The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	757900	766411	3186859		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|757900_758383_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_015380738.1|758366_759497_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|759499_760231_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|760232_760487_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|760486_761167_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003645864.1|761159_763379_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_053267268.1|763363_764818_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	4.3e-50
WP_003645866.1|764814_765840_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_003645867.1|765832_766411_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 2
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	955893	990088	3186859	integrase,portal,capsid,tail,terminase	Lactobacillus_phage(80.0%)	39	955654:955670	995726:995742
955654:955670	attL	CCGTGCGGGTGATAAGT	NA	NA	NA	NA
WP_053267716.1|955893_957015_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	4.9e-46
WP_053267717.1|957101_958016_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_053267718.1|958069_959818_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016511204.1|959993_960170_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	3.9e-11
WP_053267719.1|960445_961507_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	45.1	4.6e-86
WP_053267720.1|961592_962051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267721.1|962151_962574_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_053267722.1|962588_963107_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.8	9.3e-16
WP_033608054.1|963248_963503_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_080371147.1|963499_963670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267723.1|963681_963987_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_053267724.1|964054_964567_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	2.3e-27
WP_024002536.1|965068_965599_+	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_052748123.1|965610_966576_+	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
WP_053267725.1|966655_967564_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_013355745.1|967560_967848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267726.1|967844_968363_+	hypothetical protein	NA	O03915	Lactobacillus_phage	52.3	4.3e-37
WP_053267727.1|968359_968740_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_053267728.1|968732_968930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267729.1|968922_969333_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	55.3	2.3e-33
WP_053267730.1|969329_969776_+	DUF1642 domain-containing protein	NA	A0A2P0ZKT5	Lactobacillus_phage	41.4	1.8e-20
WP_053267731.1|970085_970553_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.9e-15
WP_080371149.1|971567_972146_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_053267732.1|972184_973129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267733.1|973348_973612_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	69.8	2.4e-28
WP_053267734.1|974501_975845_+|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	97.8	3.8e-263
WP_053267735.1|975853_977380_+|portal	phage portal protein	portal	O03928	Lactobacillus_phage	81.9	3.7e-246
WP_053267736.1|977376_978519_+|capsid	capsid protein	capsid	O03929	Lactobacillus_phage	93.7	3.6e-169
WP_053267738.1|979215_980097_+	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	58.4	1.1e-90
WP_053267739.1|980116_980545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267740.1|980541_980895_+|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	89.7	3.1e-55
WP_053267798.1|980900_981248_+|capsid	capsid protein	capsid	O03933	Lactobacillus_phage	84.3	5.0e-50
WP_053267741.1|981247_981652_+	hypothetical protein	NA	O03934	Lactobacillus_phage	98.5	4.8e-68
WP_053267742.1|981685_982201_+	hypothetical protein	NA	O03972	Lactobacillus_phage	89.0	5.9e-79
WP_053267743.1|982253_982685_+	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	1.4e-73
WP_053267744.1|982690_983314_+	hypothetical protein	NA	O03936	Lactobacillus_phage	95.5	5.4e-103
WP_053267745.1|983317_988153_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	81.0	0.0e+00
WP_053267746.1|988142_988982_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_053267747.1|988981_990088_+|tail	phage tail protein	tail	A0A0B5CYL4	Listeria_phage	35.0	1.0e-43
995726:995742	attR	CCGTGCGGGTGATAAGT	NA	NA	NA	NA
>prophage 3
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	1831052	1840900	3186859		Lactobacillus_phage(87.5%)	9	NA	NA
WP_053267625.1|1831052_1832048_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	5.3e-52
WP_015380221.1|1832675_1832813_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_053267624.1|1832908_1833349_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	4.0e-76
WP_053267623.1|1833419_1833980_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_046810985.1|1834067_1836506_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.8	0.0e+00
WP_053267622.1|1836508_1837123_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	1.2e-110
WP_003643099.1|1837466_1838414_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_053267621.1|1838599_1839571_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	97.5	2.5e-179
WP_053267620.1|1839661_1840900_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.1	5.7e-213
>prophage 4
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	2035857	2103697	3186859	head,integrase,transposase,holin,protease,portal,capsid,tail,terminase,tRNA	Lactobacillus_phage(72.34%)	75	2046986:2047001	2095941:2095956
WP_114894109.1|2035857_2036733_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	3.6e-20
WP_027822961.1|2036741_2037449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053267088.1|2037609_2038173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033611449.1|2038604_2039045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080371090.1|2039234_2039399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021730634.1|2039766_2040633_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_053267089.1|2040625_2041933_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003643301.1|2042065_2042506_+	universal stress protein	NA	NA	NA	NA	NA
WP_154566808.1|2042917_2043088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267090.1|2043320_2043701_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	63.2	7.8e-12
WP_053267091.1|2043711_2043975_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	97.7	2.8e-37
WP_053267130.1|2043974_2045087_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	36.4	2.5e-34
WP_053267092.1|2046061_2046313_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.2	4.2e-30
WP_053267093.1|2046305_2048924_-	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	62.9	9.0e-184
2046986:2047001	attL	AGATTCCTGTGGACGG	NA	NA	NA	NA
WP_053267094.1|2048939_2051339_-|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	69.9	0.0e+00
WP_080371098.1|2051406_2053047_-|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	65.1	5.4e-219
WP_053267096.1|2053187_2058410_-|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	76.8	0.0e+00
WP_016058335.1|2058422_2058614_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_053267097.1|2058610_2058994_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	99.2	8.8e-64
WP_053267098.1|2059195_2059834_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	90.5	2.2e-104
WP_053267099.1|2059834_2060218_-	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	96.9	3.6e-65
WP_015380477.1|2060214_2060655_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	4.2e-78
WP_053267100.1|2060644_2061007_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	96.7	8.3e-64
WP_053267101.1|2060990_2061329_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	93.8	1.1e-52
WP_053267102.1|2061401_2062634_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.4	2.7e-207
WP_053267103.1|2062633_2063389_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	6.7e-124
WP_053267104.1|2063366_2064560_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	97.7	1.1e-221
WP_053267105.1|2064562_2064757_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
WP_053267106.1|2064746_2066645_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	97.0	0.0e+00
WP_053267107.1|2066647_2067106_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.0	4.0e-79
WP_053267108.1|2067266_2067548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080371092.1|2067580_2068048_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.8	7.9e-83
WP_053267110.1|2068058_2068229_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	91.1	5.3e-21
WP_053267111.1|2069038_2069470_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	98.6	1.7e-76
WP_053267112.1|2069630_2070086_-	DUF1642 domain-containing protein	NA	A0A2K9VD68	Lactobacillus_phage	45.2	4.0e-23
WP_053267113.1|2070082_2070505_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	44.7	1.0e-12
WP_154566810.1|2070524_2070692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267114.1|2070925_2071303_-	hypothetical protein	NA	A0A1S5SCY1	Streptococcus_phage	41.5	1.3e-14
WP_053267115.1|2071299_2071746_-	DUF1642 domain-containing protein	NA	Q5ULV5	Lactobacillus_virus	63.6	6.0e-48
WP_080371094.1|2071748_2072144_-	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	54.0	2.0e-34
WP_154566812.1|2072172_2072340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100255588.1|2072342_2072501_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	3.9e-18
WP_053267117.1|2072504_2072816_-	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	91.3	3.2e-48
WP_053267118.1|2072818_2073121_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	87.0	4.7e-44
WP_046038735.1|2073256_2074042_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.2	4.1e-132
WP_053267119.1|2074041_2074839_-	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	65.3	6.3e-56
WP_003641373.1|2075878_2076184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164878069.1|2076184_2076355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267120.1|2076735_2076990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825329.1|2077132_2077393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179297125.1|2077607_2077772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267121.1|2077785_2078484_-	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	60.9	1.3e-68
WP_027823017.1|2078549_2078801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267122.1|2078905_2079658_-	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	2.2e-58
WP_003644552.1|2079670_2079886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267123.1|2080142_2080475_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	60.0	2.1e-29
WP_053267124.1|2080467_2080875_+	toxin	NA	A0A1B0Y2S4	Lactobacillus_phage	47.8	4.0e-30
WP_053267125.1|2080939_2081815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267126.1|2082976_2084158_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.9	6.9e-59
WP_053267127.1|2084399_2085734_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.2	5.8e-38
WP_053267128.1|2085746_2086754_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003638174.1|2086942_2087143_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_053267129.1|2087486_2087852_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_088467706.1|2088050_2089739_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
WP_053267260.1|2089770_2090547_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003644133.1|2090571_2091450_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053267259.1|2091574_2092459_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_053267258.1|2092451_2093768_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_053267257.1|2094016_2096356_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	9.3e-39
2095941:2095956	attR	CCGTCCACAGGAATCT	NA	NA	NA	NA
WP_003641346.1|2096623_2097202_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644130.1|2097655_2099029_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	4.2e-124
WP_003641344.1|2099362_2100385_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_003641343.1|2100489_2101914_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003644129.1|2101913_2103377_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003641341.1|2103376_2103697_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	2257426	2318191	3186859	transposase,integrase,tRNA,protease	Lactobacillus_phage(40.0%)	49	2281089:2281108	2284242:2284261
WP_003645743.1|2257426_2258722_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	4.2e-57
WP_003644060.1|2258892_2259522_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_021357441.1|2259630_2260104_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045352123.1|2260379_2262269_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	4.0e-16
WP_021357439.1|2262455_2263382_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	5.5e-19
WP_021357438.1|2263452_2264004_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	4.9e-07
WP_053267327.1|2264103_2264838_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644055.1|2264906_2265401_-	kinase	NA	NA	NA	NA	NA
WP_003645748.1|2265488_2265608_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_053267328.1|2265816_2269590_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_053267329.1|2269704_2270235_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_053267330.1|2271106_2271751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072540428.1|2272089_2272638_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	9.1e-30
WP_077727009.1|2272634_2272844_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047672916.1|2274218_2276753_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.5	1.2e-68
WP_053267332.1|2276875_2279392_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_114894106.1|2279501_2281688_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
2281089:2281108	attL	TGGTTTCCGTATAATAAAGG	NA	NA	NA	NA
WP_053267334.1|2281687_2282776_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	38.5	1.5e-60
WP_053267335.1|2282833_2286385_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
2284242:2284261	attR	CCTTTATTATACGGAAACCA	NA	NA	NA	NA
WP_053267336.1|2286409_2290060_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_021357610.1|2290094_2290676_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_053267337.1|2290678_2291272_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_158099649.1|2291474_2293064_-	alpha-rhamnosidase	NA	NA	NA	NA	NA
WP_015825253.1|2293169_2293502_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_053267338.1|2293863_2294874_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_053267339.1|2295005_2295806_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003641176.1|2296009_2296450_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003644046.1|2296510_2296933_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641174.1|2296947_2297130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267340.1|2297142_2297688_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641172.1|2297699_2297954_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641171.1|2298194_2300042_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
WP_011101208.1|2300031_2300415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355305.1|2301009_2301366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033098992.1|2301432_2302500_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_033098993.1|2302499_2303090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267341.1|2303124_2305836_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|2305998_2306313_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_053267342.1|2306444_2308949_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_053267343.1|2309445_2310129_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053267344.1|2310676_2311045_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	40.9	6.6e-16
WP_021730181.1|2311277_2311646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267345.1|2312213_2312483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087509231.1|2312489_2312651_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_053267346.1|2312758_2313625_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_053267347.1|2313621_2314215_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_053267348.1|2314470_2317038_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_157697323.1|2317653_2317827_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053267349.1|2317819_2318191_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	2515881	2524505	3186859		Streptococcus_phage(66.67%)	11	NA	NA
WP_003643943.1|2515881_2516877_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	5.9e-51
WP_003640969.1|2517015_2517801_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643942.1|2517804_2518701_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640967.1|2518799_2519147_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|2519171_2520191_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_053267369.1|2520222_2520537_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003644908.1|2520533_2521199_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|2521596_2521848_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|2521862_2522462_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|2522477_2522786_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|2522807_2524505_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 7
NZ_CP021997	Lactiplantibacillus plantarum strain LPL-1 chromosome, complete genome	3186859	2542954	2643488	3186859	integrase,transposase,protease,portal,capsid,tail,terminase,tRNA,lysis	Lactobacillus_phage(80.65%)	103	2572537:2572552	2610749:2610764
WP_003644975.1|2542954_2544367_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
WP_003640932.1|2544644_2546135_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640931.1|2546460_2547636_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_053267373.1|2547651_2549031_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640928.1|2550091_2550628_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_053267374.1|2550766_2551063_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_053267375.1|2551071_2551755_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_053267376.1|2551830_2553162_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	3.2e-68
WP_053267377.1|2553351_2554044_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_021356512.1|2554462_2555140_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003643926.1|2555289_2556315_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003643925.1|2556747_2557710_-	AEC family transporter	NA	NA	NA	NA	NA
WP_016526944.1|2558019_2559213_+	LCP family protein	NA	NA	NA	NA	NA
WP_016526943.1|2559280_2560054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267378.1|2560046_2560850_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_003644984.1|2560846_2562169_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003640916.1|2562171_2562573_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003640915.1|2562583_2563555_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003640914.1|2563718_2564237_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003640913.1|2564233_2564653_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_053267379.1|2564723_2567573_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003640911.1|2567877_2568264_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_003644988.1|2568392_2569325_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003640909.1|2569343_2570150_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003640908.1|2570185_2571160_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_046038320.1|2571450_2572305_-	C39 family peptidase	NA	NA	NA	NA	NA
2572537:2572552	attL	TGCGGCCAAGAAGATT	NA	NA	NA	NA
WP_053267380.1|2572730_2573663_-	lysin	NA	A0A2P0ZLG2	Lactobacillus_phage	96.8	3.4e-178
WP_053267381.1|2573662_2573947_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	97.9	2.0e-41
WP_053267382.1|2573946_2574141_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	100.0	6.9e-25
WP_053267383.1|2574143_2574527_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	94.5	3.6e-65
WP_053267384.1|2574531_2574978_-	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	69.7	1.5e-46
WP_053267385.1|2574980_2575430_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	41.8	4.0e-23
WP_053267386.1|2575436_2579159_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	67.1	0.0e+00
WP_053267387.1|2579178_2580000_-|tail	phage tail family protein	tail	A0A2P0ZLE2	Lactobacillus_phage	95.6	2.9e-149
WP_053267388.1|2580003_2584551_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	80.8	0.0e+00
WP_003643912.1|2584569_2584791_-	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_003643911.1|2584814_2585129_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
WP_053267389.1|2585221_2585833_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.6	4.3e-105
WP_053267390.1|2585847_2586270_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.9	9.7e-72
WP_053267391.1|2586266_2586674_-	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_053267392.1|2586670_2587060_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	86.8	1.9e-61
WP_053267393.1|2587040_2587346_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	97.0	1.4e-48
WP_003643905.1|2587484_2588663_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_053267394.1|2588683_2589436_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	98.4	2.3e-132
WP_053267395.1|2589422_2590565_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.8	2.0e-212
WP_053267396.1|2590583_2592266_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	98.8	0.0e+00
WP_053267418.1|2592262_2592550_-|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	87.4	5.6e-39
WP_053267397.1|2592658_2592901_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	91.2	2.9e-36
WP_053267398.1|2592918_2593161_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	83.8	6.6e-33
WP_080371116.1|2593160_2593499_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	94.6	2.3e-60
WP_003643898.1|2593482_2593698_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_053267399.1|2593766_2594474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053267400.1|2594652_2595084_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	95.6	3.9e-68
WP_053267401.1|2595095_2595404_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	93.1	1.6e-47
WP_053267402.1|2595536_2596046_-	DUF1642 domain-containing protein	NA	A0A2K9VC25	Lactobacillus_phage	56.3	5.7e-42
WP_179297124.1|2596060_2596219_-	hypothetical protein	NA	O03920	Lactobacillus_phage	71.2	6.4e-13
WP_053267403.1|2596247_2596907_-	SAM-dependent DNA methyltransferase	NA	D6PSV0	Lactobacillus_phage	94.6	7.7e-100
WP_101843607.1|2596948_2597098_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	89.1	1.0e-12
WP_053267404.1|2597117_2597450_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	90.0	4.2e-54
WP_053267405.1|2597704_2598970_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	93.6	5.4e-227
WP_053267406.1|2598966_2599761_-	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	93.9	1.6e-139
WP_053267407.1|2599831_2600464_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	3.5e-102
WP_053267408.1|2600466_2601183_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	4.6e-114
WP_053267409.1|2601182_2601692_-	HNH endonuclease	NA	A0A0S2MXX9	Enterococcus_phage	35.3	1.5e-13
WP_053267419.1|2601688_2602948_-	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	96.2	3.1e-230
WP_053267410.1|2603099_2603579_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	93.7	9.3e-79
WP_021730257.1|2603681_2603852_-	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_015825166.1|2603823_2604009_-	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_179297123.1|2604001_2604178_-	hypothetical protein	NA	A0A2P0ZLB1	Lactobacillus_phage	86.2	7.7e-23
WP_053267411.1|2604170_2604614_-	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	91.2	1.7e-71
WP_021357721.1|2604752_2605025_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	100.0	1.2e-43
WP_053267412.1|2605024_2605228_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	98.5	5.7e-30
WP_053267413.1|2605224_2606034_-	ORF6N domain-containing protein	NA	Q9T1J2	Lactobacillus_phage	60.4	6.0e-46
WP_050339955.1|2606046_2606229_-	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	60.0	5.2e-14
WP_053267414.1|2606499_2606880_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	64.5	1.0e-40
WP_053267415.1|2606889_2607321_+	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	99.3	1.7e-79
WP_053267416.1|2607413_2608037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267417.1|2608271_2608730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053266960.1|2608906_2609269_+	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	85.8	1.0e-53
WP_053266959.1|2609440_2610598_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.9	2.3e-216
WP_053267002.1|2610888_2611764_-	homoserine kinase	NA	NA	NA	NA	NA
2610749:2610764	attR	TGCGGCCAAGAAGATT	NA	NA	NA	NA
WP_003640905.1|2611772_2613059_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003644992.1|2613124_2613571_-	SprT family protein	NA	NA	NA	NA	NA
WP_033615666.1|2613570_2615742_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_053267003.1|2616035_2616470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644995.1|2616524_2619179_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	8.8e-70
WP_003640900.1|2619634_2620462_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_053267004.1|2620461_2621940_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	3.3e-106
WP_003644996.1|2622096_2622834_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640897.1|2623003_2623705_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644997.1|2623728_2624865_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_053267005.1|2624943_2625735_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.7	1.7e-29
WP_003640894.1|2626095_2626917_+	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	3.3e-52
WP_003640893.1|2627109_2628216_+	anion permease	NA	NA	NA	NA	NA
WP_053267006.1|2628374_2629217_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003640891.1|2629251_2629587_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_053267007.1|2629617_2630142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640889.1|2630315_2630774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088467707.1|2630802_2631578_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	55.0	9.3e-28
WP_015639982.1|2632188_2633031_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003643855.1|2633085_2634558_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003642090.1|2640877_2642377_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_053267179.1|2642480_2643488_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
