The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	962611	1012430	6929205	terminase,holin,integrase,capsid	Pseudomonas_phage(20.0%)	50	976586:976603	1010857:1010874
WP_088446151.1|962611_964867_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_088446152.1|965164_966169_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_088446153.1|966165_967014_-	phosphonate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_088446154.1|967037_967976_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088446155.1|968205_969051_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_062679868.1|969044_969878_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088446156.1|970005_970473_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_062679726.1|970494_971241_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_088446157.1|971361_972339_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_088446158.1|972628_973990_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_088446159.1|974159_975680_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_062679728.1|975910_977473_+	cytochrome C	NA	NA	NA	NA	NA
976586:976603	attL	GCGCTGTCCAACGACGGC	NA	NA	NA	NA
WP_062679729.1|977489_977837_+	cytochrome c	NA	NA	NA	NA	NA
WP_062679730.1|977833_978868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446160.1|978892_979528_-	DUF4202 domain-containing protein	NA	NA	NA	NA	NA
WP_088446161.1|979546_980701_-	heme d1 biosynthesis radical SAM protein NirJ	NA	NA	NA	NA	NA
WP_088446162.1|980702_981206_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088446163.1|981207_981690_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088446164.1|981682_982681_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088446165.1|982670_983843_-	protein nirF	NA	NA	NA	NA	NA
WP_088448424.1|983851_984181_-	cytochrome c	NA	NA	NA	NA	NA
WP_088446166.1|984189_984993_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_062679738.1|985217_985655_+	universal stress protein	NA	NA	NA	NA	NA
WP_062679739.1|985893_986829_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088446167.1|986921_987845_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_088446168.1|988393_989377_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	41.3	1.1e-65
WP_088446169.1|989379_989598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446170.1|989594_990113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446171.1|990109_990640_-	hypothetical protein	NA	X5KCC3	Pseudomonas_phage	46.8	6.8e-30
WP_157672698.1|991052_992021_-	hypothetical protein	NA	B5WZU1	Pseudomonas_phage	36.2	5.9e-24
WP_088446174.1|992102_992267_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_088446175.1|992413_992932_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	44.4	1.4e-08
WP_088446176.1|992928_993303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157672699.1|993299_993461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446177.1|993461_996092_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	61.9	6.8e-38
WP_157672700.1|996091_997255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446179.1|997263_997998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446180.1|998008_999145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157672701.1|999141_999558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446182.1|999554_1000958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446183.1|1000958_1001663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446184.1|1001659_1002670_-	collagen-like protein	NA	A0A076YL75	Mesorhizobium_phage	48.0	4.5e-06
WP_088446185.1|1002666_1002966_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	44.4	5.7e-10
WP_088446186.1|1002967_1003327_-	hypothetical protein	NA	E5FFI2	Burkholderia_phage	50.9	3.3e-20
WP_157672702.1|1003378_1003798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446188.1|1004706_1005246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446189.1|1005799_1006846_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_088446190.1|1007158_1008256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088446191.1|1010328_1011753_-|terminase	terminase	terminase	A0A140XG51	Salmonella_phage	41.8	1.9e-95
1010857:1010874	attR	GCCGTCGTTGGACAGCGC	NA	NA	NA	NA
WP_157672703.1|1011749_1012430_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	50.5	8.3e-49
>prophage 2
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	1019806	1029142	6929205		Pseudomonas_phage(20.0%)	16	NA	NA
WP_088446204.1|1019806_1020445_+	pentapeptide repeat-containing protein	NA	A0A221SAP8	Ralstonia_phage	54.8	1.4e-18
WP_088446205.1|1020480_1020780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446206.1|1020783_1021149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446207.1|1021237_1021972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446208.1|1021979_1022159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446209.1|1022160_1023258_+	hypothetical protein	NA	B5WZW5	Pseudomonas_phage	59.2	7.7e-36
WP_088446210.1|1023265_1024099_+	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	30.5	6.3e-14
WP_088446211.1|1024091_1024763_+	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	37.3	3.1e-32
WP_088446212.1|1024762_1025257_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	51.8	6.1e-41
WP_157672705.1|1025266_1025740_+	hypothetical protein	NA	A0A142IE59	Pseudomonas_phage	35.2	1.8e-13
WP_157672706.1|1025810_1025960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446213.1|1025962_1026370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088446214.1|1026369_1027182_+	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	51.2	3.4e-73
WP_088446215.1|1027178_1028342_+	hypothetical protein	NA	V9VCU4	Achromobacter_phage	47.9	1.4e-11
WP_088446216.1|1028334_1028847_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	66.0	9.7e-58
WP_088446217.1|1028839_1029142_+	ASCH domain-containing protein	NA	I6S5Y4	Salmonella_phage	59.6	5.7e-26
>prophage 3
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	3060251	3073644	6929205	integrase,transposase	Escherichia_phage(57.14%)	16	3060198:3060257	3072826:3073705
3060198:3060257	attL	GGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGGC	NA	NA	NA	NA
WP_001389365.1|3060251_3061016_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|3061399_3061540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|3061522_3062023_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3062150_3062990_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3062983_3063331_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3063494_3064286_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001256776.1|3064378_3065638_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_015057121.1|3065980_3066940_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|3066830_3067535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|3068367_3069027_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001297013.1|3069119_3070310_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|3070213_3070552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|3070548_3070734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|3070759_3071038_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|3071395_3072100_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3072879_3073644_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
3072826:3073705	attR	GGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGGCGGCTGCTGCGAAATGGTGGTTGAGCATGCCCATGGCCTCCGTCAGCGCCGAGGGCCCAATGCCAAAAGCTCTCTCCACAAGGCGCACCTCGCCCCTGATGCCGGGCTGCAGGCACCAGGGGCGAGCCTGTCCTTTGCGCAGGGCTCGCATGACTTCGAATCCCTTGATCGTGGCATAGGCCGTGGGGATCGATTTGAAACCGCGCACCGGCTTGATCAGTATCTTGAGCTTTCCGTGATCGGCCTCGATCACGTTATTGAGATACTTCACCTGCCGGTGGGCCGTCTCCCGGTCCAGCTTTCCTTCGCGCTTCAATTCGGTGATCGCTGCACCATAGCTCGGCGCTTTGTCGGTATTGAGCGTGGCAGGCTTTTCCCAGTGCTTCAGGCCTCGCAGGGCCTTGCCCAGGAACCGCTTCGCTGCCTTGGCGCTGCGGGTCGGCGACAGGTAGAAATCGATCGTGTCGCCCCGCTTGTCGACTGCCCGGTACAGGTAGGTCCACTTGCCCCGCACCTTGACGTAGGTTTCATCCAGGCGCCAGCTCGGATCAAAGCCACGCCGCCAGAACCAGCGCAGCCGCTTCTCCATCTCCGGGGCGTAGCACTGGACCCAGCGATAGATCGTCGTATGGTCGACCGAAATGCCGCGTTCCGCCAGCATTTCCTCAAGGTCGCGATAGCTGATCGGATAGCGACAATACCAGCGCACCGCCCACAGGATCACATCACCCTGGAAATGGCGCCACTTGAAATCCGTCATCGTTCCGTCCGTCCAATCTCCGCCAAGCATGCTCAAGCTTCACGATTTTTGCAACAGAGCC	NA	NA	NA	NA
>prophage 4
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	5022495	5029103	6929205	protease,transposase	Lake_Baikal_phage(16.67%)	8	NA	NA
WP_006220190.1|5022495_5022699_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	7.3e-17
WP_062682780.1|5022875_5023439_+	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	38.2	8.5e-15
WP_042794090.1|5023756_5023963_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	59.7	8.1e-16
WP_088446674.1|5024128_5025349_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	82.1	1.9e-197
WP_062682781.1|5025408_5025954_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.7	1.7e-20
WP_062682782.1|5026211_5026967_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_062682783.1|5027134_5028445_+	trigger factor	NA	NA	NA	NA	NA
WP_062682784.1|5028449_5029103_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.2	2.6e-55
>prophage 5
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	5616756	5624398	6929205	tRNA	Moraxella_phage(33.33%)	8	NA	NA
WP_062682555.1|5616756_5617131_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	28.9	5.5e-10
WP_088148650.1|5617273_5618278_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062682557.1|5618506_5619799_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.6	9.3e-65
WP_062682558.1|5619921_5620953_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	2.1e-91
WP_062682559.1|5621143_5621782_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_088447846.1|5621961_5622720_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	4.9e-66
WP_087881481.1|5622839_5623529_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	3.6e-31
WP_062682562.1|5623546_5624398_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.2	4.9e-14
>prophage 6
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	6864375	6874658	6929205	holin,tail	uncultured_Mediterranean_phage(28.57%)	15	NA	NA
WP_157672776.1|6864375_6865569_-	hypothetical protein	NA	A0A248SL32	Klebsiella_phage	33.2	1.2e-31
WP_088448339.1|6865579_6866020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448340.1|6866049_6866352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157672777.1|6866375_6866936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448342.1|6867025_6867316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448343.1|6867315_6868485_-	hypothetical protein	NA	Q08J79	Stx2-converting_phage	39.0	1.5e-18
WP_088448344.1|6868487_6870143_-	hypothetical protein	NA	A0A1B1ITF2	uncultured_Mediterranean_phage	29.0	1.9e-54
WP_088448591.1|6870145_6870442_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	39.8	3.4e-07
WP_088448345.1|6870458_6870806_-	hypothetical protein	NA	E5E3W4	Burkholderia_phage	43.5	4.7e-16
WP_088448346.1|6870869_6871313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448347.1|6871312_6872614_-|tail	tail fiber protein	tail	A0A0B5A509	Achromobacter_phage	59.5	1.3e-55
WP_088448348.1|6872617_6873079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448349.1|6873089_6873623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448350.1|6873623_6874013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088448351.1|6874016_6874658_-	hypothetical protein	NA	A0A1B1ITG1	uncultured_Mediterranean_phage	32.1	1.7e-19
>prophage 7
NZ_CP020917	Achromobacter denitrificans strain PR1 chromosome, complete genome	6929205	6897232	6907726	6929205		Pseudomonas_phage(28.57%)	10	NA	NA
WP_088448593.1|6897232_6898036_+	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	50.6	5.9e-70
WP_088448381.1|6898051_6898273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088448382.1|6899511_6900675_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	38.0	2.5e-53
WP_088448383.1|6900684_6902469_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	37.1	3.4e-81
WP_088448384.1|6902483_6903125_+	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	48.3	1.3e-46
WP_088448385.1|6903135_6903636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088448386.1|6903632_6904439_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	55.7	7.4e-20
WP_088448387.1|6904435_6904825_+	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	52.2	1.3e-27
WP_157672786.1|6904817_6904973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088448388.1|6906799_6907726_+	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	60.0	1.1e-107
