The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	583862	590916	3224939		Faustovirus(16.67%)	9	NA	NA
WP_013572350.1|583862_585077_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.1	2.2e-31
WP_011078536.1|585120_585504_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	2.0e-52
WP_011149601.1|585576_585900_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.8e-25
WP_045591742.1|585960_586476_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_088427454.1|586497_588351_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.0	7.4e-108
WP_011078532.1|588362_588701_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011078531.1|588781_588976_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_039539150.1|589128_590427_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.1	3.8e-34
WP_011078529.1|590490_590916_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.4	5.1e-20
>prophage 2
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	666801	673509	3224939		Staphylococcus_phage(50.0%)	7	NA	NA
WP_038963551.1|666801_667941_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	2.8e-65
WP_080722289.1|667953_669222_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.0	2.3e-100
WP_011149678.1|669422_669872_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_039548972.1|669891_670998_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.0	3.6e-41
WP_038939357.1|670999_671656_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	35.5	1.1e-32
WP_038963553.1|671753_672863_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	40.4	2.3e-64
WP_011078424.1|673038_673509_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	2.2e-32
>prophage 3
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	854499	937195	3224939	tRNA,plate,integrase,tail,protease	Vibrio_phage(31.03%)	97	875033:875089	915573:915629
WP_088427515.1|854499_856233_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.1	9.8e-86
WP_039447776.1|856453_857050_+	VOC family protein	NA	NA	NA	NA	NA
WP_017421001.1|857111_857945_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.2	1.9e-15
WP_026050452.1|858140_858341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427516.1|858438_860358_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_038939428.1|860358_861060_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	36.9	4.0e-06
WP_088427517.1|861085_861391_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_088427518.1|861432_861987_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_088427519.1|861986_862841_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017420995.1|862962_864660_+	long-chain-fatty-acid--CoA ligase FadD	NA	Q75ZG1	Hepacivirus	25.7	1.4e-41
WP_130251526.1|864747_865863_+	ribonuclease D	NA	NA	NA	NA	NA
WP_017420993.1|865945_866209_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_011149811.1|866211_867024_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017420992.1|867046_867709_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017420991.1|867884_868166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017420990.1|868217_869189_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_017420989.1|869234_870179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017420988.1|870403_871603_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_088427520.1|871791_872985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427521.1|873076_873745_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.6e-26
WP_038939431.1|873716_874967_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
875033:875089	attL	TTAGGTGTATGGTCGGACTGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
WP_039548845.1|875221_875785_-	N-acetylmuramidase	NA	A0A286N2Q6	Klebsiella_phage	52.0	9.3e-46
WP_017788816.1|876424_877471_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088427522.1|877467_877710_+	co-chaperone GroES	NA	NA	NA	NA	NA
WP_011078238.1|878010_878706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427523.1|878702_879668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046029179.1|879660_881259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427524.1|881255_882635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427525.1|882643_883732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427526.1|883828_884017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427527.1|884021_884561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157721622.1|884789_885179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011078230.1|885157_885394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427529.1|885362_885692_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088427530.1|885792_888369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017788800.1|888444_889035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039548817.1|889084_889681_+	hypothetical protein	NA	A0A1D9CA16	Salinivibrio_phage	57.2	2.8e-56
WP_088427531.1|889670_889967_+	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_088427532.1|889976_890582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427533.1|890574_891075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427534.1|891074_891608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427535.1|891607_892207_+|plate	phage baseplate assembly protein V	plate	D4HTV0	Vibrio_phage	38.3	3.3e-09
WP_088427536.1|892208_892694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017788792.1|892668_892956_+	hypothetical protein	NA	G3MBI0	Bacillus_virus	43.0	3.1e-13
WP_017788791.1|892959_893307_+	dTDP-glucose pyrophosphorylase	NA	NA	NA	NA	NA
WP_017788790.1|893303_894164_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	33.4	4.3e-34
WP_088427537.1|894160_894811_+|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	36.6	7.0e-21
WP_088427538.1|894816_896403_+	hypothetical protein	NA	A0A2I7R2I0	Vibrio_phage	38.4	2.0e-45
WP_088427539.1|896399_896918_+	hypothetical protein	NA	A0A2I7R277	Vibrio_phage	50.6	1.9e-40
WP_157721623.1|896962_897391_+	hypothetical protein	NA	A0A2I7R277	Vibrio_phage	55.0	4.4e-40
WP_088427541.1|897486_898647_+|tail	phage tail protein	tail	A0A1B2LRR3	Wolbachia_phage	39.3	1.3e-70
WP_088427542.1|898658_899174_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	34.9	1.9e-16
WP_088427543.1|899183_899594_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_088427544.1|899634_901761_+	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	43.0	7.8e-77
WP_088427545.1|901769_902165_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	40.9	3.3e-21
WP_039548779.1|902161_902368_+|tail	tail protein	tail	NA	NA	NA	NA
WP_088427546.1|902358_903375_+	hypothetical protein	NA	D4HTW7	Vibrio_phage	36.3	8.7e-42
WP_088427547.1|903401_905060_-	NTPase KAP	NA	R9TRQ8	Vibrio_phage	36.2	2.2e-42
WP_088427548.1|905081_905879_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_088427549.1|906032_906224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427550.1|906312_906837_+	hypothetical protein	NA	A0A0M3LQ72	Mannheimia_phage	43.3	1.7e-17
WP_039549382.1|907019_907499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011078200.1|907528_908233_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011078199.1|908220_908436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011078198.1|908446_908758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427551.1|908750_909050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088428219.1|909111_909339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427552.1|909304_912064_+	hypothetical protein	NA	E5E3T2	Burkholderia_phage	50.3	1.5e-266
WP_017788772.1|912073_912250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427553.1|912263_912587_+	hypothetical protein	NA	A2I2Z5	Vibrio_virus	62.2	1.7e-28
WP_088427554.1|912561_912858_+	DUF3850 domain-containing protein	NA	R9TIU2	Vibrio_phage	58.6	5.5e-13
WP_011078192.1|912854_913109_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	33.8	3.6e-05
WP_043920895.1|913101_913353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427555.1|913385_913898_+	PadR family transcriptional regulator	NA	H9EB19	Vibrio_phage	31.8	3.4e-10
WP_039549357.1|914097_914292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088427556.1|914309_915476_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017420984.1|915816_917046_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
915573:915629	attR	TTAGGTGTATGGTCGGACTGAGAGGATTTGAACCTCCGACCCCCGACACCCCATGAC	NA	NA	NA	NA
WP_038963439.1|917042_917768_-	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.9	1.8e-09
WP_026050451.1|917764_918229_-	hotdog family protein	NA	NA	NA	NA	NA
WP_088427557.1|918221_919409_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_088427558.1|919418_920072_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_088427559.1|920023_922333_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_017788760.1|922322_922979_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_017420977.1|922948_923395_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017420976.1|923403_924948_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	31.8	7.7e-58
WP_088427560.1|924925_926635_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017420974.1|926627_926999_-	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_088427561.1|927011_928379_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_045588791.1|928386_928944_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
WP_011078172.1|928947_929202_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011078171.1|929218_929479_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_038939440.1|929573_930332_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_038939441.1|930328_931081_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_017420969.1|931125_931515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045588792.1|931545_932616_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017420967.1|932640_933897_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045588793.1|934177_937195_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
>prophage 4
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	1628532	1668722	3224939	transposase	Staphylococcus_phage(62.5%)	60	NA	NA
WP_088427740.1|1628532_1629667_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	65.5	6.3e-118
WP_088427741.1|1630628_1630790_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428228.1|1631120_1631279_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427742.1|1631344_1632313_+|transposase	IS30-like element ISVvu6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.2	9.7e-43
WP_088427744.1|1632820_1632979_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427745.1|1632962_1633475_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088427746.1|1633446_1633644_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_080927643.1|1634436_1634565_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_080927712.1|1635390_1635519_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428229.1|1635868_1635976_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427747.1|1635993_1636464_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_088427748.1|1636606_1637068_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157721625.1|1637067_1637175_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428230.1|1637540_1637669_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427749.1|1637680_1638139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427750.1|1638338_1638863_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_088427751.1|1638885_1639047_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_017420735.1|1639056_1639278_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_088427752.1|1639624_1640593_+|transposase	IS30-like element ISVvu6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	9.7e-43
WP_088427753.1|1640667_1641219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080721907.1|1641271_1641349_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427754.1|1641382_1641724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427755.1|1642217_1642313_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427757.1|1642738_1642900_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_045628735.1|1643377_1643758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427759.1|1643915_1644422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011105946.1|1644562_1645351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427760.1|1645511_1645892_-	GFA family protein	NA	NA	NA	NA	NA
WP_088427761.1|1645848_1646031_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_157721638.1|1646366_1646504_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427762.1|1647097_1647346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088428232.1|1647402_1647525_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_043037848.1|1649006_1649309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088428233.1|1649328_1649451_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427765.1|1649924_1650692_-	hypothetical protein	NA	A0A2H4J456	uncultured_Caudovirales_phage	52.8	3.4e-38
WP_088428234.1|1650675_1650813_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428235.1|1651156_1651300_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427752.1|1651381_1652350_+|transposase	IS30-like element ISVvu6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.5	9.7e-43
WP_072599303.1|1652529_1652847_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_088428236.1|1653377_1653506_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_038940876.1|1653538_1653889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157721639.1|1653962_1654049_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_080582150.1|1654449_1654578_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_005386966.1|1654585_1654948_-	VOC family protein	NA	NA	NA	NA	NA
WP_088427766.1|1655578_1656043_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088427767.1|1656065_1656209_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427768.1|1656204_1656699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427769.1|1656695_1657163_-	hypothetical protein	NA	A0A2I7QIF0	Vibrio_phage	30.3	1.3e-08
WP_157721640.1|1657274_1657346_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427742.1|1657493_1658462_+|transposase	IS30-like element ISVvu6 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.2	9.7e-43
WP_088427770.1|1658965_1659718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088428237.1|1660341_1660464_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427771.1|1661727_1662057_-	DUF4468 domain-containing protein	NA	NA	NA	NA	NA
WP_081007929.1|1662102_1662228_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427772.1|1662217_1662673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088428238.1|1662654_1662765_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427773.1|1664213_1664393_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428239.1|1664698_1664809_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088428234.1|1667048_1667186_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_088427775.1|1667789_1668722_+|transposase	IS30-like element ISVvu6 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.8	6.3e-39
>prophage 5
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	1756418	1783061	3224939	capsid,tRNA,integrase,terminase,tail,portal	Enterobacteria_phage(30.77%)	22	1750523:1750536	1758820:1758833
1750523:1750536	attL	TCACCGCAAACCAA	NA	NA	NA	NA
WP_045609247.1|1756418_1757381_+|integrase	integron integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.8	1.6e-16
WP_004727974.1|1757438_1757792_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_088427853.1|1757833_1758028_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080526514.1|1758131_1758683_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.1	1.6e-13
WP_011080263.1|1758686_1760615_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	5.5e-130
1758820:1758833	attR	TCACCGCAAACCAA	NA	NA	NA	NA
WP_088427855.1|1761329_1762199_-	DUF4376 domain-containing protein	NA	A0A2I7RR76	Vibrio_phage	41.6	1.2e-47
WP_088427856.1|1762195_1765723_-	hypothetical protein	NA	A0A2I7RQ82	Vibrio_phage	32.2	1.8e-110
WP_157721644.1|1765777_1770751_-	hypothetical protein	NA	A0A0E3M2R6	Enterobacteria_phage	22.3	5.6e-17
WP_039542884.1|1770757_1771309_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_039542882.1|1771305_1771908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427858.1|1771907_1774214_-	hypothetical protein	NA	A0A0M7QAD7	Escherichia_phage	26.5	1.6e-19
WP_058666973.1|1774194_1774473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427859.1|1774538_1774991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039542875.1|1775000_1775519_-|tail	tail fiber protein	tail	K7P6G8	Enterobacteria_phage	53.5	4.6e-39
WP_039542912.1|1775518_1775962_-|tail	phage minor tail U family protein	tail	K7PJT1	Enterobacteria_phage	35.6	5.1e-07
WP_039542873.1|1775951_1776584_-|tail	tail protein	tail	K7PKQ5	Enterobacteria_phage	41.8	5.2e-29
WP_039542871.1|1776580_1776859_-	ATP-binding sugar transporter from pro-phage family protein	NA	NA	NA	NA	NA
WP_088427860.1|1776851_1777037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427861.1|1777089_1779069_-|capsid	phage major capsid protein	capsid	A0A088FRT0	Escherichia_phage	47.0	8.7e-155
WP_088427862.1|1779025_1780594_-|portal	phage portal protein	portal	A0A088FVG5	Escherichia_phage	43.7	3.9e-118
WP_088427863.1|1780593_1781121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088427864.1|1781114_1783061_-|terminase	terminase	terminase	A2I2W6	Vibrio_virus	59.1	1.5e-212
>prophage 6
NZ_CP016321	Vibrio vulnificus strain FORC_037 chromosome I, complete sequence	3224939	2629272	2640428	3224939	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_045589573.1|2629272_2631855_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	1.7e-78
WP_038964353.1|2632035_2632497_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_038941440.1|2632612_2633662_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.3	1.8e-111
WP_017420280.1|2633794_2634298_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	43.3	3.1e-24
WP_038941441.1|2634381_2636943_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.2	1.3e-30
WP_017420278.1|2637018_2638011_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	1.5e-35
WP_088428082.1|2638091_2639018_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.1	1.6e-13
WP_088428083.1|2639031_2639658_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.6	3.6e-38
WP_017420275.1|2639660_2640428_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	1.1e-68
>prophage 1
NZ_CP016322	Vibrio vulnificus strain FORC_037 chromosome II, complete sequence	1852101	902134	910609	1852101		Vibrio_phage(100.0%)	13	NA	NA
WP_088428451.1|902134_902503_-	hypothetical protein	NA	Q9MCC3	Vibrio_phage	75.2	4.4e-44
WP_088428452.1|902705_902942_+	hypothetical protein	NA	A0A2I7RNI2	Vibrio_phage	56.1	5.1e-06
WP_045594699.1|902944_903136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015727929.1|903138_903339_+	hypothetical protein	NA	C3W4P3	Vibrio_phage	69.2	1.8e-20
WP_040110772.1|904396_904747_+	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	70.0	1.6e-40
WP_088428628.1|904785_904980_+	hypothetical protein	NA	G8IRU7	Vibrio_phage	65.1	2.8e-18
WP_039537901.1|905010_905217_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	54.7	2.4e-07
WP_088428453.1|905349_906858_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	33.5	2.5e-21
WP_039537895.1|906857_907202_+	DUF2523 domain-containing protein	NA	Q64EV1	Vibrio_phage	57.9	1.1e-28
WP_088428454.1|907204_908572_+	toxin	NA	Q64EV0	Vibrio_phage	69.1	1.4e-180
WP_044024063.1|908581_908893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088428455.1|909604_910057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088428456.1|910237_910609_-	phage protein	NA	Q9MCC4	Vibrio_phage	72.3	1.2e-44
