The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	697488	705168	2996610	plate	Myoviridae_environmental_samples(28.57%)	10	NA	NA
WP_003625401.1|697488_698751_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	38.3	2.5e-30
WP_003625399.1|698823_699270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812546.1|699392_699962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812545.1|699968_701066_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	34.5	5.9e-12
WP_012812544.1|701073_701652_-	DUF2612 domain-containing protein	NA	Q6UIZ7	Burkholderia_virus	38.6	1.3e-29
WP_041632464.1|701651_702887_-	phage Mu protein	NA	A0A2R3UAL9	Myoviridae_environmental_samples	38.8	1.2e-61
WP_012812542.1|702873_703227_-	hypothetical protein	NA	A0A068CCM1	Acinetobacter_phage	42.1	1.1e-12
WP_012812541.1|703238_703928_-|plate	baseplate assembly protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	43.1	3.1e-35
WP_012812540.1|703924_704851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003628974.1|704847_705168_-	hypothetical protein	NA	A0A191ZDK0	Acinetobacter_phage	36.2	8.3e-07
>prophage 2
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	709694	719379	2996610	terminase	Aeromonas_phage(42.86%)	12	NA	NA
WP_012812535.1|709694_710849_-	DUF3383 family protein	NA	E2GLU1	Acinetobacter_phage	33.0	2.8e-28
WP_041632462.1|710867_711440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812533.1|711400_711781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812532.1|711771_712278_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_012812531.1|712314_712632_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.4	2.5e-11
WP_088365025.1|712675_713713_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	47.0	4.1e-79
WP_012812529.1|713712_714213_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	46.9	9.2e-29
WP_012812528.1|714250_715252_-	DUF2213 domain-containing protein	NA	A0A2R3UAL3	Myoviridae_environmental_samples	36.5	1.1e-28
WP_012812527.1|715248_716628_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	7.8e-86
WP_082179749.1|716642_716861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041632588.1|716875_717928_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_012812525.1|717924_719379_-|terminase	phage terminase large subunit	terminase	A0A1X9SGU8	Bradyrhizobium_phage	45.2	6.7e-104
>prophage 3
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	757784	779271	2996610	head,portal,capsid,integrase,protease,terminase,tail	Pseudomonas_phage(25.0%)	34	755251:755266	786457:786472
755251:755266	attL	GCTGGCAGGCTGCGGA	NA	NA	NA	NA
WP_088364641.1|757784_758831_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	37.0	1.1e-50
WP_088364642.1|758830_759088_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_088364643.1|759084_759444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364644.1|759440_760013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666394.1|760025_760214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364646.1|760318_760774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364647.1|760770_761118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364648.1|761093_761378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666395.1|761374_761611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364650.1|761733_762138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666396.1|762097_762436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364651.1|762432_762810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365026.1|762894_763176_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088364652.1|763339_763546_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157666397.1|763592_764420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364654.1|764534_764861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364655.1|765149_765629_+	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	35.9	2.5e-07
WP_088364656.1|765628_765823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364657.1|765809_765995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364658.1|765987_766407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364659.1|766403_767432_+	hypothetical protein	NA	A0A0U4B0G9	Pseudomonas_phage	35.8	5.0e-13
WP_088364660.1|767379_769308_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088364661.1|769567_769999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365027.1|770109_770433_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_050819265.1|770586_770886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364662.1|770886_772617_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	45.1	3.8e-130
WP_088364663.1|772613_773945_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	45.7	3.6e-88
WP_088364664.1|773937_774789_+|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	39.3	2.1e-17
WP_088364665.1|774858_776097_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	46.7	2.3e-89
WP_088365028.1|776121_776763_+	hypothetical protein	NA	B0VK37	Azospirillum_phage	26.1	3.1e-05
WP_088364666.1|776759_777083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364667.1|777082_777523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364668.1|777519_777966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364669.1|778008_779271_+|tail	phage tail protein	tail	NA	NA	NA	NA
786457:786472	attR	GCTGGCAGGCTGCGGA	NA	NA	NA	NA
>prophage 4
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	941882	984186	2996610	head,transposase,integrase,terminase,plate	Aeromonas_phage(17.39%)	58	976721:976734	987266:987279
WP_088364702.1|941882_942530_-|plate	baseplate assembly protein	plate	H9C0X6	Aeromonas_phage	48.7	6.7e-32
WP_088364703.1|942516_943470_-	hypothetical protein	NA	A0A2R3UAK8	Myoviridae_environmental_samples	30.1	1.7e-31
WP_088365029.1|943771_944512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364705.1|944712_945000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364706.1|945044_945854_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	37.8	8.5e-16
WP_088364707.1|945850_946180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364708.1|946192_946414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364709.1|946514_947114_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_088364710.1|947171_947654_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	33.1	2.0e-12
WP_088364711.1|948002_948587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364713.1|949134_949878_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	40.9	1.5e-38
WP_088364714.1|950059_950290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666401.1|950406_950601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364715.1|950601_950838_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_088364716.1|950866_951061_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_157666402.1|951089_952433_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	33.9	6.7e-50
WP_088364718.1|953880_955266_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_088364719.1|956536_957001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364720.1|957000_957438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364721.1|957440_958598_-	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	35.0	9.9e-34
WP_157666403.1|958600_959158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364723.1|959094_959493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666404.1|959492_960077_-	hypothetical protein	NA	A0A2H4P6T2	Pseudomonas_phage	39.1	2.0e-22
WP_088364725.1|960061_960478_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	40.3	8.5e-12
WP_088364726.1|960487_960826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364727.1|960829_961870_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.3	6.3e-80
WP_088364728.1|961869_962370_-	hypothetical protein	NA	I2GUD6	Acinetobacter_phage	47.3	1.2e-28
WP_088364729.1|963812_964643_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	35.7	8.9e-45
WP_088364730.1|964639_966130_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.8	2.7e-100
WP_088364731.1|966129_967614_-	hypothetical protein	NA	A0A1Y0T3N1	Sinorhizobium_phage	39.2	1.7e-75
WP_088364732.1|967594_968068_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	62.4	6.6e-45
WP_088364733.1|968204_968573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666405.1|968612_969173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666406.1|969359_970034_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_157666407.1|970113_970287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666408.1|970283_970601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364737.1|970796_971798_-	hypothetical protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	44.0	3.7e-37
WP_088364739.1|972260_972443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364740.1|972439_972703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364741.1|972811_974311_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	32.7	2.0e-55
WP_088364742.1|974307_975246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082246873.1|975596_975935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364744.1|976015_976219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364745.1|976212_976755_-	HNH nuclease	NA	A0A0N9BAQ5	Vibrio_phage	29.5	3.2e-11
976721:976734	attL	TTGCTGGTTTTCCA	NA	NA	NA	NA
WP_088364746.1|976751_977033_-	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	49.4	9.8e-12
WP_044583033.1|977029_977224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666409.1|977336_977735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364747.1|977783_978023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364748.1|978025_978490_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	50.3	5.9e-38
WP_157666410.1|978502_978919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666411.1|979009_979285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364751.1|979654_979999_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088364753.1|980408_980747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666412.1|981502_982219_+	hypothetical protein	NA	Q8SBE6	Shigella_phage	55.5	1.8e-25
WP_088364754.1|982230_982542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364755.1|982538_982829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364756.1|982828_983053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364757.1|983052_984186_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	38.5	1.8e-40
987266:987279	attR	TTGCTGGTTTTCCA	NA	NA	NA	NA
>prophage 5
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	1328501	1383495	2996610	head,portal,tRNA,capsid,integrase,protease,tail	Azospirillum_phage(16.67%)	59	1380056:1380073	1387636:1387653
WP_003623236.1|1328501_1329194_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_012812265.1|1329190_1329820_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_003623238.1|1329886_1330447_-	NifU family protein	NA	NA	NA	NA	NA
WP_012812264.1|1330673_1331909_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_012812263.1|1331987_1333286_-	YncE family protein	NA	NA	NA	NA	NA
WP_003623241.1|1333393_1334233_-	creatininase family protein	NA	NA	NA	NA	NA
WP_003623248.1|1337334_1338294_+	tetratricopeptide repeat protein	NA	A0A1J0GW78	Streptomyces_phage	37.6	3.5e-08
WP_003623250.1|1338308_1339013_+	peptidase	NA	NA	NA	NA	NA
WP_003623252.1|1339039_1339225_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_003623254.1|1339255_1339642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012812260.1|1341049_1341577_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_012812259.1|1341816_1342296_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_088364770.1|1342559_1343192_-	semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014457637.1|1343560_1344640_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_014457636.1|1344636_1345338_+	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	25.9	1.6e-07
WP_014457634.1|1345827_1346403_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003623266.1|1347779_1348364_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_157666414.1|1348691_1348859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364771.1|1348913_1349114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364772.1|1349115_1349496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364679.1|1349537_1349849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364773.1|1349841_1350021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365035.1|1350017_1350575_-	lysozyme	NA	A0A291LB53	Caulobacter_phage	33.3	1.0e-12
WP_088364677.1|1350679_1350991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364774.1|1351051_1351798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364775.1|1351794_1352547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457195.1|1352546_1353329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364776.1|1353330_1354962_-	hypothetical protein	NA	B0VK48	Azospirillum_phage	29.3	2.6e-24
WP_088364777.1|1361207_1361939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365036.1|1361943_1362318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364778.1|1362865_1364128_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_088364779.1|1364170_1364617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364780.1|1364613_1365054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364781.1|1365053_1365377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365037.1|1365373_1366015_-	hypothetical protein	NA	B0VK37	Azospirillum_phage	25.7	3.1e-05
WP_088364782.1|1366039_1367281_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	46.8	2.7e-90
WP_088364783.1|1367350_1368202_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	39.3	2.1e-17
WP_088364784.1|1368194_1369526_-|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	45.8	4.7e-88
WP_050819265.1|1371252_1371552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365027.1|1371705_1372029_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_088364661.1|1372139_1372571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364785.1|1372828_1374760_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_088364786.1|1374713_1375736_-	hypothetical protein	NA	A0A0U4B0G9	Pseudomonas_phage	36.5	6.5e-13
WP_064776470.1|1375732_1376152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364787.1|1376144_1376330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364788.1|1376316_1376511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364789.1|1376500_1376971_-	hypothetical protein	NA	A0A0A8IL22	Aurantimonas_phage	35.2	9.3e-07
WP_157666415.1|1377259_1377580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080986749.1|1377576_1377828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050819274.1|1377912_1378554_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088364792.1|1378891_1379269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666416.1|1379265_1379625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364794.1|1379621_1379918_+	hypothetical protein	NA	NA	NA	NA	NA
1380056:1380073	attL	CCTGAATGGTTTTTGGAA	NA	NA	NA	NA
WP_088364796.1|1380236_1380692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364797.1|1380986_1381559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365038.1|1381573_1381942_+|protease	membrane protease subunit	protease	A0A0X8WNX5	Ralstonia_phage	47.8	1.2e-20
WP_088364798.1|1381938_1382340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365039.1|1382407_1382620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666417.1|1382709_1383495_+|integrase	tyrosine-type recombinase/integrase	integrase	B6SCW8	Bacteriophage	33.8	6.7e-18
1387636:1387653	attR	TTCCAAAAACCATTCAGG	NA	NA	NA	NA
>prophage 6
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	1636299	1687084	2996610	tRNA,transposase	Burkholderia_virus(25.0%)	41	NA	NA
WP_035352292.1|1636299_1637217_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_014457520.1|1637248_1637518_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003624193.1|1637795_1639946_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003624195.1|1640005_1641424_+	2-nitropropane dioxygenase	NA	NA	NA	NA	NA
WP_003624197.1|1641512_1641698_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_014457519.1|1641891_1644657_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.3	3.0e-97
WP_003624202.1|1644653_1645193_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	3.1e-30
WP_014457518.1|1645234_1645726_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	51.6	1.2e-33
WP_014457517.1|1646044_1646962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041632568.1|1646990_1649453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457515.1|1649607_1650075_+	adenosylmethionine decarboxylase	NA	A0A1D7SEZ2	Cyanophage	41.7	2.1e-14
WP_014457514.1|1650186_1651059_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_014457513.1|1651356_1652493_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_003624219.1|1652536_1652902_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003624220.1|1652913_1655883_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	53.2	1.6e-277
WP_014457511.1|1656050_1656824_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003624223.1|1657117_1657468_-	RidA family protein	NA	NA	NA	NA	NA
WP_014457510.1|1657555_1658206_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003624225.1|1658199_1659291_-	XdhC family protein	NA	NA	NA	NA	NA
WP_003624226.1|1659406_1659829_+	host attachment protein	NA	NA	NA	NA	NA
WP_003624227.1|1659941_1660613_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014457509.1|1660609_1661140_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003624230.1|1661224_1662199_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	32.4	2.8e-29
WP_012812583.1|1668928_1670314_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	8.5e-32
WP_014457496.1|1670371_1671238_-	recombinase family protein	NA	R9TP69	Rhizobium_phage	45.8	7.1e-61
WP_007283917.1|1671266_1671647_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	54.3	2.7e-28
WP_041632562.1|1671636_1671960_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.1	5.6e-11
WP_014457497.1|1672061_1672289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014457498.1|1672396_1672801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457499.1|1672943_1674329_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	3.8e-32
WP_087652208.1|1674546_1675756_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	1.9e-96
WP_088364820.1|1676302_1676983_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.9	3.5e-31
WP_088364821.1|1677428_1678639_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	5.0e-97
WP_014457501.1|1678850_1679399_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_124307063.1|1679539_1680163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014457504.1|1680714_1681476_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_041632565.1|1681707_1681977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088364821.1|1682560_1683771_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	5.0e-97
WP_088364822.1|1684646_1685330_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_014457493.1|1685326_1685860_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_088364823.1|1685874_1687084_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	8.6e-97
>prophage 7
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	2207497	2267506	2996610	transposase	Staphylococcus_phage(25.0%)	49	NA	NA
WP_012812328.1|2207497_2208748_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_088365046.1|2208769_2209789_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	26.1	2.0e-06
WP_088364683.1|2212097_2213483_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_003624578.1|2215592_2216549_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_088364881.1|2216600_2217305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624576.1|2217406_2217649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364882.1|2217874_2219233_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	1.4e-34
WP_088364883.1|2219281_2220598_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_003624573.1|2220726_2221239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364884.1|2221356_2221908_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_088364885.1|2222092_2222731_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_088364886.1|2222749_2223523_-	cytochrome c1	NA	NA	NA	NA	NA
WP_035362349.1|2223522_2224764_-	ubiquinol-cytochrome c reductase	NA	NA	NA	NA	NA
WP_088364887.1|2225417_2226470_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.7	4.1e-18
WP_088364888.1|2226451_2227054_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.2	8.5e-21
WP_088365047.1|2227068_2228382_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.7	8.8e-79
WP_003630055.1|2228418_2228904_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.3	9.6e-23
WP_035365922.1|2228973_2229984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365048.1|2230098_2232693_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003624558.1|2232797_2234057_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003624557.1|2234158_2234395_-	DUF3297 family protein	NA	NA	NA	NA	NA
WP_088364889.1|2234496_2235261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003624555.1|2235303_2236266_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003624554.1|2236281_2236482_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_003624553.1|2236483_2238568_-	FUSC family protein	NA	NA	NA	NA	NA
WP_088364890.1|2238890_2240039_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_088364891.1|2240035_2242741_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_088364892.1|2242724_2244191_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_088364893.1|2244410_2244965_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_003630066.1|2244957_2245536_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_003630067.1|2245591_2246203_-	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	48.9	1.7e-45
WP_088364894.1|2246243_2246714_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003624541.1|2246834_2248043_-	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_088364895.1|2248327_2249827_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.2	1.8e-51
WP_088364896.1|2249872_2250865_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_088364897.1|2250857_2251976_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_014457074.1|2252092_2252962_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003624536.1|2253113_2253476_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_088364898.1|2253503_2255774_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_003624534.1|2255857_2256805_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	26.4	6.0e-21
WP_014457070.1|2256812_2257799_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_088364899.1|2257795_2258731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365049.1|2258784_2259252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365050.1|2259450_2260755_-	ammonium transporter	NA	NA	NA	NA	NA
WP_157666427.1|2261413_2263177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088365051.1|2263457_2265068_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.0	2.3e-113
WP_088364718.1|2265364_2266750_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_157666428.1|2266892_2267150_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_042711006.1|2267146_2267506_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	2449565	2520718	2996610	tRNA,transposase	Planktothrix_phage(16.67%)	57	NA	NA
WP_003625290.1|2449565_2450882_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014456939.1|2450887_2452135_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003630513.1|2452127_2452850_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	4.3e-35
WP_014456938.1|2452853_2453342_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003625295.1|2453614_2454412_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003625297.1|2454433_2455267_+	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_012813230.1|2456001_2457387_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_039891566.1|2457944_2458355_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012812328.1|2459279_2460530_+|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_014456935.1|2460694_2462518_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	38.4	1.6e-102
WP_014456934.1|2462517_2463894_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_014456933.1|2463976_2464675_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_014456932.1|2464688_2465495_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003625306.1|2465491_2466280_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_003625307.1|2466276_2467353_-	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_014456930.1|2467367_2468567_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_041632504.1|2468563_2469526_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014456928.1|2469609_2470590_+	acylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_014456927.1|2470614_2471568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364956.1|2471573_2472788_-	pyridoxal phosphate-dependent aminotransferase family protein	NA	D2TEZ5	Emiliania_huxleyi_virus	29.9	6.7e-33
WP_003625320.1|2472794_2473046_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_014456925.1|2473177_2474944_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_003625325.1|2474943_2476074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813266.1|2483785_2484256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006115452.1|2484274_2485510_+	TolC family protein	NA	NA	NA	NA	NA
WP_012813265.1|2485506_2486661_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_088364957.1|2486660_2489729_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003626138.1|2489734_2490406_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_088364958.1|2490402_2491755_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_088364959.1|2491888_2492593_+	VIT family protein	NA	NA	NA	NA	NA
WP_014456922.1|2492791_2492917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082179769.1|2493434_2493923_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_014456920.1|2494077_2495043_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_088364960.1|2495388_2496475_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.7	4.3e-07
WP_014456918.1|2496646_2497990_+	membrane protein	NA	NA	NA	NA	NA
WP_088364961.1|2498358_2499063_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_014456916.1|2499059_2499602_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_014456915.1|2499826_2501494_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_003630930.1|2501676_2503053_-	MFS transporter	NA	NA	NA	NA	NA
WP_041632503.1|2503256_2503649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456913.1|2503800_2504241_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_014456912.1|2504270_2505032_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014456911.1|2505191_2505824_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014456910.1|2505886_2506600_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014456909.1|2506718_2507240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014456908.1|2507799_2509077_+	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_088364962.1|2509185_2510778_+	oxalyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_088364963.1|2510994_2512017_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	1.0e-21
WP_088364964.1|2512278_2513664_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_014456905.1|2513976_2515149_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_014456904.1|2515145_2515862_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_041632502.1|2515868_2516150_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014456903.1|2516359_2517073_+	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_014456902.1|2517037_2517607_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003626699.1|2517806_2518310_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_014456901.1|2518418_2518883_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012813230.1|2519332_2520718_-|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP021922	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 chromosome, complete genome	2996610	2681285	2822774	2996610	integrase,transposase	Streptococcus_phage(32.0%)	110	2677805:2677849	2733016:2733060
2677805:2677849	attL	CTCATAACCTGAAGGCCGCAGGTTCAAATCCTGCCCCCGCAACCA	NA	NA	NA	NA
WP_088364977.1|2681285_2682140_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	35.4	3.5e-36
WP_088364963.1|2683683_2684706_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	1.0e-21
WP_088364683.1|2684967_2686353_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_088364978.1|2687580_2688783_+	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	42.0	1.3e-73
WP_088364979.1|2688914_2689136_-	integration host factor	NA	M4SRV7	Rhodobacter_phage	45.7	2.7e-09
WP_088364980.1|2689225_2690305_+	DNA primase	NA	A0A2I7R8M6	Vibrio_phage	32.3	6.2e-06
WP_007397892.1|2690619_2691555_+	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_088364683.1|2692188_2693574_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_039998684.1|2694344_2694968_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.3	1.1e-20
WP_088365056.1|2695592_2695808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007397897.1|2695826_2696150_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_007397899.1|2696815_2697100_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007397900.1|2697234_2697498_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_007397901.1|2697636_2697855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099963252.1|2697874_2698423_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_007397904.1|2698643_2698895_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088364982.1|2698908_2699988_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_007397906.1|2699984_2700482_+	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_007397907.1|2700478_2701036_+	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_007397908.1|2701037_2701376_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_088364983.1|2701380_2702085_+	lytic transglycosylase domain-containing protein	NA	U5PVY0	Bacillus_phage	33.3	1.4e-06
WP_088365058.1|2702365_2704105_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_088364984.1|2704118_2704547_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_088364985.1|2704546_2704801_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_088364986.1|2705013_2705841_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_088364987.1|2706168_2708187_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_088365059.1|2708194_2708641_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_088365061.1|2708835_2709792_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_088365063.1|2709857_2710157_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_010516001.1|2710156_2710432_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_012813126.1|2712383_2713769_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_088364988.1|2714552_2715287_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_088364989.1|2715292_2716735_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_088365064.1|2716740_2717424_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_088364990.1|2717420_2718413_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_088364991.1|2718409_2719582_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_078527195.1|2719578_2719818_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_088364992.1|2719819_2720740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078527199.1|2720919_2721810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157666432.1|2721806_2722184_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_039735298.1|2722283_2723624_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_088365066.1|2723620_2724652_-	di-heme enzyme	NA	NA	NA	NA	NA
WP_088365067.1|2724797_2725655_-	metallo-mystery pair system four-Cys motif protein	NA	NA	NA	NA	NA
WP_088364993.1|2725708_2726296_-	putative natural product biosynthesis protein	NA	NA	NA	NA	NA
WP_088364994.1|2726292_2727099_-	DUF692 family protein	NA	NA	NA	NA	NA
WP_120357830.1|2727158_2727254_-	methanobactin	NA	NA	NA	NA	NA
WP_088364995.1|2727354_2729571_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_078527209.1|2729716_2730208_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_078527211.1|2730509_2731589_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078527213.1|2731672_2732842_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	35.9	3.1e-51
WP_088364996.1|2733220_2734307_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
2733016:2733060	attR	CTCATAACCTGAAGGCCGCAGGTTCAAATCCTGCCCCCGCAACCA	NA	NA	NA	NA
WP_088364997.1|2734371_2734887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364998.1|2734950_2735349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012812390.1|2735679_2737065_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_088365068.1|2737122_2737455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364999.1|2737876_2738548_-	LexA family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	28.2	4.9e-17
WP_088365000.1|2738705_2738951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813200.1|2739399_2740383_+	Abi family protein	NA	NA	NA	NA	NA
WP_003618711.1|2740584_2740878_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.9	2.1e-17
WP_003618686.1|2740874_2741135_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	41.2	6.1e-08
WP_012813198.1|2741348_2741711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365001.1|2741860_2742947_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	23.3	7.4e-07
WP_012813195.1|2743959_2744259_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_012813194.1|2744286_2744868_-	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_012813230.1|2744933_2746319_+|transposase	IS1380-like element IS1380A family transposase	transposase	NA	NA	NA	NA
WP_012813192.1|2746828_2747278_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_088365002.1|2747536_2749126_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.0	7.1e-107
WP_010515587.1|2749191_2749539_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	60.7	1.6e-32
WP_012813034.1|2749535_2749973_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012813033.1|2750014_2751325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813032.1|2751520_2752258_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_088364718.1|2754252_2755638_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_012813029.1|2758924_2759509_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012812390.1|2759888_2761274_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_082179755.1|2761452_2761902_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012812328.1|2762077_2763328_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012813027.1|2763646_2764267_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003626763.1|2764263_2764812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813026.1|2766513_2767944_+	NtaA/DmoA family FMN-dependent monooxygenase	NA	NA	NA	NA	NA
WP_088365004.1|2767946_2769110_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_088365005.1|2769117_2770566_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003626774.1|2770571_2772062_+	MFS transporter	NA	NA	NA	NA	NA
WP_012813024.1|2772068_2772608_+	flavin mononucleotide (FMN) reductase	NA	Q9KX93	Enterobacteria_phage	44.0	1.2e-13
WP_088365006.1|2772805_2775004_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_012813022.1|2775036_2776383_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088365007.1|2776832_2778137_+	MFS transporter	NA	NA	NA	NA	NA
WP_088365008.1|2778190_2778947_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812328.1|2779126_2780377_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012813019.1|2780391_2780694_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_088365009.1|2780853_2781582_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_003624234.1|2785539_2786691_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003624237.1|2793359_2794304_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	29.2	2.4e-25
WP_003624238.1|2794539_2796342_-	allophanate hydrolase	NA	NA	NA	NA	NA
WP_012813013.1|2796380_2799920_-	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_003624240.1|2799938_2800583_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_003624241.1|2800599_2801403_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_003624243.1|2801444_2801924_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813012.1|2801935_2802850_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.7	1.3e-36
WP_003624247.1|2802849_2803812_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003624249.1|2803832_2804825_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012813011.1|2805129_2806623_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012813010.1|2806649_2808011_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_012813009.1|2808056_2809214_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_052583190.1|2809333_2810275_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813004.1|2813288_2814113_-	2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase	NA	NA	NA	NA	NA
WP_003624259.1|2814165_2815953_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_035362298.1|2816080_2816989_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003624263.1|2817143_2818511_+	MFS transporter	NA	NA	NA	NA	NA
WP_012812390.1|2819029_2820415_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_088364718.1|2821388_2822774_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
>prophage 1
NZ_CP021923	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-1	177959	6188	90162	177959	transposase,integrase	Leptospira_phage(23.53%)	54	53529:53588	105078:106529
WP_088365077.1|6188_7276_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.4e-42
WP_039891529.1|8113_8791_+	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_012813251.1|8850_10110_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_012813250.1|10109_11591_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012813249.1|11728_12136_+	enamine deaminase RidA	NA	NA	NA	NA	NA
WP_003630594.1|12257_13652_+	allantoin permease	NA	NA	NA	NA	NA
WP_012813248.1|13651_15268_+	alcohol dehydrogenase	NA	A0A1V0S9M4	Catovirus	29.4	1.8e-49
WP_088365078.1|15264_16419_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_041633333.1|16519_17440_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012812390.1|18346_19732_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813244.1|19925_20933_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_088365081.1|21922_23308_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	3.2e-31
WP_012813243.1|24233_25307_+	alkene reductase	NA	NA	NA	NA	NA
WP_012813275.1|25524_26262_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012813278.1|30731_32258_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.3	4.6e-87
WP_012813279.1|32293_32890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365083.1|33137_34210_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.4	4.5e-41
WP_006115729.1|34713_35067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088365084.1|35063_35453_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.9	2.4e-40
WP_012812328.1|35528_36779_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_088365085.1|37420_38630_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.0	6.6e-97
WP_012813285.1|39670_40582_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088365111.1|40763_42398_+	MFS transporter	NA	NA	NA	NA	NA
WP_124307069.1|42586_43778_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	27.9	4.9e-20
WP_006117298.1|43897_44629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813288.1|44670_45060_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012812390.1|46891_48277_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_088365086.1|49266_50338_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.9	5.4e-42
WP_088365088.1|52748_53528_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.2	8.1e-32
WP_012813342.1|53517_55041_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.6	1.1e-32
53529:53588	attL	GGCGGCTGTCCCTTCGCAGGATGTCATACCGCCCTGTATCGGCGCACGGTTCGTGTTCGA	NA	NA	NA	NA
WP_012813340.1|55485_55710_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012813339.1|55815_57249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813338.1|57371_57872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813336.1|59376_59796_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813334.1|62588_63851_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088365089.1|63902_66920_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_012813331.1|67696_68500_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_012813330.1|68506_69334_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012813329.1|69385_69955_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813137.1|70258_70942_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	9.3e-24
WP_012813135.1|73622_74246_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_088365091.1|74256_76365_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	30.3	3.6e-34
WP_012813133.1|76379_78086_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_082179775.1|78088_78178_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_012813131.1|79811_80261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003618791.1|80580_80979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010516881.1|81052_81703_+	cation transporter	NA	NA	NA	NA	NA
WP_003618793.1|81878_83138_+	TolC family protein	NA	NA	NA	NA	NA
WP_003618801.1|83134_84169_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010516885.1|87327_87525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813326.1|87912_88551_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	32.5	7.2e-10
WP_019092663.1|88600_88897_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_012813324.1|88893_89010_+	pilus retraction motor protein PilT	NA	NA	NA	NA	NA
WP_088365092.1|89075_90162_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	2.0e-44
105078:106529	attR	TCGAACACGAACCGTGCGCCGATACAGGGCGGTATGACATCCTGCGAAGGGACAGCCGCCATGCGTCATGATCCTGCGGCTGCTTCACTTGTGGTCATGCTCCGTGGATTGCGGATGTATGGCATGTCCCAGGCCACGGCCGACCTCATCGAGCAGGGGGCACCTGCCTTCGAGGCGGCCATCCCCATCCTCTCACAACTCCTGAAGGCGGAACTGGCCGAACGCGAAGTGCGCTCCATCGCCTACCAGACAAAGACCGCCCGGTTCCCCGCCTACAAGGACCTGTCCGGGTTCTCCTTTGCCGATACGCAGGTCAACGAGCCCATGATCCGCCAGCTCCATAGCGGGGACTTCATCGAGCGTGCTGAAAATGTCGTGCTGATCGGCGGTCCGGGAACCGGGAAAACCCACCTGGCGACCGCGCTGGCCATCCAGGCGATCACCCATCACCGCAAGAAGGCGCGCTTCTGGTCAACGGTCGACCTGGTCAATGCGCTCGAACAGGAAAAGACCGCCAACCGGGCCGGGCAGATTGCCGACAGGCTGCTCCGCCTGGATCTCGTGATCCTTGATGAACTCGGTTATCTCCCCTTCAGTGCGTCTGGGGGCGCCCTGCTGTTCCATCTGCTCAGCCGCCTCTACGAGCGCACCAGTGTCATCATCACAACCAATCTGAGCTTCAGTGAATGGGGAGACGTCTTTGGTGACCCGAAGATGACAACGACGCTCCTCGATCGGCTGACCCATCACTGTCATATCCTCGAGACAGGAAATGACAGCTACAGGTTCCGCGCCAGCACCGCCGCGTCAAAAAACAGAAAGGACAGATCCTCTTCTTGACCGCCCGCCCGACTGTGCCTGAAATAGCATCTGGCTGGGTCAATTCCTGATGAAAAACCCGGGTCAGTTCTCAGTGAAAATCAACAGGCTTGTCGTTGTGACTGGAAACTTACGAGAACTTACGAGGGTAGATGGGTTGCGATCTGAGGATTGGACGGCCGGTTAAGGGATAAGTGGAGCTTCTGCTTCGGCTTCTGCCTCATGTCAGACGTAACAGGAATTGCTGGAGTTTTCTGAAAGCAGACATATAGCGAGATGATAATATGCGCATGGAAATGTGCATAAACATGTGCTATGCTTCAGTTCTCATGTAAATAGGATCAAAGCTATGGTTCGTGTGCACTCCACCAGTCCGTTGCGTCGTCCCACTAATGTGACGTTACCTGCTCAGTTACTCGAAGAAGCCAGATCGCTTGATCTCAACATATCGCAGGCCTGCGAACAGGGGTTGAAGTCAGCGATCGCTTCGGTTCGTGCTCAACAATGGCTCGCAGAAAATCGCTCCTCCCTTGAAGCATCCCGACAGTATGTCGAAAAGAATGGTCTTCCTCTGGCGGATTATCGGAACTTCTGAATGGCCCGTTTTGATGTGTATTGTTTGGCCGGACGAGG	NA	NA	NA	NA
>prophage 2
NZ_CP021923	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-1	177959	139803	147582	177959	transposase	uncultured_Caudovirales_phage(66.67%)	9	NA	NA
WP_012813242.1|139803_141417_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	28.8	2.5e-43
WP_006115729.1|141859_142213_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006115730.1|142209_142632_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	1.2e-48
WP_006115732.1|142631_143927_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.5	3.6e-133
WP_012813274.1|143950_144649_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.7	4.1e-83
WP_012813273.1|144657_145737_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	56.2	5.3e-82
WP_012813272.1|146050_146392_+	translation repressor RelE/RelB/StbE	NA	NA	NA	NA	NA
WP_006115735.1|146388_146685_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088365103.1|146827_147582_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.3	2.7e-24
>prophage 1
NZ_CP021924	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2	184348	0	75022	184348	transposase,integrase	Streptococcus_phage(52.94%)	50	11013:11036	71182:71205
WP_088365136.1|0_1019_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	28.3	2.7e-19
WP_012813141.1|1503_2466_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012813142.1|2455_3286_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	29.8	9.0e-21
WP_088365115.1|3830_5804_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	29.1	2.1e-36
WP_088365117.1|6155_7241_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012813145.1|7253_8300_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_019088708.1|8296_8590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813147.1|8744_10061_-	replication protein C	NA	NA	NA	NA	NA
11013:11036	attL	TCGACGCGGATTTCTCACACTTGA	NA	NA	NA	NA
WP_012812390.1|11241_12627_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_088365041.1|12890_14276_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_012813114.1|15163_16171_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_012813113.1|16167_16788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813112.1|17192_17594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813111.1|17611_19987_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_012813110.1|20000_20663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813107.1|21342_22728_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	5.0e-32
WP_012813105.1|23637_25008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813104.1|25224_25653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088365119.1|25927_27313_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	4.2e-31
WP_012813102.1|28299_32259_-	DNA damage-inducible protein	NA	NA	NA	NA	NA
WP_157666435.1|32243_32684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813100.1|32974_33358_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_012813099.1|34063_34777_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_012813098.1|34849_36328_-	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	28.1	9.1e-32
WP_012813096.1|37126_37570_+	recombinase family protein	NA	M1T2R9	Escherichia_phage	50.8	2.6e-27
WP_012813095.1|37602_38643_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_041247965.1|40656_41679_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_012813093.1|41796_42135_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088365092.1|42201_43289_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	2.0e-44
WP_088364718.1|43991_45377_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_088365121.1|46209_48435_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088365123.1|48431_50651_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.5	1.9e-65
WP_082179782.1|50764_51205_+	DNA helicase II	NA	NA	NA	NA	NA
WP_012813230.1|51347_52733_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.0	2.5e-31
WP_041633310.1|53374_54895_-	MFS transporter	NA	NA	NA	NA	NA
WP_012813226.1|55098_55977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012813225.1|55980_56604_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012813224.1|57038_58442_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_012813223.1|58782_59265_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_012813222.1|59289_60264_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_012813221.1|60260_61370_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_012813220.1|61366_61930_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035366441.1|61929_62898_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_012813219.1|62894_64073_+	MSMEG_0565 family glycosyltransferase	NA	NA	NA	NA	NA
WP_020936672.1|64060_64348_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_035366434.1|64364_65612_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012813217.1|65626_67399_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	20.7	1.7e-08
WP_088364718.1|68413_69799_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_003631418.1|71966_72740_+	TSUP family transporter	NA	NA	NA	NA	NA
71182:71205	attR	TCAAGTGTGAGAAATCCGCGTCGA	NA	NA	NA	NA
WP_012813126.1|73636_75022_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
>prophage 2
NZ_CP021924	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-2	184348	84231	145040	184348	transposase,integrase	Streptococcus_phage(33.33%)	44	112444:112503	130825:131879
WP_088365127.1|84231_85414_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	64.6	4.2e-96
WP_006115563.1|85621_85900_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	47.8	4.9e-16
WP_081461411.1|85903_86197_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_006115564.1|86427_87507_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012812328.1|87869_89120_-|transposase	IS701-like element IS1452 family transposase	transposase	NA	NA	NA	NA
WP_012813208.1|89165_90158_-	TonB family protein	NA	NA	NA	NA	NA
WP_006117544.1|90255_90435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813207.1|90486_91017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012813206.1|91093_93316_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_124307076.1|94082_94325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006117547.1|94367_95570_+	porin	NA	NA	NA	NA	NA
WP_012813179.1|95701_96781_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_088365129.1|98008_99781_+	oleate hydratase	NA	NA	NA	NA	NA
WP_003631146.1|101170_102562_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003631147.1|102646_103804_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012813128.1|103891_104485_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088364963.1|105894_106917_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	1.0e-21
WP_012812390.1|107178_108564_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012812390.1|108847_110233_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813125.1|110809_111406_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_012813124.1|111402_111711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041633166.1|111796_112099_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_082179783.1|112107_112371_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	45.2	4.8e-13
112444:112503	attL	GGCTCTGTTGCACAATTCGGTCTATTGGCGTGACGAGGCCGCTATAGAGTTTTCCATTAC	NA	NA	NA	NA
WP_012813119.1|116580_117453_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	32.3	1.5e-10
WP_012813118.1|117439_118495_-	DUF1870 family protein	NA	F0PIG8	Enterococcus_phage	27.8	3.2e-15
WP_012813117.1|118705_119629_-	plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_012813116.1|120053_120551_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012812390.1|120765_122151_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.2	1.1e-31
WP_012813150.1|122558_125027_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012813151.1|125039_126149_+	glycerophosphodiester phosphodiesterase	NA	A0A2P1N091	Streptomyces_phage	31.6	7.1e-05
WP_012813152.1|126326_127202_-	EamA family transporter	NA	NA	NA	NA	NA
WP_012813153.1|127394_128285_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041633201.1|128525_128948_-	camphor resistance protein CrcB	NA	NA	NA	NA	NA
WP_012813156.1|131368_131983_+	hypothetical protein	NA	NA	NA	NA	NA
130825:131879	attR	GTAATGGAAAACTCTATAGCGGCCTCGTCACGCCAATAGACCGAATTGTGCAACAGAGCCCCTGATCGGGTTCAATGGCCATTGCGCATAAATCACGCTGATGTCGTGTTTCGCTGCTCAACTGGACGGATGGGGGGAGACCTTTTTCGCCTTCGCGCATAGCTGGAAGGGGTGTGGCCAACCAGGCTCTACAGCTTTCGGTCATAGCTCGGGTTTGGTCCCGCAAGAGCGGAGAAGGCTCCGGAATTGTGCTCGCAGGCTGTGTAGTTTTAGGGTCTGGTGACGCGGTTTCTGCTGCCGCGAACGCAGGCATGCCCCCAAGCAAGACAAATAGAGGCAGGATATGTTTTGCTGTGCAGACGGGTCTGCCATGGCTGATAGAGCAGTAGGGATGAGGCATAAGAGGTTCTCCTTTAGGGATGAGTATTCCCTCTCATCATGCGACCAGATTCACTTTTTTAGACGAATCTGGCGAGACTAAGTTTTTCGTCGCATCCTGTGACGCAAAGATAGGGGCTCACGGGAATAAGGAGACGAAACTGTTATGCAACATGGCGTCAATCCGAGTTGTGACGCGGTAAGCACCTGGGAAGATACTGGAATACAGGGTGAGCACCTGAAACTGGAGGAAACATCCACCAGCGTGGTGACATTCCGCACTCCAAGTTCACCAGAGGTGAGAGCGCGTTATAGGCAAATTGCCCAGGATGGAGAAGGAGACGTACCGCACCCCCGTTTTGGTGACGGATGGCGGTTGCGTGTCGATATCCTGAGTGAAGATGGCAGCATAGTCGATGGGAGCGTCTTTTTCAGACTGTTCCGGGGACCTGAACAGATCGTCAGACCATATTTGTTAGGGCTGATGACATGGGATGAAGACATGCGTCTTGGAGCGTTGATAACTGCCAGTTTACTGGGTTCCCTTGGATATGCTCAGGGAAAGATCAACCCGACAGAGAAACCCAAAGAAATCAAAAAGAGCGGCATACTTCCCCAACTTATTACCCTGATTTCAAACACGCCGCATGGGCCGCGTCCATCTGAAGATCCGCATA	NA	NA	NA	NA
WP_124306776.1|131960_132224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813157.1|132416_133052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157666438.1|133006_133585_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_088364963.1|134250_135273_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	1.0e-21
WP_050818279.1|135534_136920_-|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.2e-32
WP_012813178.1|137452_137695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003624578.1|137746_138703_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_088365133.1|139070_140280_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	63.7	2.5e-96
WP_088364718.1|142348_143734_+|transposase	IS1380-like element IS1380A family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.4	2.9e-32
WP_088365135.1|144283_145040_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	3.5e-11
>prophage 1
NZ_CP021925	Acetobacter pasteurianus subsp. pasteurianus strain SRCM101468 plasmid pAP1468-3	49900	12798	20408	49900	transposase,integrase	Rhodobacter_phage(14.29%)	9	NA	NA
WP_088365142.1|12798_13878_+	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.9	3.0e-61
WP_012813377.1|13913_14165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012813376.1|14191_14827_-	AAA family ATPase	NA	D4HTX7	Vibrio_phage	26.9	3.2e-10
WP_041633471.1|14869_15487_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.9	2.7e-14
WP_012813374.1|15564_16389_-	AAA family ATPase	NA	B5TA81	Burkholderia_phage	23.3	4.0e-05
WP_012812886.1|16388_17888_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003630649.1|18006_18600_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.3	1.4e-28
WP_082179790.1|18833_19235_-	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	41.9	3.6e-15
WP_088365138.1|19321_20408_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	4.9e-43
