55.6	8.9e-57
WP_088272339.1|1843242_1844508_+|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	45.2	2.6e-80
WP_088272340.1|1844530_1844992_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	5.2e-10
WP_063695024.1|1845009_1845312_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	3.6e-12
WP_019712664.1|1845301_1845616_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.2e-12
WP_088272341.1|1845615_1846014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272342.1|1846010_1846403_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_088272343.1|1846417_1847017_+|tail	phage tail protein	tail	A0A1J0MFV0	Staphylococcus_phage	32.1	1.0e-13
WP_088272344.1|1847083_1847452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272345.1|1847651_1852139_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.3e-68
WP_046160652.1|1852132_1852972_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.6	3.4e-92
WP_088272346.1|1852986_1854690_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.3	3.1e-177
WP_069837318.1|1854741_1856298_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	82.9	1.5e-250
WP_088272347.1|1856334_1857456_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.2	6.3e-195
WP_031600553.1|1857471_1857771_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	2.0e-39
WP_031600554.1|1857767_1857938_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031600555.1|1857989_1858202_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.9e-15
WP_031600556.1|1858216_1858480_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	66.7	2.7e-24
WP_031600557.1|1858535_1859513_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	71.4	2.0e-64
WP_031600558.1|1859558_1860023_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_088272610.1|1860041_1861805_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.5	5.0e-122
WP_080283100.1|1861974_1862046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479884.1|1862061_1863147_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_049832641.1|1863183_1863384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881290.1|1863980_1864271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479885.1|1864509_1865001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272348.1|1866331_1866583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072592598.1|1866766_1867201_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_031600262.1|1868129_1869377_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_046160431.1|1869960_1870497_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046160432.1|1870575_1871478_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|1871555_1871936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479898.1|1872477_1872708_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	75.0	2.1e-20
WP_088272349.1|1872704_1873349_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_014479901.1|1874221_1874386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479902.1|1874525_1874996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046381051.1|1875792_1877184_+	MFS transporter	NA	NA	NA	NA	NA
WP_014479906.1|1877214_1878816_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_046381052.1|1878953_1880108_-	ROK family protein	NA	NA	NA	NA	NA
WP_014479908.1|1880345_1881683_+	xylose isomerase	NA	NA	NA	NA	NA
WP_014479909.1|1881833_1883333_+	xylulokinase	NA	NA	NA	NA	NA
WP_031600262.1|1883817_1885065_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_014479910.1|1885194_1885830_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	7.7e-73
WP_088272350.1|1886242_1887658_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_029726905.1|1887759_1888944_-	alanine racemase	NA	NA	NA	NA	NA
WP_088272351.1|1889351_1889780_-	endonuclease	NA	NA	NA	NA	NA
WP_088272352.1|1890208_1890670_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_014479915.1|1890699_1891134_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	92.3	5.8e-72
WP_033881937.1|1891734_1891998_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
1891206:1891225	attR	ATATTATGTATAAAATGAAT	NA	NA	NA	NA
WP_003231643.1|1892404_1892569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272353.1|1892843_1893683_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.2	9.6e-164
WP_121509411.1|1893805_1894093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479919.1|1894135_1894855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479920.1|1895014_1895371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014479921.1|1895616_1895817_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 6
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	2000481	2055194	4086692	holin,transposase	Bacillus_phage(63.64%)	56	NA	NA
WP_080480857.1|2000481_2000814_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.7	2.6e-27
WP_088272364.1|2000853_2001156_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	43.4	4.9e-17
WP_069837540.1|2001161_2001371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043857633.1|2001696_2003148_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_004399503.1|2004146_2004824_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_017697452.1|2007293_2007599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121509413.1|2009423_2009579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697449.1|2010109_2010607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272365.1|2010707_2011619_-	VanW family protein	NA	NA	NA	NA	NA
WP_015251949.1|2011922_2012405_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_021481417.1|2012414_2012651_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069837543.1|2012773_2013568_+	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_046160469.1|2013685_2014558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015714066.1|2014658_2015537_+	DMT family transporter	NA	NA	NA	NA	NA
WP_046160470.1|2015710_2016142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837544.1|2016406_2017039_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_080480858.1|2017294_2018215_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.2	1.0e-57
WP_069837546.1|2018674_2019037_-	YobA family protein	NA	NA	NA	NA	NA
WP_003231381.1|2019097_2019310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021481426.1|2019413_2019677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837547.1|2019975_2022576_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.8	3.3e-45
WP_069837548.1|2023242_2023884_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_014477028.1|2024511_2024751_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.1	1.4e-19
WP_029318062.1|2024921_2025260_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	3.5e-08
WP_031600262.1|2025360_2026608_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_069837550.1|2026694_2026895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837551.1|2026936_2027395_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_033881696.1|2027431_2027665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043857647.1|2028079_2028211_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	93.0	2.7e-17
WP_003231002.1|2028447_2028699_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	94.0	1.5e-35
WP_033881218.1|2029067_2030495_-	serine hydrolase	NA	NA	NA	NA	NA
WP_033881214.1|2030628_2030859_+	membrane protein	NA	NA	NA	NA	NA
WP_033881215.1|2030868_2031261_-	UPF0715 family protein	NA	O64087	Bacillus_phage	81.4	3.7e-49
WP_087614174.1|2031305_2031530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837923.1|2031564_2031918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837552.1|2032831_2033080_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	86.4	2.3e-25
WP_046160477.1|2033171_2033609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160541.1|2033699_2034083_-	membrane protein	NA	O64087	Bacillus_phage	34.2	4.0e-08
WP_069837553.1|2034675_2035230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478926.1|2035763_2036888_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_021481445.1|2038203_2038578_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	1.1e-26
WP_087614177.1|2039688_2040849_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.0	3.2e-32
WP_046160480.1|2041129_2041663_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046160481.1|2041685_2042537_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052006225.1|2042709_2043855_-	ThiF family adenylyltransferase	NA	A0A1V0SCZ9	Indivirus	21.1	4.3e-05
WP_033881552.1|2043859_2044690_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080480860.1|2044701_2045934_-	MFS transporter	NA	NA	NA	NA	NA
WP_031600262.1|2046017_2047265_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_041054825.1|2049143_2049479_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	100.0	4.2e-54
WP_041338710.1|2049522_2049882_-	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	100.0	3.5e-62
WP_072592542.1|2050141_2050225_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_019712872.1|2050513_2051047_-	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
WP_019712871.1|2051082_2051661_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
WP_014479998.1|2051716_2052175_-	hypothetical protein	NA	A0A1P8CWJ1	Bacillus_phage	85.5	2.8e-72
WP_003231326.1|2052267_2052726_-	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_015251922.1|2054636_2055194_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.1	5.3e-102
>prophage 7
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	2236272	2292461	4086692	protease,transposase	Bacillus_phage(35.0%)	57	NA	NA
WP_087614170.1|2236272_2237423_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_088272613.1|2237541_2238591_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_014477197.1|2238603_2239752_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_024572170.1|2239984_2240659_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_003230553.1|2240737_2240914_-	YpfB family protein	NA	NA	NA	NA	NA
WP_029317976.1|2240958_2241612_-	cyclic di-GMP receptor DgrA	NA	NA	NA	NA	NA
WP_029726759.1|2241704_2243057_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_088272380.1|2243091_2244012_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
WP_014480144.1|2244164_2244821_-|protease	intramembrane metalloprotease PrsW	protease	NA	NA	NA	NA
WP_157673324.1|2244852_2245914_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_003230536.1|2246023_2247298_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003230533.1|2247453_2248038_-	genetic competence negative regulator	NA	NA	NA	NA	NA
WP_014480147.1|2249060_2249504_-	YpbF family protein	NA	NA	NA	NA	NA
WP_004398603.1|2249566_2250289_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072173318.1|2250239_2250809_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_014480148.1|2250868_2252359_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.3	3.2e-61
WP_014480149.1|2252351_2253410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003225461.1|2253675_2253924_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_004399159.1|2253963_2254536_-	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_046160519.1|2255032_2256610_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.4	5.8e-37
WP_088272381.1|2256651_2257419_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_088272382.1|2257530_2258634_-	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
WP_003230521.1|2258569_2259154_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_014480153.1|2259357_2261127_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	1.2e-38
WP_003246107.1|2261123_2261846_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
WP_014480154.1|2261926_2263102_-	cytochrome c biogenesis protein ResC	NA	NA	NA	NA	NA
WP_014480155.1|2263121_2264750_-	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_014480156.1|2264746_2265286_-	thiol-disulfide oxidoreductase ResA	NA	NA	NA	NA	NA
WP_004398815.1|2265380_2266115_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003230509.1|2266206_2266743_-	spore maturation protein SpmB	NA	NA	NA	NA	NA
WP_004398980.1|2266747_2267338_-	spore maturation protein SbmA	NA	NA	NA	NA	NA
WP_014480157.1|2267325_2268474_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	6.0e-23
WP_014477219.1|2268596_2269136_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_014480158.1|2269190_2269784_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.6e-14
WP_014477220.1|2269773_2270529_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_014480159.1|2270808_2271333_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2271346_2271721_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_088272383.1|2271833_2272298_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_038828558.1|2272330_2273527_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_014480161.1|2273541_2274189_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_032726066.1|2274199_2275285_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
WP_003230488.1|2275679_2276024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272384.1|2276258_2276810_-	signal peptidase I	NA	NA	NA	NA	NA
WP_046160525.1|2277251_2277458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003230479.1|2277627_2277840_+	spore germination protein	NA	NA	NA	NA	NA
WP_031600647.1|2279889_2280609_+	hypothetical protein	NA	D2XR29	Bacillus_phage	37.8	7.2e-43
WP_031600648.1|2280993_2281959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881339.1|2282032_2282353_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_031600649.1|2282376_2283231_-	C1 family peptidase	NA	A0A1X6WFA2	Pacmanvirus	29.5	3.4e-23
WP_069964195.1|2283514_2284237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031600262.1|2284352_2285600_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_088272385.1|2285686_2286766_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_088272386.1|2286822_2287050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272387.1|2287406_2288522_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	71.9	1.9e-146
WP_069964114.1|2288849_2290613_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.7	1.5e-126
WP_069964115.1|2290628_2291096_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_031600262.1|2291213_2292461_+|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
>prophage 8
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	2530824	2576824	4086692	coat,holin,protease,transposase	uncultured_Caudovirales_phage(22.22%)	49	NA	NA
WP_014480339.1|2530824_2532372_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_014479891.1|2532368_2533127_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_072592549.1|2533719_2533806_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_157673326.1|2535218_2535524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480344.1|2535916_2536396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881358.1|2537012_2537279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049832653.1|2537417_2537570_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	76.0	8.4e-18
WP_088272402.1|2539057_2539879_-	multidrug efflux transcriptional regulator BltR	NA	NA	NA	NA	NA
WP_029727180.1|2539995_2541198_+	multidrug efflux MFS transporter Blt	NA	NA	NA	NA	NA
WP_015714357.1|2541366_2541825_+	spermine/spermidine acetyltransferase	NA	NA	NA	NA	NA
WP_031600262.1|2541857_2543105_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_019712547.1|2543350_2544655_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014477437.1|2544944_2545088_-	YrzO family protein	NA	NA	NA	NA	NA
WP_014480355.1|2546195_2547062_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014480356.1|2547181_2548219_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	26.5	6.4e-16
WP_088272403.1|2548306_2549242_-	CDF family zinc transporter CzcD	NA	NA	NA	NA	NA
WP_088272404.1|2549919_2551242_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_014480359.1|2551402_2551735_-	branched-chain amino acid transporter AzlD	NA	NA	NA	NA	NA
WP_088272405.1|2552470_2552944_-	azlBCD operon transcriptional regulator AzlB	NA	NA	NA	NA	NA
WP_017697606.1|2553267_2553543_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_088272406.1|2553812_2555045_-	cytochrome P450	NA	NA	NA	NA	NA
WP_014480365.1|2555707_2556274_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_072592606.1|2556502_2556874_-	YrdB family protein	NA	NA	NA	NA	NA
WP_014480368.1|2557705_2558209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272407.1|2558428_2559283_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.6	5.7e-95
WP_014480370.1|2559678_2560722_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_088272408.1|2561069_2561867_+	glutamate racemase	NA	NA	NA	NA	NA
WP_032726255.1|2562247_2562955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072175780.1|2563529_2563607_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_033881351.1|2563893_2564055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046160629.1|2564118_2564877_-	ZinT family metal-binding protein	NA	NA	NA	NA	NA
WP_046160630.1|2565010_2565541_-	RNA polymerase sigma factor SigZ	NA	A0A1V0DZZ1	Clostridioides_phage	24.8	2.1e-07
WP_029318151.1|2565676_2566657_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014480377.1|2566815_2567631_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.7e-19
WP_015384191.1|2568067_2568331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038829669.1|2568467_2569283_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004398671.1|2569689_2570046_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004399021.1|2570098_2570458_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_119123071.1|2570729_2570831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398984.1|2570973_2571360_-	VOC family protein	NA	NA	NA	NA	NA
WP_003229845.1|2571622_2571868_+|coat	spore coat protein F-like protein YraG	coat	NA	NA	NA	NA
WP_009967868.1|2571885_2572254_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_014480383.1|2572272_2573409_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	7.7e-15
WP_014480384.1|2573427_2573625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480385.1|2573640_2573940_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014480386.1|2574202_2574625_-	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_014480387.1|2574807_2575002_+	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_014480388.1|2575132_2576182_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_003229836.1|2576314_2576824_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
>prophage 9
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	2663635	2719986	4086692	coat,tRNA,protease,transposase	Faustovirus(14.29%)	52	NA	NA
WP_014480446.1|2663635_2664799_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_003229691.1|2664915_2666022_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_088272415.1|2666008_2666878_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003229687.1|2666831_2668427_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_088272416.1|2668529_2669717_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.0e-33
WP_004398582.1|2669676_2670219_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_069964238.1|2670242_2671100_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2671116_2671560_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|2671620_2672907_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014480451.1|2672940_2673519_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2673596_2673719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2673839_2674124_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2674136_2674475_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2674477_2674786_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014480452.1|2674932_2675799_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_014480453.1|2675791_2676586_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_014480454.1|2676735_2677542_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2677543_2678224_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2678276_2678795_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2678791_2679664_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2679694_2680708_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_014480455.1|2680799_2681495_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_014480456.1|2681531_2682101_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_014480457.1|2682253_2683252_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|2683385_2684132_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014480460.1|2684271_2685564_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_088272417.1|2685623_2688266_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.8	9.8e-162
WP_003222590.1|2688713_2688905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480462.1|2688923_2689949_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_014480463.1|2689981_2691703_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_014480464.1|2691833_2693126_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_014480465.1|2693155_2694130_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014480466.1|2694126_2694915_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_014480467.1|2694904_2695849_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2695881_2696712_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2696719_2698087_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2698316_2698814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2698835_2699423_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014480468.1|2699419_2701744_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_003229613.1|2703735_2704998_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_003229611.1|2705269_2706544_-	trigger factor	NA	NA	NA	NA	NA
WP_041052474.1|2706771_2707776_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_014480472.1|2707895_2708495_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229604.1|2708507_2709926_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_014480473.1|2709975_2711073_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_033881607.1|2711093_2712650_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|2712636_2713665_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|2713688_2714207_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_014480476.1|2714203_2715928_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.2	2.4e-60
WP_038827685.1|2716740_2717076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069837666.1|2717877_2718702_+	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_087614170.1|2718836_2719986_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
>prophage 10
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	2957526	3008353	4086692	coat,holin,transposase	Staphylococcus_phage(22.22%)	44	NA	NA
WP_014477741.1|2957526_2957931_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|2958096_2958534_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|2958626_2958803_+	YtzI protein	NA	NA	NA	NA	NA
WP_014480629.1|2958796_2959234_-	FixH family protein	NA	NA	NA	NA	NA
WP_003219361.1|2959353_2959827_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003229076.1|2959954_2960182_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_014477744.1|2960178_2960742_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003219346.1|2960835_2961084_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_014480630.1|2961289_2962621_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_014480631.1|2962664_2963705_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_014480632.1|2963758_2963917_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_069837708.1|2963935_2964823_-	manganese ABC transporter permease MntD	NA	NA	NA	NA	NA
WP_088272449.1|2964812_2966120_-	manganese ABC transporter permease MntC	NA	NA	NA	NA	NA
WP_017695441.1|2966125_2966878_-	manganese ABC transporter ATP-binding protein MntB	NA	A0A1V0SE00	Indivirus	27.1	6.0e-16
WP_014480636.1|2966896_2967817_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_087961500.1|2968096_2969212_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_087961499.1|2969208_2970669_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	5.5e-74
WP_003229054.1|2970759_2971575_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_041337037.1|2971609_2972434_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_041052658.1|2972421_2974164_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_017695436.1|2974160_2975576_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_017695435.1|2975865_2976585_+	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_014480643.1|2976593_2977412_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	6.3e-51
WP_088272451.1|2977583_2978870_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.9e-71
WP_017695432.1|2978866_2979817_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.6	2.9e-31
WP_088272452.1|2979819_2981028_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_014480647.1|2981115_2981544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480648.1|2981545_2982601_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_014480649.1|2982615_2983749_-|coat	spore coat protein CotSA	coat	NA	NA	NA	NA
WP_072592554.1|2983938_2985012_+|coat	spore coat kinase CotI	coat	NA	NA	NA	NA
WP_014480651.1|2985091_2985559_+	TspO/MBR family protein	NA	NA	NA	NA	NA
WP_014480652.1|2985589_2987986_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.2e-12
WP_014480653.1|2987972_2989427_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004398841.1|2989423_2990455_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_003229018.1|2990478_2991621_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_088272454.1|2991617_2993501_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_003228966.1|3001168_3001747_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_014480655.1|3001788_3002310_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014480656.1|3002327_3003857_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
WP_032727091.1|3003877_3004402_-	membrane protein	NA	NA	NA	NA	NA
WP_014478926.1|3004679_3005804_-|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_003242867.1|3005984_3006473_+	DinB family protein	NA	NA	NA	NA	NA
WP_069837716.1|3006478_3007057_-	molybdenum cofactor sulfurase	NA	NA	NA	NA	NA
WP_003243227.1|3007144_3008353_-|holin	choline dehydrogenase	holin	NA	NA	NA	NA
>prophage 11
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	3248794	3350273	4086692	tail,terminase,plate,capsid,integrase,holin,protease,portal,head,transposase	Bacillus_phage(62.96%)	114	3295069:3295091	3333444:3333466
WP_014478984.1|3248794_3250147_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	41.8	1.4e-87
WP_003228493.1|3250274_3251153_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_014480842.1|3251224_3252967_-	two-component system sensor histidine kinase YvrG	NA	W8CYF6	Bacillus_phage	24.2	1.3e-16
WP_003243545.1|3252963_3253677_-	two-component system response regulator YvrH	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
WP_003228484.1|3253828_3254068_-	sigma-O factor regulator RsoA	NA	NA	NA	NA	NA
WP_088272473.1|3254004_3254643_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003244090.1|3254793_3254946_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_014480845.1|3255066_3256224_+	oxalate decarboxylase	NA	NA	NA	NA	NA
WP_003243579.1|3256284_3256695_+	acid stress-sensitive anti sigma factor RsiO	NA	NA	NA	NA	NA
WP_014480847.1|3256727_3257957_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014480848.1|3257949_3258639_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.4e-40
WP_014480849.1|3258622_3259816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003243882.1|3259986_3260796_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	1.1e-10
WP_003244298.1|3260811_3261822_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_080478450.1|3261821_3262976_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_038829338.1|3263073_3264021_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069837773.1|3264255_3265665_-	amino acid permease	NA	NA	NA	NA	NA
WP_003221612.1|3266064_3266205_-	small, acid-soluble spore protein, SspJ family	NA	NA	NA	NA	NA
WP_003228444.1|3266371_3266854_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
WP_014480853.1|3266953_3268807_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.3	3.6e-86
WP_064671659.1|3268834_3269761_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_088272475.1|3269871_3270654_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157673327.1|3270625_3271318_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015483687.1|3271348_3272179_-	glyoxal/methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.8	1.7e-80
WP_014480858.1|3272401_3272887_+	stress response protein YvgO	NA	NA	NA	NA	NA
WP_014480859.1|3272931_3274944_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_088272477.1|3275198_3276914_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_088272478.1|3276939_3278757_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_088272479.1|3278927_3281252_-	DNA helicase IV	NA	NA	NA	NA	NA
WP_003219999.1|3281445_3282054_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_024572513.1|3282239_3282656_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_003228414.1|3282660_3283329_-	disulfide bond formation protein BdbD	NA	NA	NA	NA	NA
WP_157673328.1|3283443_3285552_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.9	4.3e-112
WP_088272482.1|3285712_3288121_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	6.5e-120
WP_003228406.1|3288203_3288413_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_003228404.1|3288488_3288794_-	copper-sensing transcriptional repressor CsoR	NA	NA	NA	NA	NA
WP_014480865.1|3288921_3289998_+	scyllo-inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_014480871.1|3293055_3293415_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_014480872.1|3293411_3293984_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003228388.1|3294094_3294889_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
3295069:3295091	attL	TATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_033882082.1|3295398_3295587_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	53.3	1.4e-11
WP_014480874.1|3295748_3297332_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	59.7	4.2e-75
WP_014480875.1|3297346_3297736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105778748.1|3298078_3298681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014480877.1|3298720_3299662_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	77.1	3.0e-97
WP_014480878.1|3299703_3300126_-|holin	holin family protein	holin	D6R405	Bacillus_phage	85.7	3.0e-57
WP_088272483.1|3300179_3300350_-	XkdX family protein	NA	NA	NA	NA	NA
WP_088272484.1|3300346_3300646_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	79.2	4.5e-39
WP_046160649.1|3300661_3301783_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	92.2	4.8e-195
WP_088272486.1|3301819_3303373_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	85.7	9.9e-255
WP_031600926.1|3303409_3305116_-	hypothetical protein	NA	D6R400	Bacillus_phage	81.8	9.4e-267
WP_031600927.1|3305127_3305967_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	83.2	8.5e-136
WP_088272488.1|3305966_3309845_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	80.9	0.0e+00
WP_017696308.1|3309857_3310037_-	hypothetical protein	NA	D6R3Z7	Bacillus_phage	68.5	1.6e-12
WP_003220222.1|3310039_3310378_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	70.5	3.0e-39
WP_017696306.1|3310432_3311044_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	89.7	7.9e-99
WP_031600930.1|3311044_3311425_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	66.1	2.6e-39
WP_088272490.1|3311421_3311805_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	89.0	5.3e-61
WP_088272491.1|3311797_3312169_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	67.5	7.8e-41
WP_088272492.1|3312101_3312449_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	89.6	2.8e-53
WP_088272493.1|3312464_3312920_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	60.2	9.6e-25
WP_088272494.1|3312948_3313263_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	66.7	9.8e-29
WP_088272495.1|3313278_3314481_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	71.3	7.3e-157
WP_003220242.1|3314517_3315144_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	92.8	1.8e-106
WP_033882052.1|3315133_3316381_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	86.5	1.3e-217
WP_033882051.1|3316386_3316602_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.6	1.3e-24
WP_088272496.1|3316614_3318324_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	92.4	0.0e+00
WP_017697674.1|3318323_3318857_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	82.5	1.0e-70
WP_088272497.1|3318928_3319270_-	transglycosylase	NA	Q9T203	Bacillus_phage	67.6	1.8e-39
WP_087961627.1|3319238_3319613_-	HNH endonuclease	NA	Q38456	Bacillus_phage	87.1	3.9e-64
WP_088272498.1|3319609_3320026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272499.1|3320015_3320261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272500.1|3320388_3320781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087961623.1|3320759_3321155_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_003220264.1|3321394_3321937_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_088272501.1|3321936_3322386_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	58.8	2.3e-39
WP_041850152.1|3322637_3322838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272503.1|3322834_3323269_-	hypothetical protein	NA	M4ZRL6	Bacillus_phage	93.8	1.9e-78
WP_088272504.1|3323268_3323829_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	51.5	1.8e-41
WP_088272505.1|3323825_3324062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272506.1|3324171_3324585_-	hypothetical protein	NA	O64129	Bacillus_phage	86.0	4.6e-66
WP_088272507.1|3324588_3324846_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	42.5	4.7e-05
WP_014480886.1|3324842_3325250_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	45.8	1.3e-25
WP_014480887.1|3325246_3325564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480888.1|3325560_3325923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220282.1|3325965_3326163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003237439.1|3326409_3326550_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_014480892.1|3326657_3327206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480894.1|3327520_3328348_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.9	3.7e-35
WP_014480895.1|3328331_3329213_-	phage replisome organiser	NA	V9QKF6	Oenococcus_phage	33.1	6.8e-27
WP_033881245.1|3329205_3329424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881244.1|3329448_3329640_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	59.0	1.0e-12
WP_014480896.1|3329691_3329895_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014480897.1|3330129_3330528_+	helix-turn-helix transcriptional regulator	NA	S5M5X8	Brevibacillus_phage	33.7	4.3e-05
WP_014480900.1|3330960_3332061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003220025.1|3333985_3334456_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
3333444:3333466	attR	TATGTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_069837784.1|3334600_3336940_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	43.4	1.3e-88
WP_003242610.1|3336958_3337699_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|3337830_3338061_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_014480904.1|3338209_3338983_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220031.1|3339016_3339250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003220034.1|3339401_3339809_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|3339838_3340258_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|3340349_3340676_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_088272508.1|3340799_3342125_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.8	7.4e-17
WP_088272615.1|3342142_3342499_+	methyl-accepting transducer	NA	NA	NA	NA	NA
WP_088272509.1|3342539_3343220_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_088272510.1|3343236_3344157_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3344168_3344822_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_014480910.1|3346266_3346800_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478003.1|3346831_3347506_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_031600963.1|3347523_3348435_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3348454_3349108_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_014480912.1|3349130_3350273_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	29.6	2.8e-12
>prophage 12
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	3691052	3711789	4086692	tRNA,bacteriocin,transposase	Shigella_phage(25.0%)	19	NA	NA
WP_087614167.1|3691052_3692242_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	36.6	1.6e-31
WP_003227612.1|3692343_3693951_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
WP_014481200.1|3694192_3694699_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_014481201.1|3694881_3696021_-	acyl-CoA dehydrogenase AcdA	NA	NA	NA	NA	NA
WP_088272547.1|3696017_3698135_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_014481203.1|3698288_3699485_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_050258580.1|3699497_3700460_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.6	7.7e-40
WP_003227597.1|3700540_3700813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272548.1|3702441_3704112_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014481216.1|3704108_3704537_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3704851_3704983_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3704939_3705092_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_069837825.1|3705116_3706463_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3706475_3706637_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_014481218.1|3706633_3707353_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.6e-18
WP_088272549.1|3707345_3708656_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_088272619.1|3708645_3709806_+	insulinase family protein	NA	NA	NA	NA	NA
WP_088272550.1|3709810_3711091_+	insulinase family protein	NA	NA	NA	NA	NA
WP_088272551.1|3711087_3711789_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
>prophage 13
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	3721494	3771821	4086692	coat,tRNA,protease	Bacillus_phage(25.0%)	49	NA	NA
WP_003243167.1|3721494_3722154_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3722262_3722451_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|3722493_3722913_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014481228.1|3723032_3724949_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.4	1.9e-143
WP_069837834.1|3725793_3727194_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|3727193_3727664_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3727775_3728276_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|3728311_3729613_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3729774_3729999_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003227516.1|3730213_3730990_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_033881831.1|3731133_3732024_-	DMT family transporter	NA	NA	NA	NA	NA
WP_014481232.1|3732192_3733038_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_088272553.1|3733086_3733986_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_088272554.1|3734131_3735103_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_121549190.1|3735377_3736142_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_087961721.1|3736274_3737054_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_121549192.1|3736946_3737228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272555.1|3737494_3738733_-	MFS transporter	NA	NA	NA	NA	NA
WP_088272556.1|3738942_3740355_-	amino acid permease	NA	NA	NA	NA	NA
WP_088272557.1|3740354_3742055_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3742128_3743676_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3743902_3745177_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|3745354_3745819_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_069837835.1|3746143_3746599_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_069837836.1|3746591_3747443_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	1.7e-38
WP_003244201.1|3747456_3748404_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_017696230.1|3748403_3749144_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	42.0	7.7e-48
WP_017696229.1|3749168_3750188_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017696228.1|3750190_3750913_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_041054693.1|3750905_3752027_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_069837837.1|3752026_3752896_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069837838.1|3752896_3754066_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	27.2	6.5e-17
WP_069837839.1|3754086_3755508_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3755512_3756283_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_069837841.1|3756602_3757133_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_088272558.1|3757176_3757548_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|3757609_3758932_-	purine permease	NA	NA	NA	NA	NA
WP_121549196.1|3758951_3759269_-	YwdI family protein	NA	NA	NA	NA	NA
WP_069837842.1|3759436_3760807_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003242965.1|3760830_3761508_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_015250953.1|3761521_3762328_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014481258.1|3762519_3763335_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3763425_3763674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481259.1|3763767_3765207_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.8	3.7e-22
WP_014481260.1|3765203_3766589_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3766890_3767661_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_069837843.1|3767699_3768530_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3768569_3768872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069837844.1|3769400_3771821_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 14
NZ_CP021892	Bacillus subtilis subsp. subtilis strain SRCM100333 chromosome, complete genome	4086692	3929609	3993016	4086692	coat,holin,transposase	Planktothrix_phage(10.0%)	58	NA	NA
WP_043858344.1|3929609_3929975_+|coat	inner spore coat protein CotNE	coat	NA	NA	NA	NA
WP_043858345.1|3930222_3930576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003243293.1|3930619_3931018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088272583.1|3931131_3932052_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003227084.1|3932092_3932440_-	YxeA family protein	NA	NA	NA	NA	NA
WP_017696088.1|3932453_3934322_-	ABC transporter permease YxdM	NA	NA	NA	NA	NA
WP_014115765.1|3934296_3935070_-	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	37.7	5.2e-31
WP_015385109.1|3935213_3936191_-	two-component system sensor histidine kinase YxdJ	NA	NA	NA	NA	NA
WP_003243527.1|3936187_3936877_-	two-component system response regulator YxdJ	NA	NA	NA	NA	NA
WP_088272584.1|3936984_3937857_-	6-phospho-5-dehydro-2-deoxy-D-gluconate aldolase	NA	NA	NA	NA	NA
WP_014481412.1|3937877_3938714_-	2-keto-myo-inositol isomerase	NA	NA	NA	NA	NA
WP_088272585.1|3938799_3939669_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014481414.1|3939688_3940723_-	bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase	NA	NA	NA	NA	NA
WP_014481415.1|3940745_3942062_-	myo-inositol transporter IolF	NA	NA	NA	NA	NA
WP_014481416.1|3942076_3942970_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_014481417.1|3942986_3944900_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_014478485.1|3944932_3945910_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_088272586.1|3945933_3946749_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_088272587.1|3946823_3948287_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088272588.1|3948703_3949459_+	myo-inositol utilization transcriptional regulator IolR	NA	NA	NA	NA	NA
WP_003227049.1|3949512_3950445_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003244225.1|3950706_3951357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088272589.1|3951360_3951669_+	DUF2653 family protein	NA	NA	NA	NA	NA
WP_088272590.1|3953338_3955219_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.5	3.6e-94
WP_014481429.1|3955386_3955638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033881094.1|3956829_3957030_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014481433.1|3957652_3957871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481434.1|3957915_3958137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014478926.1|3958458_3959583_+|transposase	IS4-like element IS4Bsu1 family transposase	transposase	NA	NA	NA	NA
WP_014481435.1|3959860_3960115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014481436.1|3960278_3962462_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	30.8	1.7e-50
WP_014481437.1|3962462_3963932_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_031600262.1|3964065_3965313_-|transposase	IS256-like element ISBsu2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	22.6	2.6e-24
WP_088272591.1|3965717_3966752_-	quercetin 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_088272592.1|3966845_3967421_-	transcriptional regulator YxaF	NA	NA	NA	NA	NA
WP_088272593.1|3967552_3968623_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_087614160.1|3968749_3969899_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	61.2	1.7e-38
WP_003243994.1|3969970_3970402_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088272594.1|3970628_3971033_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_017697265.1|3971002_3971695_+	LrgB family protein	NA	NA	NA	NA	NA
WP_088272595.1|3971734_3972766_-	general stress protein	NA	NA	NA	NA	NA
WP_088272596.1|3972858_3974007_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.6	1.5e-50
WP_003243132.1|3974202_3974934_+	gluconate operon transcriptional repressor GntR	NA	NA	NA	NA	NA
WP_014481444.1|3974926_3976468_+	gluconokinase	NA	NA	NA	NA	NA
WP_069964432.1|3976496_3977843_+	gluconate permease GntP	NA	NA	NA	NA	NA
WP_015715037.1|3977865_3979272_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	1.7e-32
WP_015483942.1|3979761_3980325_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_088272597.1|3980338_3981868_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.7e-33
WP_088272598.1|3981977_3983417_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_046381466.1|3983430_3983649_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_040081205.1|3983992_3984703_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014478516.1|3984793_3985516_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_014481448.1|3985536_3986166_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_088272599.1|3986646_3988572_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_033880917.1|3989022_3989316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481451.1|3989853_3990294_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	34.4	3.4e-11
WP_014479891.1|3990713_3991472_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.6	5.8e-43
WP_014480339.1|3991468_3993016_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
