The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022014	Mycobacterium tuberculosis strain MTB2 chromosome, complete genome	4417716	2211109	2257893	4417716	transposase,protease	Burkholderia_virus(50.0%)	47	NA	NA
WP_003899118.1|2211109_2212786_+|protease	PecA family PE domain-processing aspartic protease	protease	NA	NA	NA	NA
WP_003409976.1|2212773_2213427_-	cutinase family protein	NA	NA	NA	NA	NA
WP_003409980.1|2213541_2213772_+	DUF167 domain-containing protein	NA	NA	NA	NA	NA
WP_003409986.1|2213856_2214768_-	ArgP/LysG family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003409989.1|2214876_2215476_+	amino acid transporter	NA	NA	NA	NA	NA
WP_088545684.1|2215891_2216323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900446.1|2216548_2217088_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(37)	NA	NA	NA	NA	NA
WP_003410001.1|2217607_2218168_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003410003.1|2218164_2218506_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_003410006.1|2218591_2218849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410009.1|2218749_2219085_-	dehydrogenase	NA	NA	NA	NA	NA
WP_003410010.1|2219173_2219518_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003410014.1|2219511_2219760_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_003899120.1|2219859_2222175_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.2	1.1e-87
WP_003410017.1|2222171_2222444_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_003410018.1|2222496_2222853_-	Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR	NA	NA	NA	NA	NA
WP_003410019.1|2223009_2223777_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003899121.1|2223872_2224826_+	universal stress protein	NA	NA	NA	NA	NA
WP_003899122.1|2227812_2228589_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_003901309.1|2228683_2230006_-	APC family permease	NA	NA	NA	NA	NA
WP_003902248.1|2230076_2231690_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003900448.1|2231699_2232452_+	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_003410047.1|2232527_2233310_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	36.5	1.3e-05
WP_003410049.1|2233430_2234288_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003410057.1|2234345_2235842_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003410060.1|2235863_2236751_-	universal stress protein	NA	NA	NA	NA	NA
WP_003410065.1|2240629_2240974_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003410070.1|2241162_2242488_-	DUF4143 domain-containing protein	NA	NA	NA	NA	NA
WP_003899127.1|2242575_2242818_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_003410075.1|2242818_2243217_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_003410078.1|2243399_2243831_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003410080.1|2243871_2244366_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_071854215.1|2245042_2245690_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003899131.1|2245643_2246234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003902247.1|2246361_2247618_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_087902221.1|2248366_2249628_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003410103.1|2249901_2250942_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	53.2	9.3e-100
WP_003410108.1|2251183_2251903_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2252113_2253375_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_034165516.1|2253373_2253667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003410120.1|2253682_2253982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003410124.1|2254066_2254372_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003900449.1|2254380_2254986_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003410131.1|2255010_2255370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902245.1|2255529_2256207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003410133.1|2256158_2256395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2256632_2257893_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
>prophage 2
NZ_CP022014	Mycobacterium tuberculosis strain MTB2 chromosome, complete genome	4417716	2936739	2984087	4417716	protease,head,terminase,tRNA,integrase,capsid	Mycobacterium_phage(30.0%)	56	2974616:2974643	2984240:2984267
WP_003413486.1|2936739_2938818_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2938926_2939154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031655258.1|2939150_2940536_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2940880_2941381_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2941397_2941838_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2941984_2942662_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2942646_2943000_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2943012_2943438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2943434_2944109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2944186_2945008_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413487.1|2948003_2948231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413569.1|2949956_2950457_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2950473_2950914_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2951060_2951738_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2951722_2952076_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2952088_2952514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2952510_2953185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2953262_2954084_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2954219_2955113_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2955115_2955934_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2955948_2957130_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2957188_2957620_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2958133_2959375_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2959684_2960047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2960393_2961518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2961519_2962059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2962198_2963497_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2963535_2963817_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2963961_2964447_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2964473_2964731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2964731_2967068_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2967096_2967339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2967339_2968017_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2968212_2968869_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2969031_2969478_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2969652_2969985_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2970104_2970464_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2970565_2971024_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2971159_2971540_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2971536_2973033_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2973222_2973459_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2973531_2973705_+	hypothetical protein	NA	NA	NA	NA	NA
2974616:2974643	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2974749_2975181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2975177_2976176_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2976189_2976654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003908028.1|2976641_2976893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2977063_2978503_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2978510_2979044_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2979196_2979823_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2979854_2980178_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2980257_2980503_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2980499_2981927_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2981928_2982321_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2982317_2982578_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2982594_2982957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2982959_2984087_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2984240:2984267	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
