The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	66909	119344	5548751	tail,integrase,transposase,tRNA	Enterobacteria_phage(58.06%)	60	60133:60148	119423:119438
60133:60148	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|66909_68643_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|68819_69308_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|69427_69820_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|69819_71898_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|71890_73039_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|73240_73885_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|73895_74285_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|74299_75349_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|75351_76212_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|76230_77832_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|77877_79539_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|79681_80185_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|80205_82170_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|82174_83101_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|83097_83985_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|84111_84690_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|84692_85043_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|85822_86251_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|86257_87682_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|87656_88457_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|88623_89610_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|89624_91139_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|91208_92198_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|92994_93498_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|93577_93829_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|93943_94030_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|94291_94615_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|94785_95283_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|95319_95559_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|95750_96962_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|97023_97689_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|98045_99047_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|99052_99400_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|99429_100080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|100095_100500_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|100589_100727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|100798_101002_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|101023_101374_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|101384_101663_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|101674_101917_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|101913_102027_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|102119_102536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|102559_102763_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|102759_103026_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|103022_103322_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|103333_103951_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|103947_104313_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|104319_107142_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|107218_108178_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|108182_108497_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|109588_110119_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|110162_110735_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|110891_111380_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|114182_114338_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|114346_114712_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|114766_115279_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|115278_116463_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|116620_116944_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829202.1|117048_118261_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_050543672.1|118264_119344_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
119423:119438	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	176924	245456	5548751	portal,tail,terminase,capsid,transposase,head,integrase,holin	Escherichia_phage(35.56%)	68	192722:192737	251115:251130
WP_001023455.1|176924_177194_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_088591992.1|177195_178509_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001230509.1|178572_179172_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088591993.1|179239_182719_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_072147834.1|182959_183589_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_044697890.1|183534_184278_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	1.1e-150
WP_013009257.1|184288_184987_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.6	3.3e-133
WP_000847298.1|184986_185316_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_088591994.1|185312_187892_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
WP_000533402.1|187872_188286_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|188312_188744_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|188757_189498_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|189479_189746_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|189803_190151_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|190187_191693_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|191682_193275_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
192722:192737	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|193271_193478_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_088591995.1|195362_195872_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_001299328.1|196266_196491_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|196572_196887_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|197413_197599_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|197826_197958_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|197970_198153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|198308_198842_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|198892_199237_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|199241_199457_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|199767_200980_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|201062_202913_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|203390_203819_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|204452_205142_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|205138_205498_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|205510_206560_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|206561_206840_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|207007_207220_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|207406_207511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|207620_208184_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|208310_208622_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|208618_208771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|208803_209160_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|209156_209381_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|209402_210101_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|210135_210678_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|210589_211627_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|211695_212121_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|212117_212345_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|212442_213087_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|213361_213514_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|213994_214183_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|214179_214368_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|214463_216935_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|216993_217197_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|217196_218219_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|218454_219252_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_162829348.1|223980_225193_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000480501.1|229298_230351_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|230664_231981_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|232082_233537_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|233879_234596_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|235221_236865_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|236982_237933_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|238034_238952_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|239408_240344_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|240405_241485_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|241496_242240_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|242236_242782_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|243143_243524_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|243520_243868_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|243917_245456_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
251115:251130	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 3
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	249422	318326	5548751	tail,lysis,terminase,capsid,transposase,head,integrase,protease,holin	Stx2-converting_phage(46.15%)	91	265730:265744	325469:325483
WP_162829204.1|249422_250635_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000638172.1|250619_251501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|251497_252403_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102658.1|252399_253470_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|253605_254289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|254304_254715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|254935_255757_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|255838_256318_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|256332_256809_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|256871_257093_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|257166_257535_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|257993_258188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|258200_258314_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|258802_258985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|259085_259415_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|259586_260645_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|260843_261317_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|261435_262602_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|263925_264576_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491529.1|264800_265676_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	5.5e-162
265730:265744	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023406.1|265816_266086_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_088591996.1|266087_267401_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	4.1e-76
WP_001230508.1|267464_268064_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_088591997.1|268131_271611_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
WP_072147834.1|271851_272481_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|272426_273170_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_088591998.1|273180_273879_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	99.1	3.1e-131
WP_000807964.1|273878_274220_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_088591999.1|274212_277455_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.7	0.0e+00
WP_001453698.1|277506_277716_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030048.1|277811_278186_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	2.3e-64
WP_001275508.1|278191_278908_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000969601.1|278966_279311_-	DUF3168 domain-containing protein	NA	A0A0N7KZG1	Stx2-converting_phage	100.0	1.9e-57
WP_000573374.1|279307_279754_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007889.1|279750_280101_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125984.1|280111_280438_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|283126_283348_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173077.1|283392_285330_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001399867.1|285393_287055_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000958380.1|287051_287615_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|287906_288272_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|288313_288541_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|289003_289261_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|289257_289755_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|289957_290395_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|290391_290889_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|290888_291104_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|291180_291453_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|291493_291673_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143087.1|291809_293747_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_001303568.1|293990_294314_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|294610_294880_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|294891_295851_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|296500_296989_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|296979_297651_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|297647_298253_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|298252_298975_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|299049_299730_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|299985_300744_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|301018_301201_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|301197_301725_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|301721_302168_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|302124_302361_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|302371_302587_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|302719_302998_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|303068_304445_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|304441_305263_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|305249_305411_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|305443_305740_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|305881_306097_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|306172_306868_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|307369_307891_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|308459_308642_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|308619_308892_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|308950_309202_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|309384_309753_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|309825_309990_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|309958_310102_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|310176_310473_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|310478_311264_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_088592000.1|311260_311662_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.2	6.4e-65
WP_162829202.1|311667_312880_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682306.1|313251_313434_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|313406_313598_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000188870.1|313674_313890_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|313988_314210_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|314206_315154_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|316015_316366_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|316553_316898_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|316975_317167_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|317147_318326_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
325469:325483	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 4
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	404343	507222	5548751	portal,tRNA,tail,terminase,capsid,transposase,head,integrase,protease,holin	Enterobacteria_phage(41.51%)	100	490261:490276	512940:512955
WP_000476014.1|404343_405705_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|406034_406352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|406757_407657_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|407738_408518_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|408617_409658_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|409705_411061_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|411064_411349_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|411379_411832_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_088592001.1|411841_413104_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|413132_413987_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|414285_415338_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|415594_416872_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|416868_417873_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|417869_418835_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|418808_419555_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|419606_420425_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|420489_421290_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|421286_422075_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|422408_422648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|423698_424046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|424055_424370_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|424479_424752_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134630.1|424872_425718_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|425935_426274_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|426355_427390_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|427400_429881_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677408.1|429896_430571_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|430658_431201_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|431492_431774_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|432035_433145_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|433276_435310_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|442267_445897_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|445958_446276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|447516_448605_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|448615_450145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|450163_450895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|450887_452024_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|452020_454024_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|454148_454610_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|454651_455122_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|455168_455888_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|455884_457570_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|458084_458333_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023455.1|458700_458970_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268980.1|458971_460285_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001228289.1|460349_460949_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_105626738.1|461016_464490_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_141220896.1|464735_465368_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	1.3e-109
WP_088592002.1|465313_466057_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	1.0e-148
WP_088592003.1|466067_466766_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.0e-130
WP_000847298.1|466765_467095_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_137330402.1|467091_467856_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.4	1.1e-134
WP_143182661.1|467807_469670_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
WP_000533402.1|469650_470064_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|470090_470522_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|470535_471276_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|471257_471524_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|471581_471929_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|471965_473471_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|473460_475053_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|475049_475256_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|475239_477168_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|477431_478970_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|479019_479367_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|479363_479744_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|479819_480095_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|480845_481052_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|481307_481580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|481739_482273_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|482493_482607_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|482828_483014_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|483541_483856_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|484131_485982_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|486749_487463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|488083_488902_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|489053_489425_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|489414_489786_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|489798_490848_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
490261:490276	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_001341388.1|490849_491128_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|491295_491451_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|492055_492829_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|493180_493594_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|493609_494380_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|494401_495148_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|495154_496246_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|496324_496780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|496986_497412_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|497395_497668_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|497776_498178_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|498205_498397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|498396_498684_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|498961_499117_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|499258_499648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|499834_500020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|500593_500782_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|500778_500970_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_192575079.1|501736_502950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	3.2e-168
WP_000273151.1|504915_505158_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|505135_506155_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|506562_507222_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
512940:512955	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 5
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	738152	776239	5548751	portal,tail,lysis,terminase,integrase,protease,holin	Enterobacteria_phage(50.0%)	49	737737:737751	776313:776327
737737:737751	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|738152_738851_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|739081_739963_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|740132_740294_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|740790_741810_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|741843_742824_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|743000_743270_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|743271_744588_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|744647_745247_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|745317_748731_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|748791_749400_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|749336_750080_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|750085_750784_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|750793_751123_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|751122_754188_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|754159_754489_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|754497_754884_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211117.1|754944_755688_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	97.6	1.4e-129
WP_001079422.1|755698_756100_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|756096_756675_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|756686_756962_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|756954_757278_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_127446149.1|759326_759662_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|759783_760908_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|760835_761048_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|761044_763147_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|763146_763638_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|764312_764465_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|764452_764920_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|764916_765414_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|765413_765629_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|765771_766170_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|766250_766409_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|766494_767238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|767421_768111_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|768125_768248_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|768585_769545_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|769756_770422_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|770418_771039_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|771031_771202_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|771198_771381_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|772078_772759_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|772755_772938_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|772910_773102_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|773178_773394_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|773492_773714_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|773924_774527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|774769_774937_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|774976_775195_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_089625990.1|775300_776239_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
776313:776327	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	1356473	1410101	5548751	integrase,transposase,plate	Enterobacteria_phage(26.67%)	44	1351099:1351113	1362713:1362727
1351099:1351113	attL	TCCGGGGCGGTTCAG	NA	NA	NA	NA
WP_001130487.1|1356473_1357655_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|1358617_1359361_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|1360184_1360958_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_192575079.1|1361458_1362672_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	3.2e-168
WP_000251069.1|1363564_1363858_-	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
1362713:1362727	attR	TCCGGGGCGGTTCAG	NA	NA	NA	NA
WP_000437875.1|1363976_1364177_-	Cro/Cl family transcriptional regulator	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|1364277_1364991_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_162829202.1|1365512_1366726_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|1367061_1367307_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|1368376_1369630_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|1369641_1370745_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|1371032_1372088_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|1372126_1372528_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|1372585_1373830_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1373921_1374380_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|1374640_1376098_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059871.1|1377196_1377649_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|1377658_1378057_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|1378059_1378353_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|1378404_1379460_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|1379530_1380316_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|1380260_1382000_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|1382817_1383591_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|1383776_1384037_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|1384055_1384316_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1384471_1385212_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|1385182_1385950_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1386054_1386633_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|1386872_1389317_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|1389359_1389833_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|1389986_1390757_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|1390874_1392047_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|1392127_1392313_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|1392227_1392491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420837.1|1394455_1395592_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451832.1|1396337_1396907_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000995683.1|1398665_1399382_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509129.1|1399521_1403754_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|1403829_1405971_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|1406180_1406699_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|1407395_1407896_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1407930_1408155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|1408205_1409597_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|1409687_1410101_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2050146	2064811	5548751	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	2045987:2046002	2063516:2063531
2045987:2046002	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|2050146_2051562_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|2051644_2052628_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|2052793_2053036_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|2053169_2054207_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|2054295_2055393_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|2055454_2055703_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|2055863_2056505_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|2056586_2057216_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|2057288_2057861_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|2057972_2058242_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|2058243_2059557_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|2059621_2060221_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|2061542_2062079_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|2062069_2062420_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|2062416_2062701_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|2063036_2063234_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|2063578_2063860_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
2063516:2063531	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|2063907_2064081_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|2064277_2064811_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 8
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2217342	2306856	5548751	plate,tRNA,tail,transposase,head,protease	Shigella_phage(48.89%)	107	NA	NA
WP_000208242.1|2217342_2217873_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|2217882_2219214_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_001308187.1|2219280_2220207_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2220299_2220785_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001301616.1|2220844_2221519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232687.1|2221641_2222268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|2222306_2222552_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2222977_2223823_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_000136788.1|2223845_2225354_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250664.1|2225583_2226594_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796310.1|2226690_2227437_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323555.1|2227441_2227870_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|2227896_2228196_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|2228407_2228848_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|2228948_2229548_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|2229655_2230423_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001452665.1|2230477_2231233_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001045681.1|2231339_2232329_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|2232647_2233610_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076742.1|2233790_2234693_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001223800.1|2234841_2235342_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|2235491_2236190_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2236186_2237560_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_088592018.1|2237665_2238340_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166037.1|2238488_2239472_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2239731_2240352_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001301668.1|2241667_2242606_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217135.1|2242589_2243426_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144081.1|2243713_2245183_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_088592019.1|2245179_2246439_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179721.1|2246613_2247438_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619508.1|2247447_2247762_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000749920.1|2247802_2249197_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000729611.1|2249674_2250121_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000446027.1|2250131_2251571_+	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_088592020.1|2251560_2252583_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000528251.1|2252689_2253427_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|2253380_2253581_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2253695_2254160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2254198_2254444_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2254479_2254662_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2254808_2256848_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2256947_2257508_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2257729_2257933_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2258012_2258534_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2258568_2259480_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2259479_2260040_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2260030_2261113_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2261112_2261550_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2261542_2262157_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2262146_2263271_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|2263254_2264604_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|2264590_2266666_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|2266792_2267269_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2267283_2267649_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2267657_2269160_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2269156_2269402_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2269402_2269963_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2269959_2270379_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_021497370.1|2270375_2270792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2270835_2271783_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|2271782_2272907_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|2273083_2273557_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|2273678_2275010_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|2274993_2276583_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|2276582_2278247_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|2278246_2278828_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|2278830_2279121_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|2279117_2279426_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|2279406_2279634_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2279643_2279862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2279845_2280274_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2280308_2280809_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2280880_2281306_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|2281375_2281885_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|2281881_2282178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2282167_2282365_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|2282357_2282690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2282705_2283056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|2283070_2283382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|2283378_2283930_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|2283933_2284449_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|2284448_2284982_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000323221.1|2284985_2285528_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|2285625_2286156_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|2286167_2286461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2286465_2286738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2286734_2287016_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2287017_2287272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2287284_2287506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2287508_2288441_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|2288512_2290603_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|2290604_2290853_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|2291020_2291605_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_000931343.1|2291950_2293699_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001301617.1|2293748_2294804_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753589.1|2294956_2295790_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_010917870.1|2295983_2299034_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331376.1|2299046_2299949_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|2299945_2300581_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027708.1|2300577_2301507_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001086384.1|2301836_2302079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295676.1|2302295_2302514_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001304016.1|2303207_2304122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226329.1|2304128_2305022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297068.1|2305432_2306374_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560983.1|2306418_2306856_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	2598214	2610710	5548751	integrase	Enterobacteria_phage(90.0%)	13	2599592:2599612	2610873:2610893
WP_001219063.1|2598214_2599396_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
2599592:2599612	attL	TGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783682.1|2600097_2602431_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_000856729.1|2602445_2602766_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459321.1|2602901_2603357_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.4e-63
WP_001244665.1|2603349_2603637_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980246.1|2603629_2604220_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001149160.1|2604216_2604483_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283029.1|2605034_2605769_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_000638629.1|2605765_2606266_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446146.1|2606339_2606912_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000186475.1|2607239_2607665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119815.1|2607661_2609521_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_001218979.1|2609540_2610710_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
2610873:2610893	attR	TGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 10
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	3690861	3697913	5548751	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|3690861_3692075_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|3692292_3692562_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|3692722_3693145_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|3693274_3694333_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|3694411_3695062_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|3695244_3695835_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|3696336_3696585_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|3697430_3697913_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 11
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	3975488	3980914	5548751	integrase	Enterobacteria_phage(50.0%)	6	3964476:3964492	3983110:3983126
3964476:3964492	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|3975488_3976058_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|3976057_3976525_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|3976511_3977192_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_088592033.1|3977201_3978338_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.4	9.0e-80
WP_000958700.1|3978512_3979670_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|3979981_3980914_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3983110:3983126	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 12
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4225718	4289658	5548751	portal,tail,terminase,integrase,protease,holin	Enterobacteria_phage(40.32%)	77	4248713:4248729	4268010:4268026
WP_000569336.1|4225718_4226645_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|4226649_4227381_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4227361_4227469_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|4227528_4228230_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|4228250_4229537_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|4229570_4229825_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|4229843_4229978_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|4229981_4230224_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000628777.1|4230311_4230875_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	75.0	8.4e-71
WP_000192143.1|4231388_4231937_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
WP_000015506.1|4231933_4232158_-	hypothetical protein	NA	Q286X0	Escherichia_phage	100.0	1.2e-36
WP_001242710.1|4232154_4232766_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
WP_000008177.1|4232756_4233293_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_000081284.1|4233420_4234245_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	99.6	7.8e-150
WP_000135680.1|4234310_4234673_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000606712.1|4235662_4236748_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	39.0	1.2e-60
WP_001410974.1|4236982_4237687_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	58.7	1.3e-68
WP_000098316.1|4237793_4238057_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_000514170.1|4238085_4238670_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.4	6.5e-58
WP_001188051.1|4238845_4239025_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_000104976.1|4239014_4239956_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	3.9e-153
WP_072141877.1|4239952_4240447_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_001452588.1|4240446_4241100_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_000210164.1|4241096_4241423_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767113.1|4241419_4241809_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061404.1|4241828_4242626_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_001360050.1|4242633_4243623_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001204753.1|4243640_4244075_+	hypothetical protein	NA	Q777W5	Enterobacteria_phage	98.6	4.0e-81
WP_000691354.1|4244581_4245529_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4245538_4245808_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142933.1|4246307_4248254_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|4248390_4248570_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|4248610_4248856_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
4248713:4248729	attL	GAAGCGCGTCTTGATGC	NA	NA	NA	NA
WP_000284506.1|4248933_4249149_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|4249153_4249687_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|4249957_4250527_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4250526_4250673_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4250900_4251086_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|4251297_4251570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|4251602_4252079_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|4252075_4253083_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_033885334.1|4253244_4254483_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	3.9e-60
WP_000229066.1|4254475_4254700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033804801.1|4254759_4255338_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	64.2	2.4e-57
WP_072178019.1|4255482_4256595_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_054408081.1|4256587_4256908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054408079.1|4256914_4257214_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_054408076.1|4257210_4259028_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	3.7e-128
WP_054408074.1|4259315_4259561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054408072.1|4259557_4259968_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|4260427_4260622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033804800.1|4260618_4262508_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.7	5.5e-183
WP_054408096.1|4262765_4263050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102414.1|4264542_4264755_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|4264754_4266257_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001097065.1|4268312_4268639_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
4268010:4268026	attR	GAAGCGCGTCTTGATGC	NA	NA	NA	NA
WP_001281350.1|4268631_4268913_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|4268915_4269539_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|4269551_4269950_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|4269957_4270710_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|4270723_4271146_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|4271172_4271481_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_192575080.1|4271761_4273453_+|tail	phage tail length tape measure family protein	tail	Q9EYE1	Enterobacteria_phage	93.0	2.4e-230
WP_010904726.1|4273404_4274169_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_000847304.1|4274165_4274495_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|4274494_4275193_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|4275203_4275947_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|4275892_4276525_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|4276715_4277243_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515110.1|4277376_4280850_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230444.1|4280917_4281517_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|4281581_4282895_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|4282896_4283166_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|4285439_4286558_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|4286554_4288348_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|4288366_4289074_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|4289070_4289658_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4551417	4671962	5548751	portal,tRNA,tail,lysis,terminase,capsid,integrase,head,transposase,protease,holin	Enterobacteria_phage(37.5%)	148	4542077:4542092	4677090:4677105
4542077:4542092	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
WP_000952736.1|4551417_4552239_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|4552394_4553441_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|4553437_4554232_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|4554398_4555517_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|4555485_4555755_-	excisionase	NA	NA	NA	NA	NA
WP_000241021.1|4555816_4556254_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.5	5.9e-40
WP_000559928.1|4556338_4556854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|4556968_4557121_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|4557436_4557913_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|4558037_4558361_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|4558344_4558770_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|4558838_4559876_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|4559787_4560330_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|4560363_4561080_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|4561112_4561394_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|4561390_4561693_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|4561682_4562000_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|4561953_4562271_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|4562257_4562695_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|4562696_4562888_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|4562890_4563478_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|4563593_4563698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|4563886_4564099_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|4564266_4564545_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|4564546_4565596_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|4565608_4565983_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|4565979_4566801_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|4567879_4569817_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|4569964_4570147_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|4570184_4570454_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|4570529_4570745_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731240.1|4570749_4571094_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
WP_000992148.1|4571144_4571678_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_088592037.1|4571948_4572518_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.0e-104
WP_000539792.1|4572517_4572664_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|4572891_4573098_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|4573162_4573387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|4573743_4573884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|4574013_4574199_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|4574240_4574606_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4574894_4575458_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|4575454_4577116_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4577179_4579117_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|4579161_4579383_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|4581909_4582236_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4582245_4582596_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4582592_4583039_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4583035_4583380_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|4583445_4584162_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|4584176_4584551_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|4584646_4584856_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_088592038.1|4584907_4588150_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.8	0.0e+00
WP_000807950.1|4588142_4588484_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|4588483_4589182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|4589198_4589453_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|4589562_4589673_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|4589975_4590854_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|4590907_4591645_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|4591590_4591827_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|4591839_4591929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|4591948_4594297_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|4594887_4598289_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|4600597_4600873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|4600933_4602295_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|4602658_4603522_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4603505_4604642_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|4604891_4606118_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|4606166_4607288_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|4607536_4608766_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|4609130_4609319_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|4610123_4610321_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|4610313_4610526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|4610515_4610980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|4610972_4611206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|4611211_4611511_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|4611507_4612908_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|4613108_4613360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|4613356_4613767_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|4613777_4614050_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|4614176_4614401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|4614652_4614859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|4614858_4615914_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|4615926_4616262_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|4616274_4616688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|4616893_4617436_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|4617691_4617973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|4618573_4620034_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|4620033_4620705_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4620873_4622244_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|4622247_4622889_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|4622924_4624031_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4624084_4624546_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|4624555_4625209_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|4625380_4626631_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000088655.1|4627863_4628100_-	excisionase	NA	NA	NA	NA	NA
WP_000145915.1|4629721_4630024_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|4630091_4630424_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|4630488_4630611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|4630668_4632195_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_088592039.1|4632696_4633095_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	62.0	2.8e-44
WP_162829202.1|4633100_4634313_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_088592040.1|4634279_4634465_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.4e-06
WP_000224907.1|4634464_4634635_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|4634627_4634918_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|4634914_4635277_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|4635273_4635414_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|4635410_4636100_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|4636421_4636727_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|4636713_4637190_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|4637406_4637589_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|4637679_4637973_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|4638264_4638675_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|4638960_4639167_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|4639331_4639526_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|4639914_4640460_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|4640434_4642360_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|4642356_4642563_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4642559_4644161_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4644141_4645461_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4645470_4645803_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|4645858_4646884_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|4646925_4647324_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753014.1|4647335_4647689_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000975100.1|4647700_4648279_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|4648275_4648671_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|4648678_4649419_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|4649434_4649857_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|4649838_4650273_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|4650265_4652815_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|4652811_4653141_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|4653140_4653839_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|4653844_4654588_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|4654524_4655157_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|4655217_4658616_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|4658682_4659282_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|4659346_4662262_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885630.1|4662261_4662843_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488339.1|4662962_4663853_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|4663871_4664378_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|4664414_4664915_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|4664993_4665176_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|4665673_4666342_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|4666398_4666647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|4666722_4667103_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4667099_4667447_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4667496_4669035_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|4669337_4670822_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|4671008_4671962_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
4677090:4677105	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 14
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4767346	4889423	5548751	portal,tail,terminase,capsid,integrase,transposase,head,protease,holin	Enterobacteria_phage(29.59%)	136	4784558:4784617	4845532:4845594
WP_000113674.1|4767346_4768477_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4768454_4768703_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|4768767_4771239_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|4771331_4771523_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4771519_4771708_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|4772266_4772500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|4772477_4772885_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|4772907_4773126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|4773198_4773498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|4773761_4774169_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|4774245_4774473_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|4774456_4775008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|4774979_4776020_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|4775931_4776474_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|4776660_4777242_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|4777238_4777403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|4778101_4778860_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|4779138_4779351_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|4779571_4779829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|4779898_4780177_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|4780178_4781225_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|4781237_4781597_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000917750.1|4782364_4782562_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|4782712_4783771_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
4784558:4784617	attL	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCT	NA	NA	NA	NA
WP_000143067.1|4784567_4786421_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|4786570_4786786_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|4786790_4787135_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_088592043.1|4787185_4787719_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	2.3e-102
WP_162829202.1|4788311_4789525_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000539792.1|4789871_4790018_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|4790245_4790431_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|4790855_4791083_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|4791124_4791490_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4791778_4792342_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|4792338_4794000_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4794063_4796001_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|4796045_4796267_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|4798792_4799119_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000573374.1|4799474_4799921_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4799917_4800262_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|4800320_4801037_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030045.1|4801042_4801417_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	6.6e-64
WP_134792845.1|4801512_4801722_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	98.6	2.6e-33
WP_088592044.1|4801772_4805015_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.9	0.0e+00
WP_000807954.1|4805007_4805349_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|4805348_4806047_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|4806057_4806801_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|4806746_4807379_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|4807721_4808897_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|4808848_4811194_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|4811261_4811861_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|4812012_4813326_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|4813327_4813597_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|4814623_4815949_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|4817546_4817669_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|4817775_4818687_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|4818752_4819322_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|4820287_4821826_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4821875_4822223_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4822219_4822600_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|4822939_4823218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|4823645_4823792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|4823928_4824576_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|4824759_4825350_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|4826856_4827507_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000113671.1|4828806_4829937_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|4829914_4830163_-	excisionase	NA	NA	NA	NA	NA
WP_088592045.1|4830227_4832672_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|4832764_4832953_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|4832949_4833138_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|4833535_4833700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4834080_4834236_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|4834425_4834833_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|4834910_4835138_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705378.1|4835121_4835673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020565.1|4835644_4836685_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_157837342.1|4836596_4837139_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000537579.1|4837173_4837932_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
WP_000215514.1|4837991_4838177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211435.1|4838524_4839073_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000882662.1|4839287_4839500_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|4839602_4839920_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|4839912_4840284_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|4840507_4840735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177817.1|4840788_4841058_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_088592046.1|4841059_4842109_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904171.1|4842121_4842496_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|4842492_4843314_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917735.1|4843540_4843738_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483509.1|4843888_4844947_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_088592047.1|4845541_4847488_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
4845532:4845594	attR	GGGAGGAATAATGACATTTAAACATTATGATGTTGTCAGGGCGGCGTCGCCGTCAGACCTTGC	NA	NA	NA	NA
WP_000143458.1|4847625_4847805_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|4847845_4848091_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|4848168_4848384_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001015158.1|4848387_4848945_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001092902.1|4848981_4849515_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|4850033_4850219_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|4850693_4851170_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077626.1|4851166_4853290_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|4853286_4853499_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974554.1|4853498_4855001_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
WP_001114424.1|4854945_4856970_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|4857057_4857384_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|4857376_4857658_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974960.1|4857660_4858284_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_000682716.1|4858296_4858695_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|4858702_4859455_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|4859468_4859891_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|4859917_4860226_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_064234964.1|4860269_4862915_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|4862911_4863241_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_047082409.1|4863240_4863939_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.1e-131
WP_088592048.1|4863949_4864693_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	3.0e-145
WP_143182664.1|4864638_4865271_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	93.3	2.1e-99
WP_088592050.1|4865519_4868996_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.3	0.0e+00
WP_088592051.1|4869063_4869663_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_078267904.1|4869727_4871041_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001023417.1|4871042_4871312_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000692020.1|4872444_4873035_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|4873412_4873583_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079499.1|4874072_4874579_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|4874624_4875125_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4875210_4875390_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|4875770_4876577_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|4876576_4877770_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|4877781_4879143_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|4879143_4880739_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|4880738_4882301_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4882392_4882437_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|4882574_4883456_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4883452_4884073_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|4884100_4885684_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|4885896_4886769_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|4886808_4887399_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|4887395_4888154_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|4888373_4889423_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 15
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	4967543	5026837	5548751	portal,tRNA,tail,terminase,capsid,transposase,head,holin	Escherichia_phage(41.67%)	72	NA	NA
WP_162829202.1|4967543_4968757_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000199475.1|4970659_4970848_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|4970844_4971033_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|4971597_4971807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|4971807_4972446_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|4972457_4972610_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|4972902_4973241_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|4973632_4973875_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|4973858_4974284_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|4974352_4975396_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_072130322.1|4975307_4975850_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450627.1|4975883_4976600_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|4976632_4976914_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|4976910_4977138_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|4977130_4977442_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|4977569_4977788_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|4977789_4978347_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|4978580_4978793_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|4978912_4979257_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|4979378_4979651_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|4979652_4980702_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|4980714_4981020_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|4981082_4981637_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|4981861_4982059_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|4982194_4982908_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|4983358_4983790_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_088592054.1|4984267_4986118_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024180155.1|4986556_4986772_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731240.1|4986776_4987121_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	8.5e-58
WP_000992148.1|4987171_4987705_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|4987976_4988546_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|4988545_4988692_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|4988914_4989100_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|4989625_4989940_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|4990021_4990246_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|4990632_4991178_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027223.1|4991152_4993078_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|4993074_4993281_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4993277_4994879_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4994859_4996179_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4996188_4996521_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|4996576_4997602_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158910.1|4997643_4998039_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	93.9	2.4e-56
WP_000753003.1|4998050_4998404_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	93.2	6.6e-58
WP_000975020.1|4998418_4998952_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|4998948_4999344_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|4999351_5000104_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|5000117_5000540_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|5000566_5000980_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_088592055.1|5000960_5003573_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|5003569_5003899_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_088592056.1|5003898_5004597_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	99.6	3.3e-133
WP_000194798.1|5004607_5005351_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|5005296_5005926_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_088591997.1|5006166_5009646_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.6	0.0e+00
WP_001230508.1|5009713_5010313_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234952.1|5010377_5011592_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.5	3.9e-81
WP_001023407.1|5011593_5011863_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|5011976_5012552_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|5012624_5013254_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|5013335_5013977_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|5014138_5014381_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_162829202.1|5014625_5015839_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|5016698_5018144_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|5018143_5019454_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|5019629_5020538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|5020867_5021431_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|5021451_5022684_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|5022938_5023922_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|5024196_5024367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|5024399_5025773_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|5025901_5026837_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
>prophage 16
NZ_CP022050	Escherichia coli O157 strain FDAARGOS_293 chromosome, complete genome	5548751	5214655	5302086	5548751	portal,tail,terminase,capsid,transposase,head,holin	Escherichia_phage(28.87%)	108	NA	NA
WP_001023400.1|5214655_5214925_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_088592059.1|5214926_5216240_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001230496.1|5216304_5216904_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_088592060.1|5216970_5220450_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
WP_143182665.1|5220696_5221329_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	9.3e-103
WP_050926769.1|5221274_5222018_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.2e-146
WP_045896506.1|5222028_5222727_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	99.1	1.8e-131
WP_000847304.1|5222726_5223056_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_103899829.1|5223052_5225665_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.2	0.0e+00
WP_000533442.1|5225645_5226059_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|5226085_5226508_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|5226521_5227274_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|5227281_5227677_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|5227673_5228252_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|5228263_5228617_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|5228628_5229024_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|5229065_5230091_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|5230146_5230479_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123292.1|5230488_5231808_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|5231788_5233390_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|5233386_5233593_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748455.1|5233589_5235515_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|5235489_5236035_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_012816791.1|5236538_5236724_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092913.1|5237242_5237776_-	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	6.9e-99
WP_001041949.1|5238287_5239079_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284518.1|5239082_5239298_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_088592062.1|5239447_5241301_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_001344632.1|5241744_5241876_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_033803818.1|5242472_5243294_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.5	2.4e-82
WP_001121082.1|5243290_5243665_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_001415191.1|5243677_5244727_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.0e-109
WP_012817785.1|5244728_5244998_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|5245051_5245279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|5245502_5245874_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|5245866_5246184_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000967408.1|5246286_5246499_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|5246687_5246792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000555106.1|5246907_5247621_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_000063625.1|5247821_5248034_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000403779.1|5248082_5248439_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_001289350.1|5248416_5249136_-	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	64.8	3.4e-69
WP_000753069.1|5249132_5249309_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
WP_001224662.1|5249301_5249484_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|5249517_5249730_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|5249780_5250137_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001266133.1|5250486_5250783_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001141097.1|5250779_5251172_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.7e-38
WP_000537578.1|5251187_5251958_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	69.2	9.7e-86
WP_157837342.1|5251992_5252535_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020565.1|5252446_5253487_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_000705350.1|5253458_5254010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476995.1|5253993_5254221_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003383.1|5254298_5254706_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	9.5e-24
WP_000379563.1|5254898_5255051_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000394546.1|5255062_5255701_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|5255701_5255911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|5256475_5256664_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|5256660_5256849_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102122.1|5256941_5259404_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000005551.1|5259476_5259728_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_001206148.1|5259747_5261043_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001120551.1|5261220_5261463_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|5262425_5262806_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5262802_5263150_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5263199_5264738_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|5265320_5265971_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|5266681_5267257_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|5267370_5267640_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_024183355.1|5267641_5268955_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001230508.1|5269019_5269619_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001152128.1|5273352_5273790_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|5273789_5274131_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_072612737.1|5274123_5277204_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_001453698.1|5277256_5277466_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|5277561_5277936_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|5277941_5278658_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|5278716_5279061_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|5279057_5279504_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|5279500_5279851_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|5279860_5280187_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_105626758.1|5280266_5282444_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	86.1	0.0e+00
WP_001063099.1|5282389_5282611_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|5282655_5284593_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|5284656_5286318_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|5286314_5286878_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|5287166_5287532_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|5287573_5287801_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|5288225_5288411_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5288638_5288785_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5288784_5289354_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|5289624_5290158_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|5290208_5290553_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|5290557_5290773_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023202.1|5291212_5293063_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|5293541_5293970_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|5294606_5295296_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|5295292_5295652_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|5295664_5296714_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|5296715_5296994_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887478.1|5297161_5297374_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.1	4.0e-18
WP_001278450.1|5297562_5297667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|5297782_5298367_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|5298423_5298819_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|5299629_5300370_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|5300376_5301339_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|5301361_5301787_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|5301783_5302086_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 1
NZ_CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	0	16165	42641	transposase	Stx2-converting_phage(50.0%)	21	NA	NA
WP_105626785.1|665_2975_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_001000143.1|2977_3298_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_001031682.1|3355_3649_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_000603936.1|3641_4253_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_001103652.1|4585_5581_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_088592066.1|5582_6224_+	conjugal transfer protein TrbJ	NA	NA	NA	NA	NA
WP_001056370.1|6236_6470_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000332248.1|6510_6798_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000612441.1|6996_7335_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001171554.1|7728_8109_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|8105_8453_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|8502_10041_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001208090.1|10224_11229_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	26.7	3.3e-17
WP_000432877.1|12908_13232_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	44.1	3.9e-12
WP_000866040.1|13272_13497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749828.1|13592_13817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000702249.1|13867_14134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001450803.1|14123_14366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545936.1|14805_15084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833471.1|15520_15703_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000466317.1|15727_16165_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	33.6	6.2e-13
>prophage 2
NZ_CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	22005	25938	42641	transposase,integrase	Escherichia_phage(33.33%)	5	19189:19203	34635:34649
19189:19203	attL	CTGACAAATCTTAAA	NA	NA	NA	NA
WP_162829202.1|22005_23218_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001096504.1|23341_23644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000955370.1|24100_24313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516225.1|24348_25008_-	peptidyl-arginine deiminase	NA	A4JWV7	Burkholderia_virus	26.2	9.4e-05
WP_000018885.1|25122_25938_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.5	7.2e-23
34635:34649	attR	TTTAAGATTTGTCAG	NA	NA	NA	NA
>prophage 3
NZ_CP022051	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence	42641	29447	29894	42641		Escherichia_phage(100.0%)	1	NA	NA
WP_000616195.1|29447_29894_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	55.3	1.4e-28
>prophage 1
NZ_CP022052	Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed2, complete sequence	95288	3262	71845	95288	integrase,transposase,protease	Macacine_betaherpesvirus(22.22%)	55	6890:6903	72724:72737
WP_001358886.1|3262_5959_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_000998048.1|6395_7934_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
6890:6903	attL	GTGCTGACGGGATG	NA	NA	NA	NA
WP_000612591.1|7983_8331_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|8327_8708_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_192575079.1|9274_10488_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	3.2e-168
WP_001302181.1|10595_11594_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|11667_13389_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|13478_14585_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|14584_15406_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001034100.1|17584_21487_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_162829200.1|21667_22881_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001172748.1|23876_24266_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|24309_26520_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001302179.1|26696_26882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105064.1|28222_28429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421248.1|28523_28799_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|28798_29083_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130945.1|29994_30852_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|30844_30919_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083831.1|31154_31409_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766796.1|31648_31987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302200.1|32024_32234_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233853.1|32279_32741_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|32985_33198_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|33330_33891_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|33993_34854_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|34912_35659_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000581721.1|37917_47427_-	toxin B	NA	NA	NA	NA	NA
WP_001453090.1|49276_49708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|51930_52089_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276250.1|52320_53082_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845908.1|53078_53513_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117168.1|53567_55526_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|55591_55825_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290823.1|55881_56334_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000547965.1|56359_56566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001451816.1|56635_57085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|57170_57734_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_000199442.1|57780_59142_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|59193_59424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032245379.1|59940_60450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|60419_60611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|60607_61030_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_010891293.1|61076_61379_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001005037.1|61919_62696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|62741_63296_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104869.1|63189_63411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|63411_64095_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_010891292.1|64171_64477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|64480_65383_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|66077_67049_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|67048_68215_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_071525396.1|68802_69141_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_162829202.1|69102_70315_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000016989.1|71038_71845_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
72724:72737	attR	GTGCTGACGGGATG	NA	NA	NA	NA
