The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	85032	167667	4668350	tRNA,tail,holin,plate,integrase	Burkholderia_phage(58.62%)	72	140314:140333	180138:180157
WP_036048694.1|85032_87003_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036048693.1|86999_87689_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_013696165.1|87745_88516_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.4	1.7e-21
WP_013696166.1|88554_89442_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	37.3	3.8e-17
WP_013696168.1|90846_91377_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_025097717.1|91538_92390_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_013696170.1|92466_92736_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_013696171.1|92862_93333_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017917925.1|93335_93875_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_036048690.1|93919_95461_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_013696174.1|95533_96412_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_017917924.1|96484_97879_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_013696176.1|98038_98464_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_036052913.1|98717_100415_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	27.1	3.0e-39
WP_036048688.1|101088_101949_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080742130.1|102099_103227_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_036048685.1|103755_106008_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_036048683.1|106499_110423_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_013696183.1|110509_111649_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_036048681.1|111926_113081_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_036035265.1|113112_113922_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025097728.1|113979_114591_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017919796.1|114687_115119_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036048679.1|115207_117892_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	4.6e-135
WP_036048677.1|117926_118115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048676.1|118206_118686_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_025097733.1|118916_120326_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_036048674.1|120363_121761_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_013696192.1|121757_122552_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_036035280.1|122641_124162_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_036048672.1|124499_125642_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036048671.1|125703_126789_-	ADP-heptose--LPS heptosyltransferase	NA	NA	NA	NA	NA
WP_013696196.1|126834_128556_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_013696197.1|128761_130150_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_013696198.1|130179_131325_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_036048669.1|131468_134399_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.4	2.0e-256
WP_036048666.1|134462_134846_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017920319.1|134889_136008_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_013696202.1|136891_137296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048664.1|137499_138552_-	oxidoreductase	NA	NA	NA	NA	NA
WP_036035288.1|139033_141118_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.4	4.4e-101
140314:140333	attL	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
WP_036048662.1|141215_142154_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_036048660.1|143441_144596_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042285421.1|144966_146073_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	78.2	1.5e-159
WP_036048658.1|146883_149676_-	hypothetical protein	NA	E5E3N5	Burkholderia_phage	85.8	0.0e+00
WP_017920741.1|149678_149882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157693187.1|149878_150397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025097752.1|150480_150729_-	ogr/Delta-like zinc finger family protein	NA	A4JWR6	Burkholderia_virus	86.6	3.6e-34
WP_013696212.1|150838_151042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048654.1|151133_151607_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	56.4	1.1e-36
WP_036048653.1|151803_152091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048652.1|152286_153384_-	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	61.2	1.5e-119
WP_036048649.1|153383_153881_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	71.8	1.4e-45
WP_088555429.1|153895_154447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088555430.1|154428_156537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048646.1|156533_156653_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	83.8	1.6e-11
WP_036048644.1|156661_156997_-|tail	phage tail assembly protein	tail	E5E3U8	Burkholderia_phage	81.4	6.3e-34
WP_013696219.1|157066_157576_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	69.8	2.3e-67
WP_025097759.1|157603_158776_-|tail	phage tail sheath protein	tail	E5E3V0	Burkholderia_phage	80.5	1.4e-181
WP_036048642.1|158825_159686_-|tail	caudovirales tail fiber assembly protein	tail	A4JWS8	Burkholderia_virus	70.9	9.2e-77
WP_036048640.1|159704_162293_-	phage Tail collar domain protein	NA	E5E3V2	Burkholderia_phage	54.8	5.9e-228
WP_036035313.1|162295_162853_-|tail	phage tail protein I	tail	E5E3V3	Burkholderia_phage	80.0	2.4e-78
WP_036048639.1|162830_163736_-|plate	baseplate assembly protein	plate	E5E3V4	Burkholderia_phage	79.1	6.8e-131
WP_025097764.1|163732_164095_-|plate	baseplate assembly protein	plate	E5E3V5	Burkholderia_phage	75.0	1.7e-45
WP_036052908.1|164091_164787_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	74.5	5.8e-90
WP_036048637.1|165020_165437_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	47.4	6.9e-30
WP_036048635.1|165429_165594_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	75.7	4.2e-07
WP_036048634.1|165571_166021_-	protein lysB	NA	E5E3W1	Burkholderia_phage	64.4	3.6e-40
WP_013696230.1|166017_166830_-	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	75.6	1.4e-111
WP_013696231.1|166826_167099_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	76.7	1.3e-29
WP_013696232.1|167100_167445_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	80.5	6.1e-40
WP_013696233.1|167460_167667_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	70.6	2.1e-19
180138:180157	attR	CACGCTGGAGGCGCTCGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	377902	429431	4668350	protease,plate,transposase	Pithovirus(25.0%)	53	NA	NA
WP_013696412.1|377902_378628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036033506.1|378908_383609_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_036033510.1|383705_385172_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_036048478.1|385274_387032_-	ABC transporter ATP-binding protein/permease	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	31.1	1.7e-05
WP_036048477.1|387764_388922_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013696417.1|388949_389147_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_013696418.1|389188_390004_+	thiazole synthase	NA	NA	NA	NA	NA
WP_042284870.1|390000_391122_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_013696420.1|391444_392266_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	2.6e-20
WP_013696421.1|392262_393030_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_013696422.1|393045_393552_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_036048476.1|393607_394528_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_013696424.1|394637_395264_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025101319.1|395260_395530_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_013696426.1|395737_396664_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	32.9	2.0e-24
WP_013696427.1|396660_397416_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013696428.1|397436_397676_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_036048475.1|397692_399048_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_017918341.1|399044_399701_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_013696431.1|399741_401070_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_036048474.1|401228_402299_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.0	1.7e-19
WP_017918339.1|402381_402969_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_013696434.1|403044_403665_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_013696435.1|403661_404303_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_013696436.1|404465_405221_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_013696437.1|405307_406081_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_036048472.1|406080_406506_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_017918336.1|406502_406868_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_085963621.1|406979_407324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013696441.1|407349_407715_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_013696442.1|407830_408070_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_013696443.1|408096_408651_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_013696444.1|408698_409478_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.9	8.4e-29
WP_013696445.1|409636_410845_-	Do family serine endopeptidase	NA	W5SAB9	Pithovirus	30.2	2.0e-08
WP_036048471.1|410866_411613_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_013696447.1|411833_412454_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_013696448.1|412453_413836_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_036052886.1|413858_414617_+	cytochrome c1	NA	NA	NA	NA	NA
WP_012734444.1|414712_415324_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_013696450.1|415391_415892_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.8	3.5e-20
WP_036048470.1|416076_416361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036048469.1|417239_417683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036048468.1|418069_419254_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.2e-18
WP_013696459.1|419350_420136_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_036048467.1|420132_421479_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_036048466.1|421579_422197_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042284862.1|422570_423242_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_013696463.1|423278_423797_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013696464.1|423812_425303_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013696465.1|425379_425883_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_013696466.1|425971_426454_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_036048462.1|426531_428370_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017918328.1|428333_429431_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	725652	734619	4668350		Chrysochromulina_ericina_virus(16.67%)	7	NA	NA
WP_036029636.1|725652_727599_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.8	3.2e-146
WP_036029634.1|727814_728951_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.0e-22
WP_063769134.1|728973_730818_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.5	1.2e-54
WP_013696727.1|730915_731731_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.9	6.3e-35
WP_013696728.1|731777_732461_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	29.3	6.7e-06
WP_036048161.1|732457_732988_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_036048159.1|733017_734619_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	28.8	3.1e-17
>prophage 4
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	951247	960626	4668350	tRNA	Bacillus_virus(33.33%)	7	NA	NA
WP_013696917.1|951247_952366_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	2.0e-23
WP_036052466.1|952482_953274_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	30.5	2.3e-10
WP_036037547.1|953412_954375_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	44.2	1.9e-62
WP_085963627.1|954537_956982_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.8	3.6e-86
WP_013696921.1|957026_957710_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_013696922.1|957926_959237_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	1.2e-80
WP_036052464.1|959324_960626_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	2.8e-93
>prophage 5
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	1040436	1048758	4668350		Bacillus_phage(16.67%)	8	NA	NA
WP_036037641.1|1040436_1041837_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.3	1.4e-77
WP_013697004.1|1041805_1042783_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.2	3.3e-14
WP_013697005.1|1042839_1043832_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.7	8.2e-29
WP_036052397.1|1043907_1044243_+	competence protein ComE	NA	NA	NA	NA	NA
WP_036053687.1|1044478_1045381_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.8e-51
WP_036052395.1|1045481_1046708_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_013697009.1|1046888_1047812_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.6	2.2e-44
WP_036053684.1|1047918_1048758_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.7	1.4e-13
>prophage 6
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	1839858	1850748	4668350	terminase	EBPR_podovirus(22.22%)	12	NA	NA
WP_036051794.1|1839858_1840215_+	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	68.0	3.2e-36
WP_124083800.1|1840330_1840747_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	43.2	4.1e-14
WP_036051792.1|1840852_1841632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283651.1|1841639_1842410_+|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	61.2	2.1e-72
WP_052409082.1|1842406_1843669_+|terminase	PBSX family phage terminase large subunit	terminase	L7TKU1	Rhizobium_phage	45.2	8.9e-105
WP_036051791.1|1843670_1845788_+	hypothetical protein	NA	F8TUN9	EBPR_podovirus	33.7	1.3e-84
WP_036051790.1|1845789_1846095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036051789.1|1846198_1846948_+	hypothetical protein	NA	A0A2I7RQ07	Vibrio_phage	37.1	1.5e-06
WP_036051788.1|1846956_1848165_+	hypothetical protein	NA	A0A1B1IR95	uncultured_Mediterranean_phage	36.1	3.0e-57
WP_144417709.1|1848164_1848614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036051786.1|1848610_1849324_+	hypothetical protein	NA	F8TUN4	EBPR_podovirus	30.0	4.7e-18
WP_036051785.1|1849323_1850748_+	hypothetical protein	NA	A0A0E3JSB2	Rhodoferax_phage	41.6	1.3e-96
>prophage 7
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	1949963	1989742	4668350	tail,integrase,portal,terminase,head,capsid	Burkholderia_virus(32.14%)	60	1939781:1939796	1958366:1958381
1939781:1939796	attL	TTCGAGGGCGCGGGCG	NA	NA	NA	NA
WP_045577496.1|1949963_1950932_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.6	7.2e-30
WP_013697841.1|1950974_1951190_+	transporter	NA	NA	NA	NA	NA
WP_013697842.1|1951344_1951542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013697843.1|1951577_1951835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283625.1|1952073_1953195_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_042283623.1|1953191_1953431_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_042283620.1|1953427_1954108_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	47.4	1.8e-43
WP_042283618.1|1954104_1955103_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	56.5	6.6e-95
WP_042283616.1|1955099_1955336_-	hypothetical protein	NA	A9YWV8	Burkholderia_phage	76.9	1.1e-27
WP_042283614.1|1955332_1955707_-	DUF4031 domain-containing protein	NA	Q6V7P5	Burkholderia_virus	57.3	4.3e-31
WP_052409077.1|1955703_1956399_-	helix-turn-helix transcriptional regulator	NA	Q6V7U1	Burkholderia_virus	58.2	1.9e-16
WP_042283610.1|1956395_1956836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052409076.1|1956832_1958491_-	helix-turn-helix transcriptional regulator	NA	Q6V7U1	Burkholderia_virus	57.7	1.1e-14
1958366:1958381	attR	TTCGAGGGCGCGGGCG	NA	NA	NA	NA
WP_042283607.1|1958509_1959694_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	83.4	4.2e-189
WP_042283602.1|1960037_1960730_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	51.5	8.5e-57
WP_042283599.1|1960835_1961123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283596.1|1961128_1961443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283594.1|1961707_1961920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417712.1|1961918_1962167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283700.1|1962494_1962692_-	hypothetical protein	NA	Q3HQX5	Burkholderia_phage	70.2	3.5e-16
WP_144417713.1|1963484_1964069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283587.1|1964108_1964309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417714.1|1964353_1964635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111946523.1|1964627_1964876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042283583.1|1965209_1965584_-	helix-turn-helix transcriptional regulator	NA	A9YWX7	Burkholderia_phage	70.4	7.6e-36
WP_080741952.1|1965668_1965917_+	hypothetical protein	NA	A9YWX8	Burkholderia_phage	78.7	1.7e-28
WP_155296500.1|1965918_1966083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741951.1|1966183_1966408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283582.1|1966404_1966623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283580.1|1966702_1968466_+	DNA methyltransferase	NA	A9YX21	Burkholderia_phage	70.9	1.1e-132
WP_042283578.1|1968462_1969332_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	69.9	3.4e-111
WP_042283576.1|1969328_1970465_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	63.9	7.0e-133
WP_042283574.1|1970461_1971436_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	76.8	2.2e-143
WP_080741950.1|1971458_1972319_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.8	2.5e-66
WP_042283573.1|1972318_1972582_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052409074.1|1972578_1973670_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	61.5	9.6e-31
WP_045577498.1|1973677_1973881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741949.1|1974053_1974389_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	61.5	1.3e-31
WP_042283566.1|1974396_1974726_+	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	51.1	1.2e-21
WP_042283563.1|1974716_1975061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111946389.1|1975057_1975336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283558.1|1975332_1975698_+	DUF2591 domain-containing protein	NA	NA	NA	NA	NA
WP_042283555.1|1975694_1975991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283553.1|1975987_1976416_+	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	67.6	4.4e-48
WP_144417716.1|1976408_1977008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111946385.1|1977188_1977848_+	DNA-binding protein	NA	Q3HR05	Burkholderia_phage	39.0	1.1e-26
WP_144417717.1|1978099_1978282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088555447.1|1978269_1978959_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	25.6	1.6e-07
WP_144417718.1|1979220_1979808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283543.1|1979800_1981894_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	32.7	1.6e-87
WP_042283541.1|1981899_1982169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283538.1|1982168_1983821_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	33.5	2.3e-76
WP_042283536.1|1983817_1984702_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	38.7	7.3e-53
WP_157693196.1|1984728_1985364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283534.1|1985406_1986063_+|head	head decoration protein	head	NA	NA	NA	NA
WP_042283532.1|1986134_1987172_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	39.8	2.8e-64
WP_042283530.1|1987173_1987491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283527.1|1987487_1988051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042283526.1|1988060_1988261_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_042283523.1|1988257_1989742_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	42.6	1.9e-90
>prophage 8
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	3344615	3402879	4668350	head,tRNA,tail,integrase,transposase,protease,portal,terminase,plate,capsid	uncultured_Caudovirales_phage(37.04%)	64	3346751:3346774	3390989:3391012
WP_088555423.1|3344615_3345432_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	3.9e-08
WP_080742219.1|3345598_3346147_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080959724.1|3346249_3346576_-	hypothetical protein	NA	NA	NA	NA	NA
3346751:3346774	attL	CCACACGCCCATGATGCAGCAGTA	NA	NA	NA	NA
WP_036050144.1|3347033_3348482_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_080742221.1|3348565_3349684_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_157693214.1|3350599_3351280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088555483.1|3351299_3351656_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_157693215.1|3351664_3352546_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_144417675.1|3354187_3354613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417676.1|3354663_3355788_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_120513474.1|3355787_3356204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050136.1|3356849_3357137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050134.1|3357175_3357961_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	82.9	1.5e-129
WP_036050133.1|3358121_3358745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050130.1|3358747_3359314_-	N-acetylmuramidase	NA	A0A0E3JI96	Rhodoferax_phage	53.7	1.8e-49
WP_017918170.1|3359310_3359760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050129.1|3359832_3360882_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.8	7.2e-84
WP_013698666.1|3360891_3361098_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	8.4e-13
WP_036050127.1|3361072_3361951_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	5.2e-35
WP_036050125.1|3361960_3364390_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	35.9	1.6e-54
WP_036050123.1|3364471_3364774_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	1.3e-06
WP_013697850.1|3364851_3365355_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.2	5.6e-42
WP_036050120.1|3365364_3366534_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.4	4.8e-161
WP_036050119.1|3366605_3367325_-|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	58.6	1.5e-59
WP_036050116.1|3367338_3369303_-|tail	tail protein	tail	E5E3V2	Burkholderia_phage	59.3	4.0e-128
WP_036050113.1|3369290_3369869_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.4	6.4e-34
WP_036050112.1|3369858_3370755_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	38.4	8.7e-46
WP_036050111.1|3370751_3371084_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	3.6e-21
WP_036050109.1|3371086_3371278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417677.1|3371379_3371820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050108.1|3371847_3372528_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	28.5	1.9e-16
WP_036050107.1|3372524_3373055_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	43.4	8.5e-25
WP_036050106.1|3373044_3373575_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	30.5	4.0e-14
WP_025099034.1|3373579_3373870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050105.1|3373871_3374867_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	63.3	1.3e-119
WP_013698682.1|3374949_3375294_-|head	head decoration protein	head	NA	NA	NA	NA
WP_036050104.1|3375323_3376415_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.2	1.2e-49
WP_036050102.1|3376411_3377902_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.0	2.1e-137
WP_036050101.1|3377898_3378105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742226.1|3378115_3380119_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.4	2.8e-177
WP_080742227.1|3380081_3380651_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036050092.1|3380763_3380958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742228.1|3381177_3381951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036050090.1|3382171_3384679_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.6	1.7e-94
WP_036050087.1|3384939_3385323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036035932.1|3385309_3385852_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.6	5.8e-29
WP_155296535.1|3386012_3386738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025099044.1|3387098_3387317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050083.1|3387368_3387731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042286168.1|3387730_3388768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050080.1|3388869_3389262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698698.1|3389270_3389507_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_036050065.1|3389463_3390765_-|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.2	5.7e-139
WP_080742231.1|3390923_3393632_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.9	5.7e-24
3390989:3391012	attR	CCACACGCCCATGATGCAGCAGTA	NA	NA	NA	NA
WP_052409263.1|3393615_3394908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013698701.1|3394965_3395514_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_036053111.1|3395501_3396773_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_080562351.1|3397012_3397273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036050063.1|3397393_3398170_-	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	33.8	5.4e-28
WP_036050060.1|3398174_3399320_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_025099054.1|3399429_3400332_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_036053110.1|3400376_3400901_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013698707.1|3401007_3402210_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036050057.1|3402219_3402879_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	3673791	3682607	4668350		Leptospira_phage(16.67%)	14	NA	NA
WP_080742194.1|3673791_3675093_-	DNA-packaging protein	NA	S5VY04	Leptospira_phage	39.0	2.2e-29
WP_042286051.1|3675170_3675785_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	49.5	1.2e-43
WP_036049752.1|3675836_3676022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042286049.1|3676018_3676795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127841027.1|3676862_3677174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127841026.1|3677170_3677425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045577484.1|3677465_3679211_-	toprim domain-containing protein	NA	A0A0F7L6A5	uncultured_marine_virus	36.9	2.3e-98
WP_052409243.1|3679207_3680068_-	hypothetical protein	NA	V5URT9	Shigella_phage	34.0	1.6e-09
WP_036049744.1|3680060_3680297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742188.1|3680293_3680572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036049742.1|3680673_3681336_+	hypothetical protein	NA	A0A0U4JEE2	Pseudomonas_phage	35.2	4.6e-20
WP_036049740.1|3681425_3681614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127841025.1|3681766_3682120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036049735.1|3682112_3682607_+	helix-turn-helix transcriptional regulator	NA	E5AGE6	Erwinia_phage	45.1	8.3e-06
>prophage 10
NZ_CP022005	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 1, complete sequence	4668350	3923657	3934555	4668350	protease,tRNA	Klosneuvirus(14.29%)	9	NA	NA
WP_036049482.1|3923657_3926495_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.9	6.5e-79
WP_013699140.1|3926497_3926998_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_036049481.1|3927102_3928314_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.9	8.2e-39
WP_013699142.1|3928394_3928841_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.6	8.7e-47
WP_025098176.1|3928961_3931259_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	1.1e-169
WP_036049478.1|3931255_3931570_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	7.6e-13
WP_004196460.1|3932101_3932305_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_036049476.1|3932442_3934035_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_013699147.1|3934189_3934555_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	3.6e-06
>prophage 1
NZ_CP022006	Burkholderia gladioli pv. gladioli strain KACC 11889 chromosome 2, complete sequence	3922845	631196	639730	3922845		uncultured_virus(33.33%)	10	NA	NA
WP_013690384.1|631196_631487_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	42.6	6.1e-17
WP_013690383.1|631504_633139_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.1	1.3e-169
WP_036056142.1|633261_634461_-	alginate O-acetyltransferase	NA	A0A125RNN9	Pseudomonas_phage	27.7	7.1e-19
WP_036056144.1|634465_635887_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	37.7	2.3e-80
WP_036056146.1|636270_636822_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_111946411.1|636820_637090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036056147.1|637126_637498_+	GFA family protein	NA	NA	NA	NA	NA
WP_017918263.1|637494_637659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017918264.1|637658_638405_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.4e-27
WP_036056149.1|638401_639730_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	27.5	2.6e-14
>prophage 1
NZ_CP022007	Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence	210524	11126	78554	210524	transposase,integrase	Burkholderia_phage(25.0%)	52	9033:9049	28930:28946
9033:9049	attL	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_036047717.1|11126_12056_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_036047714.1|12274_12667_-	DUF2471 family protein	NA	NA	NA	NA	NA
WP_036052807.1|12757_13057_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047712.1|13149_13416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047709.1|13440_16590_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	28.2	2.0e-89
WP_036047707.1|16596_18075_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_036047700.1|18896_19304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047697.1|19368_20127_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	35.0	4.6e-32
WP_036047694.1|20395_21388_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	1.8e-156
WP_036047694.1|21609_22602_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	85.5	1.8e-156
WP_144417600.1|23031_23352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047689.1|23370_23688_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047687.1|24169_24361_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042284319.1|25390_26260_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013700210.1|26379_26709_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_036047680.1|26894_27317_-	hypothetical protein	NA	A0A1P8DJD6	Virus_Rctr71	40.9	7.8e-21
WP_155296512.1|27390_27558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047676.1|27602_27878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105820820.1|28541_29628_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.6	3.2e-42
28930:28946	attR	CCCGGAAAACGGGGTGA	NA	NA	NA	NA
WP_144417602.1|30122_30689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742007.1|30723_31023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047658.1|31260_31647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047655.1|31674_32076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111946429.1|32363_32723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417603.1|32707_32944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047947.1|32954_33329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155308249.1|33811_33982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742004.1|34063_34546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742003.1|35518_36097_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_036047652.1|36093_37686_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	1.7e-68
WP_027810102.1|37717_38068_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.5e-17
WP_052409116.1|38813_39047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042284310.1|39844_44083_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.7	2.5e-26
WP_042284307.1|44104_44575_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_042284304.1|44627_45062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036032541.1|45061_45931_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_042284301.1|45930_48921_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045577426.1|49431_50307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080742001.1|51130_52276_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_052409115.1|52155_53868_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042284296.1|54361_54838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_157693257.1|54869_55541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088555622.1|55537_55864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080742000.1|56337_56661_+	Arc family DNA-binding protein	NA	A0A0H5AWD9	Pseudomonas_phage	55.8	8.3e-07
WP_036052800.1|56984_57872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080741999.1|58304_59363_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_036052799.1|59362_61102_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	24.6	1.7e-21
WP_155296510.1|61486_70765_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	28.7	7.2e-26
WP_036053757.1|70976_71528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036052788.1|74591_75221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296509.1|75925_76213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036052779.1|77747_78554_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP022007	Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence	210524	89211	132810	210524	transposase,integrase	Leptospira_phage(50.0%)	46	92395:92409	139599:139613
WP_036052759.1|89211_90792_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.8	1.3e-44
WP_111946417.1|90822_91155_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.5	9.1e-17
WP_036052753.1|91799_92420_-	hypothetical protein	NA	NA	NA	NA	NA
92395:92409	attL	GCCAGGGTCTTCGGG	NA	NA	NA	NA
WP_144417605.1|92514_92799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047908.1|92848_93109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047905.1|93199_93733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417606.1|95536_95905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157693258.1|95996_96518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417608.1|96786_97083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144417609.1|97118_97877_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_036047899.1|98145_98388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047897.1|98443_99286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144417610.1|99625_99820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047895.1|99816_100608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088555623.1|101056_101814_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_036047889.1|101868_102090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042284287.1|102086_103076_+	DUF4238 domain-containing protein	NA	A0A0F7LBR6	Escherichia_phage	36.4	6.6e-55
WP_088555625.1|103102_105430_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	27.1	7.1e-07
WP_036047888.1|105588_106248_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	25.6	3.2e-05
WP_036047886.1|106311_106569_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_036047884.1|106568_106997_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_144417611.1|107067_107370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047882.1|107402_107681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047880.1|107729_108053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059443127.1|108069_108540_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_036052819.1|108565_108904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036047877.1|108935_110516_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	31.5	7.9e-34
WP_036047875.1|110548_110902_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	6.3e-16
WP_036047873.1|110877_111360_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144417612.1|111622_111934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036052816.1|113390_113867_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111946435.1|113902_114193_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.0	1.7e-14
WP_036047871.1|114224_115790_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	1.5e-69
WP_080742020.1|115984_116590_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_036047869.1|116720_117896_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_036047868.1|118115_118886_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	24.6	1.6e-08
WP_036047866.1|119044_119599_-	OsmC family protein	NA	NA	NA	NA	NA
WP_036047864.1|119875_120439_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036047862.1|120568_120910_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_036047859.1|120978_121659_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_036052815.1|121826_122936_+	alkene reductase	NA	NA	NA	NA	NA
WP_036047853.1|124043_124646_-	NADP oxidoreductase coenzyme	NA	NA	NA	NA	NA
WP_036052813.1|124778_125720_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036047851.1|126131_127514_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_036057583.1|127960_128374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036047848.1|130665_132810_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
139599:139613	attR	GCCAGGGTCTTCGGG	NA	NA	NA	NA
