The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	0	8116	4863143		Bacillus_virus(100.0%)	7	NA	NA
WP_000434197.1|2019_3153_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506505.1|3352_4141_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_031603421.1|4258_4558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989024.1|4532_4712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001116926.1|4746_6120_+	SPI-2 type III secretion system effector kinase SteC	NA	NA	NA	NA	NA
WP_001268403.1|6586_7294_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000230462.1|7309_8116_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
>prophage 2
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	26602	27472	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000456774.1|26602_27472_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.2	2.3e-51
>prophage 3
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	31022	31880	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_077248237.1|31022_31880_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXG1	Streptococcus_phage	28.1	3.4e-07
>prophage 4
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	42097	50145	4863143	tRNA	Streptococcus_phage(20.0%)	10	NA	NA
WP_000945036.1|42097_42613_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.3e-22
WP_001046799.1|42870_43434_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945608.1|43844_44999_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	2.0e-10
WP_000387373.1|45144_46128_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001670836.1|46403_46586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206674.1|46614_47988_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156208.1|48031_48967_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
WP_000089153.1|49177_49330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159242.1|49322_49661_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|49710_50145_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
>prophage 5
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	55257	56247	4863143		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762206.1|55257_56247_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	42.5	1.2e-69
>prophage 6
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	61039	66453	4863143		Klosneuvirus(50.0%)	3	NA	NA
WP_000139701.1|61039_64942_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	28.8	7.2e-52
WP_001098498.1|65005_65806_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000527273.1|65922_66453_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	7.0e-19
>prophage 7
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	70213	70945	4863143		Planktothrix_phage(100.0%)	1	NA	NA
WP_001196340.1|70213_70945_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-24
>prophage 8
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	77484	84574	4863143		Synechococcus_phage(33.33%)	5	NA	NA
WP_000842141.1|77484_78603_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	1.5e-31
WP_020899414.1|78771_80397_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-07
WP_000414259.1|80457_81381_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000024091.1|81673_83017_+	VOC family protein	NA	NA	NA	NA	NA
WP_020899415.1|83065_84574_+	carboxylesterase/lipase family protein	NA	L7Y5U6	Megavirus	38.5	3.8e-33
>prophage 9
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	100675	102640	4863143		Phage_TP(100.0%)	1	NA	NA
WP_001249753.1|100675_102640_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.7	8.6e-22
>prophage 10
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	120245	122366	4863143		Salmonella_phage(100.0%)	1	NA	NA
WP_020899419.1|120245_122366_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	3.7e-135
>prophage 11
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	130307	131852	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_000702596.1|130307_131852_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	8.3e-20
>prophage 12
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	140015	141104	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000769035.1|140015_141104_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	75.1	4.0e-154
>prophage 13
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	147472	148483	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000642447.1|147472_148483_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	8.6e-26
>prophage 14
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	169427	169712	4863143		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000221343.1|169427_169712_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	5.2e-21
>prophage 15
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	188743	189862	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000758335.1|188743_189862_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.5	1.6e-113
>prophage 16
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	198799	199183	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091194.1|198799_199183_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 17
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	208470	227753	4863143		Escherichia_phage(44.44%)	20	NA	NA
WP_000989267.1|208470_208674_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_001181258.1|208740_210207_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.0	5.6e-42
WP_000949152.1|210350_210749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742688.1|210752_211730_-	MFS transporter	NA	NA	NA	NA	NA
WP_000836487.1|211783_212803_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000706264.1|212813_214028_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.7	2.6e-45
WP_000921389.1|214149_214476_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	2.2e-23
WP_001066440.1|214628_214970_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000199997.1|215005_215566_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000743122.1|215606_216317_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000975516.1|216420_216729_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001117604.1|216885_219324_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	7.3e-220
WP_000705294.1|219422_221858_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.2	6.0e-206
WP_000213064.1|221868_222486_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
WP_000534700.1|222487_223345_+	dimethyl sulfoxide reductase subunit H	NA	NA	NA	NA	NA
WP_000206561.1|223387_224002_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.3	2.5e-28
WP_000557304.1|224306_225017_+	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_001211193.1|225045_225948_+	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_000379677.1|225957_226605_+	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_000593086.1|226604_227753_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-25
>prophage 18
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	245467	249872	4863143		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000824309.1|245467_246601_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	2.3e-120
WP_000928682.1|246753_248460_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000732951.1|248570_249872_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	4.4e-14
>prophage 19
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	271514	272789	4863143	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168626.1|271514_272789_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 20
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	279704	280226	4863143		Salmonella_phage(100.0%)	1	NA	NA
WP_000826819.1|279704_280226_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	3.1e-51
>prophage 21
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	285300	292724	4863143		Streptococcus_phage(20.0%)	8	NA	NA
WP_001081022.1|285300_286155_+	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.2e-15
WP_000007299.1|286281_286863_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	6.9e-44
WP_000102277.1|286945_287035_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000190993.1|287330_288356_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.1e-31
WP_020899427.1|288352_289285_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020899428.1|289397_290603_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098879.1|290892_292041_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.9	2.5e-85
WP_000493971.1|292082_292724_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.3	8.8e-24
>prophage 22
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	316678	321017	4863143		Ectocarpus_siliculosus_virus(50.0%)	3	NA	NA
WP_001050769.1|316678_319441_+	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	7.1e-30
WP_000666335.1|319471_320110_+	two component system response regulator	NA	NA	NA	NA	NA
WP_000122323.1|320288_321017_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.9	2.4e-46
>prophage 23
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	338867	342077	4863143		environmental_halophage(50.0%)	3	NA	NA
WP_000143859.1|338867_340088_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.8	1.7e-92
WP_000907925.1|340084_341356_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948902.1|341330_342077_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	3.4e-11
>prophage 24
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	364055	386778	4863143	transposase,tRNA	Stx2-converting_phage(25.0%)	24	NA	NA
WP_000381395.1|364055_365627_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|365646_365994_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|365993_366671_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_105612035.1|366632_366770_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000093362.1|366766_367060_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000117497.1|367149_368790_+	medium-chain fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.3e-20
WP_000069340.1|368831_371210_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.5e-172
WP_000370992.1|371546_372380_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082196.1|372535_373582_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.6	9.7e-81
WP_000089115.1|373738_373930_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175669.1|373964_375407_-	YdiU family protein	NA	NA	NA	NA	NA
WP_000562005.1|375468_376182_-	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_001213256.1|376495_376960_-	lipoprotein	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
WP_000080607.1|377036_377786_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
WP_001181565.1|377785_378337_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000954984.1|378428_379409_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229266.1|379611_379911_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672402.1|379915_382303_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018570.1|382318_383302_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|383438_383483_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|383603_383960_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|384010_384208_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001574431.1|384303_384846_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001144223.1|384849_386778_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	4.2e-130
>prophage 25
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	399613	401866	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000019119.1|399613_401866_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.0e-143
>prophage 26
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	408033	408861	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000174981.1|408033_408861_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.0e-72
>prophage 27
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	415559	416786	4863143		Klosneuvirus(100.0%)	1	NA	NA
WP_000059493.1|415559_416786_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.6e-26
>prophage 28
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	420373	422323	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235865.1|420373_422323_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.4e-40
>prophage 29
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	427208	427865	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000184708.1|427208_427865_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	7.3e-18
>prophage 30
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	437274	440695	4863143		Bacillus_phage(100.0%)	2	NA	NA
WP_000219714.1|437274_438561_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
WP_001048646.1|439201_440695_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.3	2.0e-10
>prophage 31
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	455656	456454	4863143		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000950207.1|455656_456454_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
>prophage 32
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	461002	461533	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_000929982.1|461002_461533_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
>prophage 33
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	466172	469515	4863143		Enterobacterial_phage(50.0%)	5	NA	NA
WP_000789471.1|466172_466730_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|467541_467805_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|467936_468149_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|468563_469085_+	lipoprotein	NA	NA	NA	NA	NA
WP_000497451.1|469275_469515_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
>prophage 34
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	473402	522908	4863143	head,tRNA,portal,transposase,terminase,holin,plate,integrase,protease,capsid,tail	Salmonella_phage(56.9%)	66	495543:495557	519424:519438
WP_000502119.1|473402_473861_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001521673.1|474056_474269_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000334550.1|474522_475194_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|475186_476455_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|476457_476877_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|477213_477426_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|477550_478684_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|478721_478934_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|478923_479529_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|479498_480752_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|480738_481326_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|481328_482408_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|482400_482814_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|482818_483352_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|483351_484410_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_058804920.1|484406_485747_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	3.1e-249
WP_023171042.1|485780_487709_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|487793_488120_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|488116_488473_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|488472_489969_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|489958_490123_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|490144_490690_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|490686_491199_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|491170_491584_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|491595_491919_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171045.1|491918_492143_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.5e-10
WP_023171046.1|492186_493404_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|493413_494262_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|494275_495580_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
495543:495557	attL	GCGCTTTTTATTCGC	NA	NA	NA	NA
WP_077909829.1|495579_497322_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|497275_497740_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|497872_498217_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|498351_498579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|498675_499053_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|499095_499635_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|499631_500246_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|500245_500527_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|500513_500900_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|501050_501974_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|502080_502911_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|502941_503931_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|503938_504799_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|504815_505205_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|505201_506095_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|506094_506577_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|506578_507538_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|507534_507759_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|507755_508898_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|508894_509449_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|509477_509702_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071591199.1|509640_509826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|509799_510495_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|511309_511681_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_058804926.1|511738_512566_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	98.2	9.2e-151
WP_000008351.1|512702_513242_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_100514545.1|513369_514044_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	94.3	5.4e-40
WP_023171066.1|514043_514517_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|515277_515514_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|515503_516646_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|516759_518010_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|518181_518847_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|518843_519173_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000476067.1|519184_519646_+	NUDIX hydrolase	NA	NA	NA	NA	NA
519424:519438	attR	GCGCTTTTTATTCGC	NA	NA	NA	NA
WP_000004541.1|519699_520806_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001519653.1|520892_521534_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423763.1|521537_522908_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
>prophage 35
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	529228	531212	4863143		Bacillus_virus(50.0%)	2	NA	NA
WP_000531607.1|529228_530365_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
WP_000799391.1|530348_531212_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
>prophage 36
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	534798	538524	4863143		Vibrio_phage(50.0%)	4	NA	NA
WP_001191856.1|534798_535620_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
WP_000291338.1|535638_536550_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_020899432.1|536578_537823_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033714.1|537822_538524_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
>prophage 37
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	544709	544967	4863143		Erwinia_phage(100.0%)	1	NA	NA
WP_000800159.1|544709_544967_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	37.1	2.1e-05
>prophage 38
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	558129	558771	4863143		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000535399.1|558129_558771_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
>prophage 39
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	562045	563172	4863143		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|562045_562282_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000007236.1|562437_563172_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	1.7e-15
>prophage 40
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	576991	577942	4863143		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000578692.1|576991_577942_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.8	2.2e-10
>prophage 41
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	593954	594200	4863143		Salmonella_phage(100.0%)	1	NA	NA
WP_001217763.1|593954_594200_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	52.6	4.1e-14
>prophage 42
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	598859	599780	4863143		Morganella_phage(100.0%)	1	NA	NA
WP_000163973.1|598859_599780_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.5	8.1e-55
>prophage 43
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	608843	609383	4863143		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000203944.1|608843_609383_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.7	2.9e-28
>prophage 44
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	613537	614371	4863143		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001137620.1|613537_614371_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.5	3.3e-39
>prophage 45
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	624275	627898	4863143		Aeromonas_phage(33.33%)	3	NA	NA
WP_000628082.1|624275_625772_+	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	22.9	4.9e-17
WP_000433674.1|626056_626938_+	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
WP_001617488.1|627043_627898_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	5.9e-92
>prophage 46
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	635842	636010	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001273663.1|635842_636010_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 47
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	642294	644536	4863143		Klosneuvirus(50.0%)	3	NA	NA
WP_000420603.1|642294_643215_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
WP_001284251.1|643214_643520_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_001537781.1|644173_644536_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	43.5	2.4e-23
>prophage 48
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	657896	658577	4863143		Bacillus_phage(100.0%)	1	NA	NA
WP_000698205.1|657896_658577_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	2.2e-33
>prophage 49
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	664350	759609	4863143	tRNA,terminase,holin,transposase,integrase,protease,tail,lysis	Salmonella_phage(58.0%)	97	690079:690098	756682:756701
WP_010989012.1|664350_664671_-	membrane protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
WP_001123045.1|664888_665764_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_000938191.1|665985_666666_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|667286_667946_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|668032_668362_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|668358_668640_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|668688_669468_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|669493_670042_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|670256_671468_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|671525_671843_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|671887_672304_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|672474_673137_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|673231_673690_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|673725_675780_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|675903_676350_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|676368_678522_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|678508_679114_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_058804903.1|679330_679840_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|680196_681249_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|681320_681773_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|681958_683719_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|683787_684306_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|684405_684573_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|684828_685392_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|685388_687029_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|687033_688287_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|688301_690209_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
690079:690098	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|690221_692330_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|692428_693538_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|693534_694077_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|694242_695253_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|695460_698073_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|698499_698691_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|698961_699648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|699632_699932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|700000_700627_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|701274_702243_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|702718_703300_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|703299_705738_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|705791_706034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|706072_709423_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|709494_710199_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|710096_710834_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|710843_711539_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|711628_712162_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|712278_712776_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|712875_713208_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|714328_714874_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|715342_715789_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|715806_716259_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|716242_716572_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000381395.1|717189_718761_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|718780_719128_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|719127_719805_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000798705.1|720601_721051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|721186_721312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899439.1|721506_722196_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	2.4e-59
WP_000801757.1|722192_722333_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|722329_722941_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_022631099.1|722943_723150_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.0e-34
WP_000929788.1|723149_723752_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|723836_724058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|724167_724401_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|724992_725589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|725600_726578_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|726632_726890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|726889_727534_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|727537_727846_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|727849_728308_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|728304_728652_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|728662_729412_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|729414_730398_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|730482_730803_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|730837_731065_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|731170_731605_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|731901_732033_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|732081_732432_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|732558_735759_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|735721_736879_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|736921_737161_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|737201_737450_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_058804912.1|737494_738787_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.5	1.0e-252
WP_000191399.1|738981_740184_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|740261_741698_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|741942_743157_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|743243_743477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762342.1|743473_743935_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|744135_745536_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|746142_747234_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|747418_748609_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|748670_749318_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|749345_749894_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|750153_751995_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|752339_756806_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
756682:756701	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|756805_757510_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|757490_758813_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|758805_759609_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 50
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	764831	769395	4863143		Bacillus_phage(66.67%)	3	NA	NA
WP_000551246.1|764831_766580_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_020899446.1|766616_768881_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	1.1e-09
WP_000167332.1|769110_769395_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
>prophage 51
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	774451	775540	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_000079584.1|774451_775540_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	1.2e-78
>prophage 52
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	779636	784327	4863143		Tetraselmis_virus(100.0%)	4	NA	NA
WP_001292799.1|779636_781919_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	1.1e-161
WP_001145561.1|781994_782954_-	SPI-2 type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_010989001.1|783084_783411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012539861.1|783502_784327_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	2.8e-22
>prophage 53
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	788621	805389	4863143	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_000213069.1|788621_789239_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_000850250.1|789249_791694_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
WP_000886697.1|791930_793223_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|793481_794825_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|794834_795446_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001542260.1|795588_799644_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|799778_800273_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537407.1|800818_801787_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.1e-62
WP_001044541.1|801900_803667_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_001202267.1|803667_805389_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	8.4e-13
>prophage 54
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	809672	818404	4863143	transposase,protease	Enterobacteria_phage(16.67%)	7	NA	NA
WP_085983316.1|809672_810927_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_119920232.1|810942_811218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|811390_811849_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|812040_814317_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|814347_814668_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|814991_815213_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_001201751.1|817285_818404_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 55
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	825189	826908	4863143		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815313.1|825189_826908_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
>prophage 56
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	830497	833249	4863143		Roseobacter_phage(50.0%)	4	NA	NA
WP_000645852.1|830497_831328_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.3e-08
WP_001160725.1|831324_831648_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270724.1|831775_832291_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|832520_833249_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
>prophage 57
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	840048	849218	4863143		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149781.1|840048_841179_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.7	1.7e-25
WP_000505788.1|841221_841695_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061629.1|841768_842614_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105452.1|842610_843564_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001000698.1|843573_844707_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	6.5e-30
WP_000125769.1|844794_845907_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_020899448.1|846255_846732_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684361.1|846828_847731_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.0	3.5e-34
WP_000075300.1|847788_848511_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001259137.1|848494_848785_-	YbjC family protein	NA	NA	NA	NA	NA
WP_000495513.1|848954_849218_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	70.5	5.9e-27
>prophage 58
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	856789	858795	4863143		Escherichia_phage(50.0%)	2	NA	NA
WP_000450103.1|856789_857548_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	29.6	5.2e-15
WP_000195709.1|857592_858795_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	1.8e-99
>prophage 59
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	874319	876191	4863143		Planktothrix_phage(100.0%)	1	NA	NA
WP_001120598.1|874319_876191_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	1.3e-14
>prophage 60
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	880512	882945	4863143		Citrobacter_phage(100.0%)	1	NA	NA
WP_000192673.1|880512_882945_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 61
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	887663	889256	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000961479.1|887663_889256_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.9	2.1e-58
>prophage 62
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	894242	899550	4863143		Enterobacteria_phage(33.33%)	6	NA	NA
WP_000716763.1|894242_894758_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.2	1.1e-16
WP_020899450.1|895111_895999_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100805.1|896301_896805_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	23.0	7.1e-05
WP_000838671.1|897281_898028_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159076.1|898171_898831_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569093.1|898827_899550_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.2	1.9e-35
>prophage 63
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	903018	912334	4863143		Acinetobacter_phage(25.0%)	8	NA	NA
WP_000146330.1|903018_903285_+	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	52.8	2.2e-13
WP_000849089.1|903569_903830_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000386494.1|903985_904960_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218630.1|904989_907134_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.7	7.4e-43
WP_000007060.1|907341_908706_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	3.0e-53
WP_001025254.1|908935_909610_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000743436.1|909609_910605_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001287616.1|910597_912334_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
>prophage 64
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	920262	920721	4863143	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|920262_920721_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 65
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	924762	928060	4863143		Streptococcus_phage(50.0%)	2	NA	NA
WP_001246033.1|924762_925671_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.9	7.8e-26
WP_000482001.1|925762_928060_-	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.1	2.4e-15
>prophage 66
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	934921	938350	4863143		Klosneuvirus(50.0%)	3	NA	NA
WP_000205518.1|934921_936211_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	7.7e-19
WP_000767419.1|936268_936745_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001095227.1|936829_938350_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	2.2e-81
>prophage 67
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	946807	954425	4863143		Planktothrix_phage(33.33%)	8	NA	NA
WP_000891710.1|946807_947866_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
WP_000604026.1|947868_948558_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000951416.1|948557_949331_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891513.1|949497_949647_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_001147410.1|949775_950564_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096928.1|950631_952107_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	30.2	4.4e-10
WP_000885513.1|952277_953186_+	DUF2167 domain-containing protein	NA	NA	NA	NA	NA
WP_001265465.1|953408_954425_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.3	3.3e-81
>prophage 68
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	958733	959510	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_001214710.1|958733_959510_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.5	4.9e-13
>prophage 69
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	965185	966454	4863143		Oenococcus_phage(100.0%)	1	NA	NA
WP_000074128.1|965185_966454_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	26.6	3.2e-33
>prophage 70
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	970179	973703	4863143		Edwardsiella_phage(33.33%)	4	NA	NA
WP_001109234.1|970179_971232_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.1	3.7e-80
WP_000784380.1|971551_971938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951251.1|972048_972987_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	1.4e-25
WP_000345368.1|972983_973703_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	35.3	3.7e-23
>prophage 71
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1000132	1000924	4863143		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113970.1|1000132_1000924_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.7	6.8e-10
>prophage 72
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1006028	1013222	4863143	integrase	Staphylococcus_phage(33.33%)	8	1002511:1002525	1014462:1014476
1002511:1002525	attL	TCAGCATGAACATTG	NA	NA	NA	NA
WP_000702849.1|1006028_1006739_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	2.2e-07
WP_000998823.1|1006742_1007513_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058800706.1|1007641_1008823_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001524627.1|1008788_1009682_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001524621.1|1009681_1010833_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.9	2.8e-81
WP_001194239.1|1011118_1011859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010988980.1|1011860_1012196_-	membrane protein	NA	NA	NA	NA	NA
WP_000824704.1|1012655_1013222_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.4	4.3e-51
1014462:1014476	attR	CAATGTTCATGCTGA	NA	NA	NA	NA
>prophage 73
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1017130	1024563	4863143		Acinetobacter_phage(33.33%)	6	NA	NA
WP_001041123.1|1017130_1018612_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	1.1e-45
WP_001142016.1|1018650_1020072_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	6.0e-57
WP_000401437.1|1020182_1020389_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001670793.1|1020725_1020815_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730066.1|1020814_1022494_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000088022.1|1022514_1024563_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	1.9e-27
>prophage 74
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1027833	1028511	4863143		Bacillus_phage(100.0%)	1	NA	NA
WP_000186054.1|1027833_1028511_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 75
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1039594	1049592	4863143	tRNA	Lactobacillus_phage(25.0%)	7	NA	NA
WP_000228709.1|1039594_1040998_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_000811134.1|1040984_1042124_+	tricarballylate utilization protein TcuB	NA	NA	NA	NA	NA
WP_000057014.1|1042174_1043479_+	tricarballylate/proton symporter TcuC	NA	Q6JIH2	Burkholderia_virus	34.9	1.2e-59
WP_000722261.1|1043527_1043860_-	lipoprotein	NA	NA	NA	NA	NA
WP_001258803.1|1043909_1045316_-	chitoporin	NA	NA	NA	NA	NA
WP_001287181.1|1045761_1047429_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	96.0	0.0e+00
WP_001023068.1|1047639_1049592_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	2.9e-09
>prophage 76
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1054246	1055911	4863143		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337041.1|1054246_1055911_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.2	9.4e-86
>prophage 77
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1060528	1061614	4863143		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000493272.1|1060528_1061614_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.6e-48
>prophage 78
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1067514	1072317	4863143		Planktothrix_phage(50.0%)	4	NA	NA
WP_000631369.1|1067514_1068240_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	36.3	8.7e-28
WP_001207419.1|1068356_1069292_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000498891.1|1069323_1070562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000368034.1|1070637_1072317_+	molecular chaperone HscC	NA	F2Y0P3	Organic_Lake_phycodnavirus	36.2	6.2e-77
>prophage 79
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1083142	1085725	4863143	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157918.1|1083142_1085725_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.6e-185
>prophage 80
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1093952	1096449	4863143		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231300.1|1093952_1095098_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.9e-09
WP_000858711.1|1095237_1096449_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
>prophage 81
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1100405	1101935	4863143		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000495780.1|1100405_1101194_-	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.9	1.3e-05
WP_000939753.1|1101284_1101668_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
WP_000034826.1|1101725_1101935_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	5.9e-22
>prophage 82
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1117049	1123596	4863143		Morganella_phage(33.33%)	6	NA	NA
WP_000278499.1|1117049_1117478_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.3e-18
WP_000417097.1|1117545_1118313_-	hydrogenase	NA	NA	NA	NA	NA
WP_001250381.1|1118312_1118870_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000064328.1|1118866_1121146_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	25.5	1.0e-45
WP_000377438.1|1121138_1121699_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000887644.1|1122030_1123596_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	3.2e-43
>prophage 83
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1126972	1128798	4863143		Streptococcus_phage(50.0%)	2	NA	NA
WP_000118144.1|1126972_1128208_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.3	2.9e-60
WP_001164756.1|1128180_1128798_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.3	3.0e-53
>prophage 84
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1143270	1149389	4863143		Klosneuvirus(50.0%)	3	NA	NA
WP_000140620.1|1143270_1144065_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.9	2.2e-08
WP_046072966.1|1144117_1145200_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000194139.1|1145504_1149389_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.5	3.8e-61
>prophage 85
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1173197	1180047	4863143		Salmonella_phage(75.0%)	6	NA	NA
WP_000195929.1|1173197_1174523_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.5	1.0e-103
WP_000339633.1|1174738_1175593_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000946038.1|1175931_1176261_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000915523.1|1177128_1177491_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703614.1|1177487_1178414_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	97.7	3.8e-169
WP_010988978.1|1178394_1180047_+	membrane protein	NA	B9UDL6	Salmonella_phage	37.9	6.7e-84
>prophage 86
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1191282	1195716	4863143	tRNA	Enterococcus_phage(50.0%)	6	NA	NA
WP_000729165.1|1191282_1192149_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.2e-29
WP_000190278.1|1192150_1192363_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_020899463.1|1192490_1193036_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001038573.1|1193028_1193466_+	STM0539 family protein	NA	NA	NA	NA	NA
WP_000819114.1|1193462_1194287_+	DUF2145 domain-containing protein	NA	NA	NA	NA	NA
WP_000912376.1|1194330_1195716_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.1e-44
>prophage 87
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1207003	1208152	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706331.1|1207003_1208152_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	39.0	9.1e-48
>prophage 88
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1215602	1217384	4863143		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001096865.1|1215602_1217384_-	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.3	1.9e-39
>prophage 89
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1221855	1222872	4863143		Planktothrix_phage(100.0%)	1	NA	NA
WP_000569660.1|1221855_1222872_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.2	1.3e-32
>prophage 90
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1227725	1228412	4863143		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110598.1|1227725_1228412_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.1e-31
>prophage 91
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1231687	1236906	4863143		Bacillus_virus(50.0%)	5	NA	NA
WP_000140195.1|1231687_1232365_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.5	3.0e-22
WP_000906146.1|1232511_1233429_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000561177.1|1233425_1233878_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026760.1|1233878_1234295_-	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
WP_000083899.1|1234404_1236906_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.4	6.1e-113
>prophage 92
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1246006	1256921	4863143	transposase	Acanthamoeba_polyphaga_moumouvirus(20.0%)	12	NA	NA
WP_000801786.1|1246006_1246978_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.4	6.6e-15
WP_001250078.1|1246974_1247937_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220237.1|1248165_1248810_-	adenylate kinase	NA	NA	NA	NA	NA
WP_001520210.1|1249050_1250925_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.9	7.5e-116
WP_001195023.1|1251035_1251641_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1251640_1251970_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000121962.1|1252015_1253944_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000127350.1|1254057_1254609_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.0e-28
WP_001189860.1|1254761_1255139_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_000926658.1|1255219_1255735_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_000051161.1|1255748_1255916_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_000440523.1|1255985_1256921_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.3e-63
>prophage 93
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1274539	1278086	4863143		Bacillus_phage(100.0%)	2	NA	NA
WP_001256070.1|1274539_1276321_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	5.4e-39
WP_001235572.1|1276313_1278086_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	6.1e-51
>prophage 94
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1282486	1283182	4863143		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817201.1|1282486_1283182_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	1.2e-87
>prophage 95
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1286475	1291643	4863143	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043544.1|1286475_1286748_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
WP_001067723.1|1286956_1289311_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	1.6e-224
WP_000130314.1|1289496_1290768_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	5.6e-131
WP_000122257.1|1291019_1291643_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 96
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1312721	1313831	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000928801.1|1312721_1313831_+	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	32.8	2.8e-25
>prophage 97
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1323347	1325010	4863143		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001021372.1|1323347_1323818_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.0	1.0e-29
WP_001150216.1|1323906_1325010_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.5e-50
>prophage 98
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1329693	1334033	4863143	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_000046629.1|1329693_1330665_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	2.3e-44
WP_000934811.1|1330675_1332523_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007628.1|1332550_1332883_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	3.7e-10
WP_000667305.1|1332905_1334033_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	9.5e-90
>prophage 99
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1342004	1351925	4863143		Bacillus_phage(60.0%)	7	NA	NA
WP_000893645.1|1342004_1343300_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
WP_000113921.1|1343369_1344059_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_001221261.1|1344273_1345476_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.3	5.7e-08
WP_001526312.1|1345472_1348613_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	3.4e-12
WP_000755620.1|1348785_1349958_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219277.1|1349979_1350888_-	fructokinase	NA	NA	NA	NA	NA
WP_000964305.1|1351013_1351925_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	7.1e-104
>prophage 100
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1355612	1356725	4863143		Bacillus_phage(100.0%)	1	NA	NA
WP_000484086.1|1355612_1356725_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.1	7.3e-18
>prophage 101
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1371279	1373166	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010229.1|1371279_1373166_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.2	1.2e-52
>prophage 102
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1386582	1396294	4863143		Escherichia_phage(33.33%)	6	NA	NA
WP_001651666.1|1386582_1389555_-	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.2	3.5e-83
WP_000910371.1|1389564_1391523_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	32.2	1.3e-81
WP_000288496.1|1391711_1392965_-	MFS transporter	NA	NA	NA	NA	NA
WP_001159470.1|1393257_1393452_-	gold resistance metallochaperone GolB	NA	NA	NA	NA	NA
WP_001020583.1|1393529_1393994_-	Au(I) sensor transcriptional regulator GolS	NA	NA	NA	NA	NA
WP_000083318.1|1394005_1396294_-	gold/copper-translocating P-type ATPase GolT	NA	E4ZFI9	Streptococcus_phage	33.3	7.1e-92
>prophage 103
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1403941	1404466	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_000830237.1|1403941_1404466_-	outer membrane protein	NA	B0FEG7	Escherichia_phage	29.2	1.3e-09
>prophage 104
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1417010	1417283	4863143		Salmonella_phage(100.0%)	1	NA	NA
WP_001675688.1|1417010_1417283_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	60.9	5.4e-07
>prophage 105
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1426641	1476681	4863143	portal,terminase,coat,transposase,integrase,protease,lysis	Salmonella_phage(44.29%)	71	1417712:1417728	1485896:1485912
1417712:1417728	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_126790267.1|1426641_1426917_+	GtrA family protein	NA	A0A1R3Y5Q2	Salmonella_virus	96.7	1.6e-43
WP_024143049.1|1426988_1428911_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	97.2	0.0e+00
WP_020899468.1|1428946_1430917_-	hypothetical protein	NA	T1SBJ2	Salmonella_phage	96.6	3.8e-304
WP_096812970.1|1431028_1431319_-	phage antirepressor protein	NA	H6WRU9	Salmonella_phage	43.8	4.7e-09
WP_000749288.1|1431391_1431877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029838.1|1431967_1433965_-	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_020899470.1|1433964_1435269_-	DNA injection protein	NA	E7C9U5	Salmonella_phage	95.4	1.6e-210
WP_000964898.1|1435279_1435969_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
WP_000627695.1|1435971_1436427_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_020899471.1|1436426_1437128_-	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	97.4	4.8e-76
WP_020899472.1|1437131_1438550_-	Packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	99.4	2.1e-275
WP_001166103.1|1438509_1439010_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|1438993_1439554_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_020899473.1|1439594_1440887_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_020899474.1|1440886_1441798_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	99.7	2.4e-160
WP_000774652.1|1441811_1443989_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|1443988_1445488_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|1445465_1445954_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|1445957_1446362_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|1446361_1446751_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|1446754_1446997_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|1447219_1447750_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_071533034.1|1447703_1447928_-	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
WP_001687043.1|1447962_1448430_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|1448426_1448924_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|1448901_1449105_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_071533031.1|1449189_1449423_-	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
WP_001047566.1|1449535_1450309_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|1450305_1450485_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|1450465_1450669_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|1450665_1450890_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001107939.1|1450886_1451492_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_020899477.1|1451484_1451661_-	protein ninF	NA	I6S668	Salmonella_phage	98.3	4.3e-26
WP_001531428.1|1451653_1451986_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|1451988_1452165_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|1452131_1452305_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_020899478.1|1452301_1452739_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	1.4e-78
WP_001248406.1|1452812_1454189_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|1454185_1455001_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|1454993_1455140_-	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|1455174_1455453_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001180316.1|1455588_1455816_-	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|1455893_1456604_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_020899481.1|1456689_1457613_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_020899482.1|1457648_1457852_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	7.7e-27
WP_024143050.1|1458219_1458582_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|1458598_1459042_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_020899485.1|1459664_1459943_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	98.9	2.3e-45
WP_000776963.1|1460218_1460533_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|1460617_1460776_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|1460756_1460945_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_004018134.1|1461414_1461834_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_001405209.1|1461830_1462181_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	4.7e-40
WP_020833632.1|1462211_1463825_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	5.0e-177
WP_001253476.1|1464315_1464600_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_020899486.1|1464646_1464940_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	93.8	4.8e-46
WP_001214777.1|1464950_1465121_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_020899487.1|1465117_1465708_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	73.9	1.7e-74
WP_020899488.1|1465874_1466525_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	68.4	4.5e-52
WP_000161224.1|1466526_1466745_+	DUF4014 domain-containing protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000208144.1|1466748_1467141_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	59.5	1.0e-38
WP_001682408.1|1467227_1467905_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1467904_1468252_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1468271_1469843_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_046072967.1|1469880_1470405_+	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	97.0	8.6e-94
WP_020899490.1|1470397_1470682_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	1.7e-48
WP_024143053.1|1470752_1471382_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	94.3	4.0e-114
WP_000051898.1|1471611_1472775_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_000893231.1|1472980_1474231_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|1474242_1475346_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|1475628_1476681_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
1485896:1485912	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 106
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1485801	1486380	4863143		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284051.1|1485801_1486380_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 107
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1503825	1509110	4863143		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_106746824.1|1503825_1504704_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.8	2.3e-27
WP_000932531.1|1504758_1505022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272656.1|1505015_1509110_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.5	2.3e-24
>prophage 108
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1520546	1576468	4863143	transposase,tRNA,plate	Salmonella_phage(20.0%)	48	NA	NA
WP_000118732.1|1520546_1521890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007106.1|1521893_1522430_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119443.1|1522496_1522982_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|1523124_1523508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|1523492_1523978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|1524282_1524768_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014344502.1|1525021_1525354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013881.1|1525653_1527162_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996817.1|1527185_1527728_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000449778.1|1527827_1530467_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000806681.1|1530834_1531737_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750535.1|1531723_1532548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|1532544_1533039_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|1533054_1534938_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|1534934_1535930_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|1535940_1536996_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|1537527_1538259_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|1538322_1538790_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|1538786_1539509_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058804905.1|1539543_1540299_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|1540370_1541738_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207224.1|1541793_1542564_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230968.1|1542641_1543442_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127538.1|1543573_1544749_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|1544853_1545768_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154871.1|1545788_1546592_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_001051726.1|1552847_1553414_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|1553603_1554635_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|1554627_1555281_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|1555319_1556135_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|1556253_1556658_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093986.1|1556654_1557362_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|1557472_1559191_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252573.1|1559264_1559966_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560527.1|1559997_1560420_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|1560416_1560962_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000955207.1|1561141_1561360_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000608644.1|1561570_1562833_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|1563156_1564302_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_105612040.1|1564390_1564639_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210056.1|1564722_1566015_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|1566077_1566467_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021054.1|1566522_1568664_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_020899493.1|1568739_1570503_-	chitinase	NA	NA	NA	NA	NA
WP_000502119.1|1570741_1571200_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000055753.1|1571393_1572353_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294826.1|1572365_1575848_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569412.1|1575871_1576468_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
>prophage 109
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1585282	1586041	4863143		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000947413.1|1585282_1586041_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	1.9e-25
>prophage 110
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1599476	1600904	4863143	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753958.1|1599476_1600904_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	4.2e-26
>prophage 111
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1604887	1605232	4863143		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|1604887_1605232_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 112
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1618612	1619410	4863143		Planktothrix_phage(100.0%)	1	NA	NA
WP_001157204.1|1618612_1619410_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
>prophage 113
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1624603	1627078	4863143		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000938517.1|1624603_1627078_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	5.6e-34
>prophage 114
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1630094	1631513	4863143		unidentified_phage(100.0%)	1	NA	NA
WP_000174614.1|1630094_1631513_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.8	1.1e-26
>prophage 115
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1642278	1651982	4863143		Anomala_cuprea_entomopoxvirus(25.0%)	9	NA	NA
WP_000150619.1|1642278_1643205_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	5.9e-21
WP_000651591.1|1643313_1643976_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683342.1|1644033_1644570_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.0e-17
WP_000829731.1|1644775_1647166_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000946047.1|1647243_1648854_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
WP_000846613.1|1649055_1649403_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000829968.1|1649509_1650370_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734276.1|1650390_1651185_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000678254.1|1651214_1651982_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	1.7e-29
>prophage 116
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1662954	1664379	4863143		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001519338.1|1662954_1664379_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 117
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1675468	1676032	4863143		Sphingobium_phage(100.0%)	1	NA	NA
WP_000936329.1|1675468_1676032_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
>prophage 118
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1680289	1681333	4863143		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217365.1|1680289_1681333_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.2	3.4e-102
>prophage 119
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1711648	1713220	4863143		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082819.1|1711648_1713220_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.1	6.9e-06
>prophage 120
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1721269	1721977	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000915965.1|1721269_1721977_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.3	8.2e-23
>prophage 121
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1729953	1735385	4863143		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_000035723.1|1729953_1732305_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.5	2.5e-15
WP_001116976.1|1732478_1735385_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.9e-21
>prophage 122
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1743114	1749428	4863143		Enterococcus_phage(33.33%)	5	NA	NA
WP_000257211.1|1743114_1743963_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	47.8	5.8e-07
WP_000624379.1|1744068_1744548_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
WP_000377155.1|1744746_1746609_-	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_000600709.1|1746601_1747132_-	glutathione-regulated potassium-efflux system oxidoreductase KefF	NA	NA	NA	NA	NA
WP_000066317.1|1747538_1749428_-	sulfatase	NA	A0A1V0SA98	Catovirus	24.7	5.0e-27
>prophage 123
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1757183	1762823	4863143		Vibrio_phage(50.0%)	4	NA	NA
WP_000787073.1|1757183_1758701_+	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	22.2	1.4e-08
WP_000347134.1|1758735_1759878_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001016212.1|1759989_1761207_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000355806.1|1761269_1762823_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	24.4	9.8e-29
>prophage 124
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1768358	1769507	4863143		Halovirus(100.0%)	1	NA	NA
WP_000597287.1|1768358_1769507_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.1	2.0e-50
>prophage 125
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1778074	1779337	4863143	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_000608644.1|1778074_1779337_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 126
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1791779	1794614	4863143	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001670710.1|1791779_1794614_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	6.5e-79
>prophage 127
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1801112	1802279	4863143		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000681340.1|1801112_1802279_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	7.5e-90
>prophage 128
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1806844	1808338	4863143		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000831880.1|1806844_1808338_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	30.6	9.1e-32
>prophage 129
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1828501	1840803	4863143		Plodia_interpunctella_granulovirus(20.0%)	12	NA	NA
WP_000235798.1|1828501_1830601_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.5	9.5e-35
WP_000860682.1|1830981_1831425_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001068132.1|1831441_1831975_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	1.2e-53
WP_000026889.1|1832035_1832380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534902.1|1832506_1833454_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001119009.1|1833733_1834873_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.2e-29
WP_000516125.1|1834958_1836875_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.1	1.2e-148
WP_001258094.1|1837222_1837627_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001103477.1|1837662_1838376_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528527.1|1838525_1839092_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_000380372.1|1839148_1839739_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130175.1|1839849_1840803_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
>prophage 130
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1859553	1860978	4863143		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001219526.1|1859553_1860978_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	7.9e-09
>prophage 131
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1864927	1870091	4863143		Bacillus_phage(33.33%)	3	NA	NA
WP_000373268.1|1864927_1866865_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	1.8e-11
WP_000046770.1|1867073_1868741_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.7	1.7e-42
WP_000093829.1|1868858_1870091_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	6.7e-89
>prophage 132
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1882243	1883566	4863143		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477838.1|1882243_1883566_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.4	1.8e-79
>prophage 133
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1889113	1892012	4863143		Salmonella_phage(50.0%)	3	NA	NA
WP_000490276.1|1889113_1889275_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
WP_000178963.1|1889403_1890021_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175965.1|1890422_1892012_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	3.1e-30
>prophage 134
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1895789	1896854	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000211207.1|1895789_1896854_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.1	4.2e-15
>prophage 135
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1901828	1903108	4863143		Salmonella_phage(50.0%)	2	NA	NA
WP_000098578.1|1901828_1902368_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	2.2e-28
WP_000799924.1|1902370_1903108_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.2e-64
>prophage 136
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1907362	1908424	4863143		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_000075429.1|1907362_1908424_-	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	23.8	2.7e-09
>prophage 137
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1914156	1915818	4863143		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919519.1|1914156_1915818_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 138
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1921631	1925141	4863143		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001043484.1|1921631_1925141_+	type I restriction-modification system endonuclease	NA	S0A182	Cellulophaga_phage	34.8	1.1e-06
>prophage 139
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1962637	1963729	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001526178.1|1962637_1963729_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	27.3	1.8e-05
>prophage 140
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1975111	1976131	4863143		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000152563.1|1975111_1976131_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-42
>prophage 141
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	1983940	1988887	4863143	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397158.1|1983940_1985452_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	8.3e-49
WP_000207090.1|1985549_1986032_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416329.1|1986031_1988887_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	3.5e-141
>prophage 142
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2000994	2007543	4863143	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	7	NA	NA
WP_000013055.1|2000994_2001930_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.2	6.5e-52
WP_000148570.1|2001942_2002404_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047544.1|2002480_2002867_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000252550.1|2002941_2003388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001738655.1|2003503_2006212_-	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.6	5.9e-45
WP_105789234.1|2006352_2006451_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_020899502.1|2006595_2007543_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.2	1.3e-12
>prophage 143
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2011208	2014452	4863143		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000187818.1|2011208_2013347_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	1.5e-266
WP_001268859.1|2013467_2013932_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	55.8	4.6e-51
WP_000220578.1|2013935_2014220_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	70.2	8.6e-32
WP_000212724.1|2014209_2014452_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	51.2	5.6e-16
>prophage 144
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2049406	2051162	4863143		Klosneuvirus(50.0%)	2	NA	NA
WP_000853764.1|2049406_2050405_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
WP_000055079.1|2050631_2051162_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 145
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2067089	2067548	4863143	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|2067089_2067548_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 146
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2087084	2088248	4863143		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943932.1|2087084_2088248_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.0	2.0e-82
>prophage 147
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2093111	2097518	4863143		Lactococcus_phage(50.0%)	3	NA	NA
WP_000076357.1|2093111_2095550_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
WP_001177632.1|2095587_2096013_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527972.1|2096219_2097518_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	4.9e-66
>prophage 148
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2103063	2106249	4863143		Wolbachia_phage(50.0%)	2	NA	NA
WP_001122537.1|2103063_2104920_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.8	5.8e-60
WP_020899506.1|2104929_2106249_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	28.8	6.9e-15
>prophage 149
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2111269	2111815	4863143		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001271546.1|2111269_2111815_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 150
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2119539	2120517	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000004794.1|2119539_2120517_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	1.7e-26
>prophage 151
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2124244	2124778	4863143		Morganella_phage(100.0%)	1	NA	NA
WP_001238396.1|2124244_2124778_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	9.4e-48
>prophage 152
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2129854	2131838	4863143		Vibrio_phage(50.0%)	2	NA	NA
WP_000729126.1|2129854_2131501_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	1.2e-189
WP_000027827.1|2131544_2131838_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 153
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2149516	2154021	4863143		Escherichia_phage(100.0%)	4	NA	NA
WP_072100297.1|2149516_2150170_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	71.9	1.1e-79
WP_000544929.1|2150185_2150959_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	79.8	4.6e-104
WP_000816143.1|2150951_2151578_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	92.3	2.9e-120
WP_000403482.1|2151591_2154021_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	81.4	0.0e+00
>prophage 154
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2172191	2180551	4863143		Bacillus_phage(25.0%)	8	NA	NA
WP_001212189.1|2172191_2173262_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	25.3	6.0e-09
WP_000844399.1|2173269_2173359_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_000919710.1|2173428_2174931_-	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.5e-55
WP_000056482.1|2175398_2175734_+	phnA family protein	NA	NA	NA	NA	NA
WP_001131299.1|2175853_2176297_+	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_000602438.1|2176418_2176883_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_000457024.1|2177140_2178049_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	36.6	1.7e-33
WP_077248277.1|2178403_2180551_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.5	1.3e-31
>prophage 155
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2190228	2192187	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000083882.1|2190228_2192187_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	2.2e-89
>prophage 156
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2198405	2199755	4863143		Moraxella_phage(100.0%)	1	NA	NA
WP_000106907.1|2198405_2199755_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	6.7e-159
>prophage 157
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2204641	2206708	4863143		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000358566.1|2204641_2206708_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	6.3e-15
>prophage 158
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2229084	2232688	4863143		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168322.1|2229084_2229615_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357724.1|2229862_2232688_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	0.0e+00
>prophage 159
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2236783	2287986	4863143	tail,tRNA,plate	Burkholderia_phage(34.78%)	54	NA	NA
WP_001147297.1|2236783_2237863_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|2237894_2239310_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|2239374_2240358_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|2240532_2240775_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182237.1|2240942_2241941_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|2242028_2243339_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|2243585_2244101_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|2244199_2244409_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|2244430_2244544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|2244540_2245866_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|2246044_2246653_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|2246761_2247130_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|2247300_2249721_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|2249819_2250692_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|2250705_2251203_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|2251383_2252301_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|2252464_2253823_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|2253911_2255021_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|2255382_2256573_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|2256704_2258249_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|2258263_2259154_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|2259319_2259730_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|2259872_2261969_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|2261968_2262706_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|2262702_2263371_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|2263404_2263647_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|2264090_2265740_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|2266084_2267434_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|2267566_2267914_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|2268489_2268777_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|2268779_2269385_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|2269397_2269712_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|2269871_2270327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058804894.1|2270323_2270521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020899514.1|2270510_2271938_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907494.1|2271937_2272462_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|2272513_2272831_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|2272790_2272919_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|2273015_2275370_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|2275369_2276323_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|2276322_2276532_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|2276519_2277563_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|2277572_2278295_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|2278622_2278985_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|2278981_2279911_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|2279910_2281458_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|2281621_2281981_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|2281971_2283087_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|2283079_2283712_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|2283714_2285460_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|2285464_2286070_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|2286066_2286522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|2286770_2287061_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|2287257_2287986_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 160
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2293881	2297565	4863143		Dickeya_phage(100.0%)	1	NA	NA
WP_000095958.1|2293881_2297565_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 161
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2311812	2313402	4863143		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187509.1|2311812_2313402_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	6.5e-68
>prophage 162
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2318882	2320645	4863143		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|2318882_2319155_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_000940092.1|2319341_2319932_-	YjaG family protein	NA	NA	NA	NA	NA
WP_020899516.1|2319973_2320645_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.8e-20
>prophage 163
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2329503	2339956	4863143		Salmonella_phage(33.33%)	6	NA	NA
WP_000400600.1|2329503_2330532_-	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.5	5.2e-103
WP_016699425.1|2330597_2330801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989089.1|2330912_2331257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576436.1|2331262_2331586_-	membrane protein	NA	NA	NA	NA	NA
WP_000653965.1|2331627_2335851_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_000263105.1|2335927_2339956_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 164
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2344076	2347170	4863143		Tupanvirus(50.0%)	3	NA	NA
WP_000031748.1|2344076_2345261_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_001541267.1|2345837_2346011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023069.1|2346219_2347170_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	6.0e-29
>prophage 165
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2355909	2357754	4863143		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591398.1|2355909_2357754_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
>prophage 166
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2378871	2382046	4863143		Hokovirus(50.0%)	2	NA	NA
WP_001128495.1|2378871_2381373_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	3.6e-12
WP_000424866.1|2381383_2382046_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
>prophage 167
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2405382	2409993	4863143		Erwinia_phage(50.0%)	5	NA	NA
WP_001293360.1|2405382_2406714_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|2406780_2407710_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|2407802_2408288_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|2408509_2408749_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|2409147_2409993_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
>prophage 168
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2420827	2422363	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001167250.1|2420827_2422363_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
>prophage 169
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2435419	2439325	4863143		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033731.1|2435419_2436118_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|2436114_2437488_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133444.1|2437538_2437934_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_014343930.1|2437945_2438698_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122635.1|2438704_2439325_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
>prophage 170
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2458054	2461105	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_010989087.1|2458054_2461105_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
>prophage 171
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2469304	2472099	4863143		Escherichia_phage(50.0%)	3	NA	NA
WP_000059693.1|2469304_2470108_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	7.6e-25
WP_001520529.1|2470141_2471038_-	sugar kinase	NA	NA	NA	NA	NA
WP_000268253.1|2471202_2472099_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	100.0	1.5e-66
>prophage 172
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2490538	2491588	4863143		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_000146194.1|2490538_2491588_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	1.5e-09
>prophage 173
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2496945	2499732	4863143		Enterococcus_phage(100.0%)	1	NA	NA
WP_020899520.1|2496945_2499732_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.8	5.8e-48
>prophage 174
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2512037	2512652	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378902.1|2512037_2512652_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.5	1.8e-18
>prophage 175
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2523579	2527014	4863143		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000257554.1|2523579_2524359_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.5e-25
WP_000459612.1|2524361_2524910_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000508972.1|2524913_2525168_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187559.1|2525373_2527014_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.5	3.4e-40
>prophage 176
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2541266	2543096	4863143		Catovirus(100.0%)	1	NA	NA
WP_001526553.1|2541266_2543096_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.4e-81
>prophage 177
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2547968	2551885	4863143		Bacillus_phage(100.0%)	3	NA	NA
WP_000383441.1|2547968_2550131_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	3.5e-117
WP_001213560.1|2550266_2550983_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000132874.1|2550982_2551885_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	1.0e-25
>prophage 178
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2570878	2576382	4863143		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612078.1|2570878_2572009_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	40.9	3.3e-18
WP_001145156.1|2572013_2572691_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676080.1|2572668_2572893_-	sugar nucleotidyltransferase	NA	I7I009	Enterobacteria_phage	52.2	2.0e-07
WP_000822145.1|2572925_2573993_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.8e-98
WP_000011227.1|2573992_2575255_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.0	9.2e-25
WP_000866685.1|2575251_2576382_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	2.3e-27
>prophage 179
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2580506	2585909	4863143		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2580506_2580836_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047525.1|2580979_2582245_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	3.7e-42
WP_001089447.1|2582363_2583845_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238842.1|2583884_2585909_-	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	1.1e-112
>prophage 180
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2589348	2589690	4863143		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000560824.1|2589348_2589690_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.5	1.7e-05
>prophage 181
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2595052	2596699	4863143		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012570.1|2595052_2596699_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.2e-64
>prophage 182
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2612079	2616077	4863143		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000339359.1|2612079_2613585_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	5.1e-14
WP_000715944.1|2613592_2614012_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102338.1|2614208_2616077_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.5e-63
>prophage 183
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2619370	2620363	4863143		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845121.1|2619370_2620363_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.0	1.2e-48
>prophage 184
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2633247	2636636	4863143		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000934854.1|2633247_2634618_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.7	1.5e-36
WP_000334066.1|2634806_2636636_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	2.6e-129
>prophage 185
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2641045	2647937	4863143		Cyanophage(33.33%)	7	NA	NA
WP_000867130.1|2641045_2642086_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	36.2	4.1e-47
WP_000741630.1|2642221_2643181_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000212197.1|2643180_2644071_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063118.1|2644157_2644931_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	2.0e-14
WP_000377800.1|2644945_2645671_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000078081.1|2645765_2646431_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001519317.1|2646599_2647937_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.4e-63
>prophage 186
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2659248	2669039	4863143		Staphylococcus_phage(25.0%)	9	NA	NA
WP_001307474.1|2659248_2659506_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239725.1|2659469_2659829_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|2659845_2659986_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000059093.1|2660646_2662047_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673478.1|2662051_2663152_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000060085.1|2663299_2664373_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072047.1|2664401_2666816_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
WP_001054589.1|2666834_2667731_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001687378.1|2667845_2669039_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	2.1e-47
>prophage 187
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2673888	2687699	4863143		Oenococcus_phage(20.0%)	10	NA	NA
WP_000704735.1|2673888_2675037_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	8.0e-52
WP_000253524.1|2675121_2676459_+	MFS transporter	NA	NA	NA	NA	NA
WP_000106953.1|2676484_2679220_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	1.4e-33
WP_001202030.1|2679299_2680340_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001562512.1|2680312_2681005_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
WP_001230254.1|2681134_2682319_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_000790665.1|2682308_2684861_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	1.1e-72
WP_000595421.1|2684853_2685486_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000724476.1|2685675_2687076_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_000888528.1|2687081_2687699_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	4.8e-11
>prophage 188
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2695341	2696293	4863143		Cyanophage(50.0%)	2	NA	NA
WP_001532742.1|2695341_2695755_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
WP_001246919.1|2695864_2696293_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
>prophage 189
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2704797	2709754	4863143		Salmonella_phage(50.0%)	5	NA	NA
WP_000828740.1|2704797_2705982_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.8	1.1e-11
WP_001526328.1|2706184_2707045_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000117642.1|2707137_2707227_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001541152.1|2707860_2707959_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168439.1|2708065_2709754_+	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	4.2e-57
>prophage 190
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2728345	2729728	4863143		Pandoravirus(100.0%)	1	NA	NA
WP_001270489.1|2728345_2729728_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.1	1.2e-41
>prophage 191
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2738092	2744129	4863143	transposase	Sodalis_phage(33.33%)	4	NA	NA
WP_000749540.1|2738092_2739034_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	4.7e-66
WP_001682335.1|2739076_2739979_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000392694.1|2740487_2741183_+	MgtC family protein	NA	G3MA03	Bacillus_virus	42.4	2.8e-15
WP_000131288.1|2741402_2744129_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.1	1.2e-34
>prophage 192
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2748042	2759505	4863143	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_001143053.1|2748042_2750910_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	3.3e-94
WP_000984806.1|2750984_2751602_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000774139.1|2752900_2753938_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.4	7.2e-68
WP_105789235.1|2754025_2754109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989082.1|2754124_2754475_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001541628.1|2754471_2755662_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
WP_000120776.1|2756339_2756684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|2756889_2758461_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2758480_2758828_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|2758827_2759505_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 193
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2765734	2767126	4863143		environmental_Halophage(100.0%)	1	NA	NA
WP_000115428.1|2765734_2767126_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	6.7e-69
>prophage 194
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2772196	2777222	4863143		Bordetella_phage(33.33%)	4	NA	NA
WP_000280481.1|2772196_2774308_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|2774326_2774602_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000046969.1|2774656_2775280_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
WP_001241834.1|2775536_2777222_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	21.5	4.8e-21
>prophage 195
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2783200	2787754	4863143		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000717792.1|2783200_2783656_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.2e-48
WP_001541625.1|2783636_2784860_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.8	9.4e-43
WP_000380129.1|2785032_2785698_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_001519051.1|2785915_2786152_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|2786172_2786340_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114508.1|2786437_2787247_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.9	1.0e-24
WP_001171890.1|2787274_2787754_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.5e-28
>prophage 196
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2802130	2811832	4863143		Prochlorococcus_phage(16.67%)	9	NA	NA
WP_000587771.1|2802130_2803063_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
WP_001213790.1|2803265_2804462_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
WP_000645990.1|2804471_2805497_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000798206.1|2805990_2807025_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.1e-07
WP_001135518.1|2807011_2807974_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214132.1|2807977_2809261_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_000116576.1|2809270_2810815_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156179.1|2811062_2811494_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001273795.1|2811580_2811832_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 197
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2835682	2837533	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000582394.1|2835682_2837533_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	6.5e-11
>prophage 198
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2864016	2865012	4863143		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182588.1|2864016_2865012_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.8e-13
>prophage 199
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2868874	2878059	4863143	transposase	Macacine_betaherpesvirus(25.0%)	11	NA	NA
WP_001541099.1|2868874_2869066_+|transposase	transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	69.8	1.5e-19
WP_000702452.1|2869237_2869705_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000965886.1|2869882_2870170_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000533909.1|2870157_2870643_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000047149.1|2871014_2871554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014594.1|2871727_2871940_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_000455790.1|2872228_2872519_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_000190524.1|2872957_2873668_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_000804674.1|2873717_2874692_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.1	5.4e-17
WP_000747548.1|2874910_2875573_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_000148453.1|2875725_2878059_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.4	9.8e-73
>prophage 200
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2896055	2898049	4863143		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196509.1|2896055_2897039_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	3.3e-14
WP_000103563.1|2897035_2898049_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	9.6e-17
>prophage 201
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2926778	2931477	4863143	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000968867.1|2926778_2927681_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.5	3.4e-05
WP_000381395.1|2928861_2930433_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2930452_2930800_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|2930799_2931477_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
>prophage 202
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2945103	2947146	4863143		Indivirus(100.0%)	1	NA	NA
WP_000184178.1|2945103_2947146_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	3.6e-47
>prophage 203
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2955389	2958131	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000202926.1|2955389_2958131_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	4.6e-21
>prophage 204
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2963499	2975162	4863143		Dickeya_phage(28.57%)	12	NA	NA
WP_000187489.1|2963499_2964165_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	1.3e-57
WP_001541054.1|2964334_2964580_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_000789683.1|2964603_2966247_-	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.5e-14
WP_000106641.1|2966446_2968645_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.0	8.5e-111
WP_000964735.1|2968725_2969352_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	64.6	3.8e-32
WP_000042853.1|2969493_2969865_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_001575094.1|2969886_2970159_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_000743277.1|2970145_2970742_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_001118686.1|2970867_2972343_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000617729.1|2972345_2973014_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.9e-13
WP_001081707.1|2973006_2974062_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000159621.1|2974307_2975162_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
>prophage 205
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2980952	2983153	4863143		Anomala_cuprea_entomopoxvirus(33.33%)	4	NA	NA
WP_000082083.1|2980952_2981720_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.4	7.5e-14
WP_000416114.1|2981721_2982435_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.7	3.7e-15
WP_000481005.1|2982560_2982788_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001521773.1|2982784_2983153_+	type II toxin-antitoxin system death-on-curing family toxin	NA	E4ZFM2	Streptococcus_phage	30.1	1.9e-07
>prophage 206
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	2986522	2988330	4863143		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907838.1|2986522_2987593_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
WP_000073548.1|2987589_2988330_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.4e-09
>prophage 207
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3009728	3012176	4863143		Dickeya_phage(100.0%)	1	NA	NA
WP_000993428.1|3009728_3012176_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 208
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3026410	3029726	4863143		Halovirus(50.0%)	2	NA	NA
WP_020899525.1|3026410_3027964_+	TROVE domain-containing protein	NA	R4TL80	Halovirus	25.5	5.8e-29
WP_001105521.1|3028511_3029726_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.6	9.4e-136
>prophage 209
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3034782	3037176	4863143		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000082246.1|3034782_3037176_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 210
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3043236	3044151	4863143	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000235945.1|3043236_3044151_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.5	3.7e-68
>prophage 211
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3050763	3054526	4863143		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3050763_3051483_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253818.1|3051479_3052832_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.9	9.5e-12
WP_001265689.1|3052906_3054526_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.3	1.2e-141
>prophage 212
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3071565	3072402	4863143		Vibrio_phage(100.0%)	1	NA	NA
WP_000742132.1|3071565_3072402_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.7	1.9e-66
>prophage 213
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3075473	3075932	4863143	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|3075473_3075932_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 214
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3090745	3094742	4863143		Acinetobacter_phage(50.0%)	3	NA	NA
WP_020899531.1|3090745_3091309_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	3.2e-62
WP_000190023.1|3091394_3092612_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000269311.1|3092654_3094742_-	membrane protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
>prophage 215
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3099328	3101236	4863143		Tupanvirus(100.0%)	1	NA	NA
WP_000634766.1|3099328_3101236_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.7	6.5e-75
>prophage 216
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3107196	3112767	4863143		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001268010.1|3107196_3107583_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	1.8e-19
WP_000820704.1|3107582_3107939_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903400.1|3107946_3108234_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3108359_3108734_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138042.1|3108829_3109300_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124693.1|3109396_3111511_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
WP_000031748.1|3111582_3112767_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
>prophage 217
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3132660	3136980	4863143	tRNA	Prochlorococcus_phage(33.33%)	6	NA	NA
WP_001285165.1|3132660_3133608_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|3133623_3134133_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_000124529.1|3134264_3135389_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|3135360_3135834_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|3135860_3136403_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063609.1|3136407_3136980_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
>prophage 218
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3151001	3154383	4863143		Bacillus_virus(50.0%)	3	NA	NA
WP_001145331.1|3151001_3153101_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
WP_000620015.1|3153251_3153416_-	DUF2556 domain-containing protein	NA	NA	NA	NA	NA
WP_000642611.1|3153498_3154383_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
>prophage 219
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3166467	3167511	4863143		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3166467_3167511_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 220
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3185962	3187231	4863143		Oenococcus_phage(100.0%)	1	NA	NA
WP_000433394.1|3185962_3187231_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	2.6e-59
>prophage 221
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3194245	3195613	4863143	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000716693.1|3194245_3195613_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.5e-20
>prophage 222
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3200482	3204517	4863143	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366112.1|3200482_3200983_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000382926.1|3201091_3201883_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001029667.1|3202017_3202911_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108071.1|3203026_3204517_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	21.9	2.7e-07
>prophage 223
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3209308	3210412	4863143		Salmonella_phage(100.0%)	1	NA	NA
WP_000184315.1|3209308_3210412_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.1	1.9e-74
>prophage 224
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3217178	3232084	4863143		Staphylococcus_phage(28.57%)	17	NA	NA
WP_020837073.1|3217178_3218108_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	1.5e-16
WP_000809815.1|3218201_3220538_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	6.0e-38
WP_000719822.1|3220764_3221418_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000044652.1|3221414_3222143_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000602196.1|3222217_3222850_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216797.1|3223098_3223371_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243749.1|3223367_3224222_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000609332.1|3224267_3224759_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176589.1|3224876_3225164_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000809020.1|3225186_3226620_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224104.1|3226667_3227393_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_000669770.1|3227399_3227954_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000047845.1|3227922_3228498_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030021.1|3228494_3229061_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.3	2.7e-53
WP_000018617.1|3229081_3230068_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	1.1e-38
WP_000922736.1|3230081_3231059_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000531566.1|3231271_3232084_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.2	9.7e-20
>prophage 225
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3236192	3237683	4863143		Vibrio_phage(50.0%)	2	NA	NA
WP_000444168.1|3236192_3236480_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.7	3.5e-17
WP_001047354.1|3236711_3237683_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	7.8e-08
>prophage 226
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3244406	3247294	4863143	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107481.1|3244406_3246341_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
WP_000764711.1|3246445_3247294_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
>prophage 227
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3250764	3257421	4863143		Dickeya_phage(50.0%)	4	NA	NA
WP_000207654.1|3250764_3252108_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	3.1e-63
WP_000105461.1|3252735_3253188_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031038.1|3253215_3254718_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133064.1|3254742_3257421_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	1.9e-24
>prophage 228
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3262956	3264846	4863143		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000807248.1|3262956_3264846_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 229
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3271982	3278631	4863143		Invertebrate_iridovirus(25.0%)	9	NA	NA
WP_000928379.1|3271982_3272300_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	8.4e-12
WP_000380404.1|3272337_3272781_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037599.1|3272760_3273279_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.2	9.0e-11
WP_001521094.1|3273409_3274045_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000643280.1|3274111_3274687_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000893481.1|3274696_3275287_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000057285.1|3275308_3275704_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249229.1|3275661_3277704_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000812288.1|3277767_3278631_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.3	9.6e-50
>prophage 230
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3294675	3295821	4863143		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706459.1|3294675_3295821_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	2.0e-47
>prophage 231
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3302304	3304599	4863143		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000867323.1|3302304_3304599_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	5.7e-158
>prophage 232
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3317785	3318754	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001098833.1|3317785_3318754_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
>prophage 233
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3324946	3341810	4863143	tRNA	Klosneuvirus(14.29%)	14	NA	NA
WP_122815345.1|3324946_3326377_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.0e-32
WP_000094651.1|3326755_3328276_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	48.5	6.4e-33
WP_000478472.1|3328663_3330229_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
WP_000983441.1|3330225_3330873_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|3331104_3331872_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000237776.1|3332152_3332659_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|3332782_3334630_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|3334779_3336525_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|3336760_3336976_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264394.1|3337203_3338217_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001272784.1|3338467_3339079_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000355776.1|3339185_3339545_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001281933.1|3339642_3340464_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000708443.1|3340568_3341810_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.7	5.5e-91
>prophage 234
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3347038	3348472	4863143		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000867682.1|3347038_3348472_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.0	8.8e-40
>prophage 235
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3353875	3354529	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076978.1|3353875_3354529_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
>prophage 236
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3360285	3362126	4863143		Ralstonia_phage(50.0%)	2	NA	NA
WP_000442833.1|3360285_3361449_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	1.4e-88
WP_000831528.1|3361454_3362126_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.9	5.7e-34
>prophage 237
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3366526	3368419	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000195318.1|3366526_3368419_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	5.3e-93
>prophage 238
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3371734	3375434	4863143		Stx_converting_phage(50.0%)	3	NA	NA
WP_000731552.1|3371734_3372127_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	1.6e-20
WP_000998789.1|3372198_3373065_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001281908.1|3373175_3375434_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.7	2.0e-86
>prophage 239
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3381271	3386976	4863143		Pseudomonas_phage(33.33%)	5	NA	NA
WP_001274458.1|3381271_3383443_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.8	2.0e-104
WP_000525382.1|3383645_3383840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128242.1|3383997_3384453_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.8	2.4e-20
WP_000818493.1|3384497_3385952_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000013100.1|3386148_3386976_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	8.6e-64
>prophage 240
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3392917	3398058	4863143		Diadromus_pulchellus_ascovirus(50.0%)	6	NA	NA
WP_000019032.1|3392917_3393802_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	48.2	1.5e-66
WP_000665657.1|3393925_3394330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936444.1|3394316_3394727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433046.1|3394818_3395334_+	RNA helicase	NA	NA	NA	NA	NA
WP_000439335.1|3395613_3396108_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_001238434.1|3396414_3398058_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.1e-09
>prophage 241
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3413486	3414959	4863143		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000437132.1|3413486_3414959_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	7.9e-44
>prophage 242
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3418358	3419237	4863143		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001137806.1|3418358_3419237_+	carbon-nitrogen hydrolase family protein	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	27.9	6.0e-07
>prophage 243
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3441143	3442229	4863143		Geobacillus_virus(100.0%)	1	NA	NA
WP_000976289.1|3441143_3442229_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 244
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3459535	3460690	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062140.1|3459535_3460690_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
>prophage 245
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3466535	3468008	4863143		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000379524.1|3466535_3468008_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.0	2.0e-47
>prophage 246
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3476024	3476681	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_020837077.1|3476024_3476681_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	5.6e-10
>prophage 247
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3487862	3489095	4863143		Catovirus(100.0%)	1	NA	NA
WP_001151627.1|3487862_3489095_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.9	1.8e-102
>prophage 248
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3497363	3503067	4863143		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_020837078.1|3497363_3500237_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.2	4.1e-262
WP_001520239.1|3500462_3500609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819369.1|3500692_3501586_+	transporter	NA	NA	NA	NA	NA
WP_001230141.1|3501633_3503067_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.2	8.8e-32
>prophage 249
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3507052	3521267	4863143	transposase,tRNA	Stx2-converting_phage(33.33%)	17	NA	NA
WP_000434302.1|3507052_3507949_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	1.4e-30
WP_000745625.1|3507972_3508686_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813394.1|3508691_3510425_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	8.1e-64
WP_010989230.1|3510529_3511627_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003339.1|3511637_3513155_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_000133994.1|3513230_3513776_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244329.1|3514040_3514799_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_010989071.1|3515083_3515890_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_001540858.1|3516164_3516416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557549.1|3516592_3516820_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911336.1|3516819_3517218_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_143182491.1|3517593_3517680_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001682408.1|3517656_3518334_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3518333_3518681_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3518700_3520272_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001526599.1|3520500_3520686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038506.1|3520730_3521267_+	porin family protein	NA	A5LH44	Enterobacteria_phage	30.7	4.3e-16
>prophage 250
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3536027	3538561	4863143		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000602490.1|3536027_3536789_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	7.7e-19
WP_000253650.1|3537142_3538561_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	3.5e-25
>prophage 251
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3549391	3556346	4863143		Moraxella_phage(33.33%)	6	NA	NA
WP_000895635.1|3549391_3550105_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	6.9e-46
WP_001274930.1|3550286_3550982_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564481.1|3551664_3552195_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957887.1|3552207_3554454_+	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	25.7	2.1e-11
WP_000204645.1|3554669_3555545_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816247.1|3555551_3556346_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	2.6e-118
>prophage 252
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3561828	3578407	4863143	tRNA	Klosneuvirus(16.67%)	10	NA	NA
WP_001138254.1|3561828_3564717_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	1.1e-62
WP_001000527.1|3564709_3568255_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.6	1.4e-09
WP_000155129.1|3568251_3570087_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.0	5.4e-18
WP_000588964.1|3570189_3571521_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000011919.1|3571753_3573007_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.9	1.9e-14
WP_000678626.1|3573506_3574604_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117748.1|3574713_3575520_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	6.5e-16
WP_014343890.1|3575571_3576459_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_020837082.1|3576758_3577202_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000991053.1|3577201_3578407_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.2e-71
>prophage 253
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3589949	3590765	4863143		Bacillus_phage(100.0%)	1	NA	NA
WP_000881444.1|3589949_3590765_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	9.2e-10
>prophage 254
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3595632	3596481	4863143		Vibrio_phage(100.0%)	1	NA	NA
WP_000100474.1|3595632_3596481_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 255
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3603900	3609196	4863143		Streptococcus_phage(33.33%)	3	NA	NA
WP_000706479.1|3603900_3605043_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.0	2.0e-47
WP_000186400.1|3605086_3607843_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.0e-52
WP_000046849.1|3607900_3609196_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.0	1.4e-36
>prophage 256
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3613978	3617804	4863143		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000210863.1|3613978_3615616_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.2e-154
WP_000036734.1|3615698_3616997_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_001199961.1|3617132_3617804_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 257
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3639796	3641828	4863143		Hokovirus(50.0%)	2	NA	NA
WP_020837087.1|3639796_3641236_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.5	4.7e-33
WP_001173663.1|3641222_3641828_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.6	1.3e-29
>prophage 258
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3644938	3648249	4863143		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001221538.1|3644938_3645700_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.8	1.4e-57
WP_000253545.1|3645693_3646320_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	4.8e-35
WP_001272632.1|3646495_3647629_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_024138556.1|3647691_3648249_+	sigma-70 family RNA polymerase sigma factor	NA	F4YCU2	Synechococcus_phage	44.0	2.2e-23
>prophage 259
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3651589	3655365	4863143		Escherichia_phage(100.0%)	4	NA	NA
WP_000613185.1|3651589_3652354_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.5	1.1e-70
WP_000206958.1|3652550_3653474_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	77.4	1.7e-116
WP_000912488.1|3653467_3654730_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.8	1.7e-132
WP_000153636.1|3654726_3655365_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.8e-85
>prophage 260
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3661331	3665407	4863143		Catovirus(50.0%)	3	NA	NA
WP_001005807.1|3661331_3663899_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	1.9e-29
WP_000858988.1|3664057_3664579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420452.1|3664750_3665407_-	Serine/threonine-protein phosphatase 2	NA	Q71TJ1	Escherichia_phage	47.9	7.8e-52
>prophage 261
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3670892	3672581	4863143		Vibrio_phage(100.0%)	1	NA	NA
WP_000848113.1|3670892_3672581_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.8	3.9e-15
>prophage 262
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3706074	3706896	4863143		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000083153.1|3706074_3706896_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	3.1e-13
>prophage 263
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3730812	3731778	4863143		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001278201.1|3730812_3731778_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.5	4.0e-36
>prophage 264
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3737683	3745191	4863143	tRNA	Pseudomonas_phage(20.0%)	7	NA	NA
WP_000132239.1|3737683_3738181_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.6	4.4e-31
WP_000963150.1|3738265_3739327_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	3.0e-114
WP_001294864.1|3739443_3739944_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_001277278.1|3739940_3740147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020837094.1|3740179_3742810_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	2.7e-79
WP_000906486.1|3743044_3743230_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|3744624_3745191_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
>prophage 265
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3757027	3762082	4863143		Bacillus_virus(25.0%)	4	NA	NA
WP_000985529.1|3757027_3758230_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
WP_000777903.1|3758584_3759544_-	ribonucleoside-diphosphate reductase 2 subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	6.1e-130
WP_000246626.1|3759554_3761699_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.7	1.7e-196
WP_001275401.1|3761671_3762082_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	3.3e-16
>prophage 266
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3768580	3772584	4863143		Clostridium_phage(50.0%)	4	NA	NA
WP_000522406.1|3768580_3769030_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_000126152.1|3769051_3769729_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531282.1|3769770_3771171_-	GABA permease	NA	NA	NA	NA	NA
WP_001095556.1|3771300_3772584_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.1	6.0e-32
>prophage 267
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3792954	3803500	4863143	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_001111809.1|3792954_3796608_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	7.9e-45
WP_001221110.1|3796688_3797804_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001530982.1|3797908_3798091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190912.1|3798766_3799339_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000079794.1|3799430_3800951_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000388997.1|3801018_3801558_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_085983317.1|3802337_3803500_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
>prophage 268
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3808109	3808706	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_001682341.1|3808109_3808706_-	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
>prophage 269
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3825072	3825357	4863143		Vibrio_phage(100.0%)	1	NA	NA
WP_000749979.1|3825072_3825357_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
>prophage 270
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3828528	3830598	4863143		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001520307.1|3828528_3830598_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
>prophage 271
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3834684	3835930	4863143	integrase	Escherichia_phage(100.0%)	2	3829244:3829257	3836699:3836712
3829244:3829257	attL	TCGCTGGGGATTTG	NA	NA	NA	NA
WP_001542209.1|3834684_3834852_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|3834865_3835930_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
3836699:3836712	attR	CAAATCCCCAGCGA	NA	NA	NA	NA
>prophage 272
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3840258	3843814	4863143		Pseudomonas_phage(33.33%)	6	NA	NA
WP_020837114.1|3840258_3840729_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	35.1	8.1e-11
WP_001614356.1|3840996_3841815_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.2	9.7e-44
WP_001614358.1|3841934_3842168_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020837115.1|3842244_3842697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104018.1|3842756_3843299_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_000734138.1|3843361_3843814_-	hypothetical protein	NA	J7KKK1	Erwinia_phage	50.8	1.0e-34
>prophage 273
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3847098	3849228	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_020837120.1|3847098_3849228_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	28.0	1.2e-32
>prophage 274
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3856156	3864684	4863143	transposase,integrase	Stx2-converting_phage(60.0%)	7	3846393:3846406	3874897:3874910
3846393:3846406	attL	CCACCGACAGCGCC	NA	NA	NA	NA
WP_001682408.1|3856156_3856834_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3856833_3857181_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3857200_3858772_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_143182490.1|3858956_3859412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246228.1|3859474_3860716_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	2.4e-102
WP_010989057.1|3861332_3862496_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196159.1|3862503_3864684_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
3874897:3874910	attR	GGCGCTGTCGGTGG	NA	NA	NA	NA
>prophage 275
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3878242	3878725	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001518569.1|3878242_3878725_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 276
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3890492	3893734	4863143		Pseudomonas_phage(50.0%)	3	NA	NA
WP_001030985.1|3890492_3891713_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|3891705_3892224_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|3892663_3893734_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 277
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3900519	3903093	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235094.1|3900519_3903093_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
>prophage 278
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3908971	3910832	4863143		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000985653.1|3908971_3909427_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|3909530_3910832_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
>prophage 279
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3916133	3922304	4863143	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098732.1|3916133_3916553_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|3916756_3917794_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|3917909_3918599_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|3918917_3919301_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|3919362_3919950_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|3920052_3920952_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|3920969_3922304_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
>prophage 280
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3928144	3935990	4863143		Streptococcus_phage(25.0%)	9	NA	NA
WP_000790154.1|3928144_3929944_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|3929960_3930935_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|3931208_3931889_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|3931885_3932791_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|3932802_3933531_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|3933542_3934274_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|3934273_3934654_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|3934765_3935026_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|3935063_3935990_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
>prophage 281
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3944574	3954566	4863143		Bacillus_phage(50.0%)	6	NA	NA
WP_000970045.1|3944574_3948462_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001670672.1|3949111_3950542_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_001054236.1|3950543_3951308_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625591.1|3951304_3952642_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_000717694.1|3952718_3953057_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000856793.1|3953105_3954566_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
>prophage 282
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3961781	3963035	4863143		Aeromonas_phage(100.0%)	1	NA	NA
WP_000919178.1|3961781_3963035_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
>prophage 283
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3970454	3980599	4863143	tRNA	Heterosigma_akashiwo_virus(16.67%)	12	NA	NA
WP_000174944.1|3970454_3971333_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000553467.1|3971477_3972281_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000940032.1|3972399_3973131_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_001241346.1|3973290_3973785_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000775263.1|3973965_3975180_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_000331704.1|3975207_3975594_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000028952.1|3975622_3975946_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_000384396.1|3976141_3976657_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196669.1|3976669_3978520_+	Fe-S protein assembly chaperone HscA	NA	A0A167RF67	Powai_lake_megavirus	38.8	3.0e-101
WP_001124466.1|3978521_3978857_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523621.1|3978868_3979069_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133541.1|3979315_3980599_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	1.2e-35
>prophage 284
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	3991398	3996647	4863143		Escherichia_phage(66.67%)	5	NA	NA
WP_000508279.1|3991398_3993804_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	38.5	8.7e-141
WP_000077436.1|3993800_3994430_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	56.4	5.5e-63
WP_020837128.1|3994422_3995232_+	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
WP_000247788.1|3995231_3996095_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000963846.1|3996215_3996647_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	1.1e-17
>prophage 285
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4022975	4032266	4863143		Escherichia_phage(33.33%)	3	NA	NA
WP_071828614.1|4022975_4029128_+	fibronectin-binding autotransporter adhesin ShdA	NA	A0A2L1IV18	Escherichia_phage	24.8	2.6e-24
WP_000953165.1|4029289_4030639_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.6	4.4e-41
WP_000944174.1|4030799_4032266_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 286
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4035315	4035507	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_000075924.1|4035315_4035507_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	84.1	6.4e-23
>prophage 287
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4041969	4050562	4863143	protease	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_001028593.1|4041969_4042608_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	44.0	1.5e-31
WP_000130477.1|4042607_4043645_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.8	2.9e-69
WP_000706208.1|4044058_4044685_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198335.1|4044772_4046062_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.6	3.0e-63
WP_000100388.1|4046132_4046858_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000132648.1|4046884_4047244_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	45.6	1.1e-18
WP_000489630.1|4047283_4048747_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892056.1|4048954_4050022_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001520562.1|4050208_4050562_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.2	1.3e-13
>prophage 288
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4053900	4054614	4863143		Synechococcus_phage(100.0%)	1	NA	NA
WP_001171630.1|4053900_4054614_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.5	9.1e-38
>prophage 289
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4073237	4074188	4863143		Cyanophage(100.0%)	1	NA	NA
WP_001072448.1|4073237_4074188_-	transaldolase A	NA	A0A127KNC6	Cyanophage	30.3	8.2e-10
>prophage 290
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4094804	4104356	4863143		Paenibacillus_phage(20.0%)	11	NA	NA
WP_000102881.1|4094804_4095674_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
WP_014344511.1|4095775_4096312_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_020837133.1|4096298_4096748_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838976.1|4096809_4097385_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084583.1|4097479_4098379_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_000517460.1|4098616_4099408_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000290275.1|4099565_4100582_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000881745.1|4100581_4101415_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852705.1|4101414_4102290_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021076.1|4102279_4103377_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	32.7	2.1e-25
WP_001093886.1|4103444_4104356_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
>prophage 291
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4109387	4119237	4863143		Hokovirus(25.0%)	9	NA	NA
WP_000623114.1|4109387_4111115_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000487600.1|4111163_4111421_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000036904.1|4111804_4112776_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
WP_000255006.1|4112939_4113701_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000983126.1|4113932_4114919_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000433266.1|4114990_4117006_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	1.5e-146
WP_001519708.1|4117007_4117226_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_000765569.1|4117222_4118221_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001109831.1|4118310_4119237_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.4	2.0e-08
>prophage 292
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4140525	4141446	4863143		Morganella_phage(100.0%)	1	NA	NA
WP_000484423.1|4140525_4141446_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
>prophage 293
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4150258	4151200	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000377772.1|4150258_4151200_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
>prophage 294
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4160380	4161466	4863143		Pandoravirus(100.0%)	1	NA	NA
WP_000918456.1|4160380_4161466_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 295
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4168723	4169509	4863143		Campylobacter_virus(50.0%)	2	NA	NA
WP_000118256.1|4168723_4169092_-	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000433423.1|4169260_4169509_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	8.0e-18
>prophage 296
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4172515	4173652	4863143		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699178.1|4172515_4173652_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
>prophage 297
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4180153	4181671	4863143		Mollivirus(100.0%)	1	NA	NA
WP_000334204.1|4180153_4181671_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	6.3e-89
>prophage 298
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4193102	4193876	4863143		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293591.1|4193102_4193876_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-10
>prophage 299
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4197604	4198624	4863143		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000026949.1|4197604_4198624_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.7	3.2e-20
>prophage 300
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4209432	4212704	4863143		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_014343872.1|4209432_4210110_+	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	33.3	4.2e-08
WP_001012861.1|4210186_4212013_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813882.1|4212104_4212704_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 301
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4234362	4235364	4863143		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000368558.1|4234362_4235364_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.9	1.4e-28
>prophage 302
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4247931	4252940	4863143		Tupanvirus(50.0%)	4	NA	NA
WP_000648776.1|4247931_4249914_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.4	1.0e-22
WP_020837134.1|4249910_4250894_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.7	2.2e-34
WP_001279284.1|4250896_4252036_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.3	2.0e-31
WP_000879248.1|4252334_4252940_+	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	43.8	1.9e-12
>prophage 303
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4256587	4257793	4863143		Oenococcus_phage(100.0%)	1	NA	NA
WP_001521492.1|4256587_4257793_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	6.7e-25
>prophage 304
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4267406	4274607	4863143		Pseudomonas_phage(50.0%)	6	NA	NA
WP_000858952.1|4267406_4268477_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000176719.1|4268592_4269471_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000660244.1|4269632_4270823_+	MFS transporter	NA	NA	NA	NA	NA
WP_000533921.1|4270824_4271079_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
WP_000332026.1|4271078_4272209_-	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	8.7e-176
WP_001076487.1|4272321_4274607_-	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.1e-282
>prophage 305
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4278047	4285260	4863143		Oenococcus_phage(33.33%)	3	NA	NA
WP_000705579.1|4278047_4279250_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	36.3	3.5e-58
WP_001281271.1|4279659_4282296_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	4.3e-93
WP_000876078.1|4282413_4285260_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.4	4.1e-41
>prophage 306
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4289427	4338550	4863143	transposase,tail,holin,protease	Salmonella_phage(23.81%)	47	NA	NA
WP_000865526.1|4289427_4290564_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
WP_000784307.1|4290678_4291731_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000975956.1|4291811_4292873_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	58.0	1.4e-18
WP_000884990.1|4292875_4293526_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000421590.1|4293601_4295245_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	9.8e-11
WP_000781589.1|4295453_4295948_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|4296361_4296853_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|4296842_4297106_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|4297102_4299589_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|4299595_4300291_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|4300277_4301147_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|4301262_4301712_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|4301721_4302324_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000990028.1|4302957_4303617_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|4303668_4304406_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|4304402_4304615_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|4304611_4305091_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|4305087_4307019_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|4307015_4307573_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_020899389.1|4307569_4308613_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|4308656_4309304_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|4310033_4310597_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|4310788_4310992_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|4311294_4312086_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|4312382_4312586_+|tail	tail protein	tail	NA	NA	NA	NA
WP_000381395.1|4312808_4314380_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4314399_4314747_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|4314746_4315424_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_058804936.1|4315464_4317828_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.2	9.6e-68
WP_001202279.1|4318156_4319146_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|4319160_4319529_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|4319557_4320889_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|4321185_4321515_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|4322107_4323349_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|4323351_4323879_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|4324256_4324700_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|4326923_4327214_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|4327241_4327745_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000256150.1|4328025_4329786_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_001135904.1|4329817_4330045_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050806.1|4330224_4331232_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_000033440.1|4331259_4331880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000494192.1|4331988_4332273_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578121.1|4332397_4334158_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_001234836.1|4334309_4335005_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213347.1|4335032_4336223_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_000203622.1|4336960_4338550_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
>prophage 307
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4344474	4345047	4863143		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241015.1|4344474_4345047_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 308
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4355188	4356046	4863143		Catovirus(100.0%)	1	NA	NA
WP_000873909.1|4355188_4356046_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
>prophage 309
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4360063	4362865	4863143	transposase	Saccharomonospora_phage(50.0%)	2	NA	NA
WP_000502119.1|4360063_4360522_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_020899390.1|4360873_4362865_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 310
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4368304	4368973	4863143		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139611.1|4368304_4368973_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
>prophage 311
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4372932	4374453	4863143		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000535907.1|4372932_4374453_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
>prophage 312
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4400507	4409678	4863143	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|4400507_4401455_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|4401438_4402170_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|4402150_4402258_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|4402317_4403049_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|4403271_4404957_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|4404953_4405673_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|4405719_4406187_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|4406243_4406774_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|4406945_4407404_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|4407644_4409678_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 313
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4426874	4429733	4863143	tRNA	Salmonella_phage(50.0%)	2	NA	NA
WP_077248263.1|4426874_4427921_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	74.9	4.6e-147
WP_001517981.1|4428371_4429733_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
>prophage 314
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4434157	4440769	4863143		Bacillus_phage(66.67%)	4	NA	NA
WP_000137854.1|4434157_4434880_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
WP_000870070.1|4434876_4436280_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.7	3.6e-30
WP_000137816.1|4436279_4437692_-	MFS transporter	NA	NA	NA	NA	NA
WP_001210077.1|4437688_4440769_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.1	2.7e-62
>prophage 315
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4451217	4460517	4863143		Catovirus(25.0%)	7	NA	NA
WP_000132082.1|4451217_4451859_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
WP_020899395.1|4451949_4452531_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	4.6e-32
WP_001252270.1|4452569_4454426_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454713.1|4454511_4456092_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.1e-38
WP_000978077.1|4456766_4457906_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482224.1|4457911_4458361_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000136405.1|4458357_4460517_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	3.2e-17
>prophage 316
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4465692	4472398	4863143		Acanthocystis_turfacea_Chlorella_virus(25.0%)	6	NA	NA
WP_000048160.1|4465692_4466814_+	GDP-mannose 4,6-dehydratase	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	65.3	6.9e-133
WP_001041701.1|4466816_4467782_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	7.9e-85
WP_001526160.1|4467784_4468258_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699632.1|4468254_4469478_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000605938.1|4469474_4470917_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	7.2e-50
WP_000164218.1|4471027_4472398_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	3.4e-33
>prophage 317
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4477986	4489419	4863143		Enterobacteria_phage(33.33%)	11	NA	NA
WP_001111841.1|4477986_4479390_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|4479567_4480461_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|4480837_4481923_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|4481922_4482822_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|4482869_4483748_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|4483748_4484300_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|4484305_4485298_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|4485294_4486068_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|4486072_4487152_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|4487178_4488492_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000143399.1|4488519_4489419_+	CDP-abequose synthase	NA	K7QJG5	Escherichia_phage	22.2	2.1e-07
>prophage 318
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4494125	4495565	4863143		Hokovirus(100.0%)	1	NA	NA
WP_000009017.1|4494125_4495565_+	mannose-1-phosphate guanylyltransferase RfbM	NA	A0A1V0SH58	Hokovirus	31.1	7.4e-55
>prophage 319
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4498650	4501460	4863143		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000043530.1|4498650_4500057_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.5e-36
WP_000704831.1|4500293_4501460_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.2	4.1e-112
>prophage 320
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4508903	4509803	4863143		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000886603.1|4508903_4509803_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 321
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4518466	4523393	4863143		Escherichia_phage(66.67%)	4	NA	NA
WP_000028228.1|4518466_4520743_+	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	27.1	2.9e-37
WP_001016236.1|4520757_4521336_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.2	3.9e-23
WP_001092559.1|4521332_4522097_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000925042.1|4522220_4523393_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	6.2e-201
>prophage 322
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4543096	4543891	4863143		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000023.1|4543096_4543891_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.2	1.2e-11
>prophage 323
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4557403	4558219	4863143		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000881552.1|4557403_4558219_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	25.6	1.6e-09
>prophage 324
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4574486	4589675	4863143		Morganella_phage(20.0%)	17	NA	NA
WP_001219015.1|4574486_4574960_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|4575607_4575898_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|4576269_4577067_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|4577547_4577709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|4577835_4578255_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|4578257_4579526_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|4579980_4580193_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|4580203_4580392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|4580652_4581849_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|4582498_4582798_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|4582889_4583585_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|4583658_4585089_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000785978.1|4585069_4585540_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001212264.1|4585528_4586449_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000929134.1|4586624_4587536_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001178599.1|4587552_4587798_+	YodC family protein	NA	NA	NA	NA	NA
WP_001119821.1|4587962_4589675_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
>prophage 325
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4613224	4613683	4863143	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502119.1|4613224_4613683_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 326
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4618053	4618806	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_001273026.1|4618053_4618806_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	1.1e-25
>prophage 327
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4627066	4627732	4863143		Sphingomonas_phage(100.0%)	1	NA	NA
WP_000781520.1|4627066_4627732_+	YecA family protein	NA	H9NBT7	Sphingomonas_phage	62.1	1.5e-05
>prophage 328
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4643000	4647135	4863143		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000483274.1|4643000_4644662_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.0	9.9e-11
WP_000204362.1|4644815_4645682_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036392.1|4645678_4646728_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763861.1|4646745_4647135_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
>prophage 329
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4655087	4661647	4863143	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_001025361.1|4655087_4656821_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	3.7e-85
WP_000024794.1|4657057_4657627_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185770.1|4657646_4658393_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569041.1|4658628_4659600_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019609.1|4659596_4660340_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
WP_000252975.1|4660380_4660776_-	membrane protein	NA	NA	NA	NA	NA
WP_000639226.1|4660828_4661647_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	4.5e-57
>prophage 330
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4665668	4666190	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_000022509.1|4665668_4666190_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 331
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4669353	4674338	4863143		Bacillus_phage(33.33%)	5	NA	NA
WP_000568508.1|4669353_4670364_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.4	2.4e-07
WP_000571508.1|4670442_4671228_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203014.1|4671224_4671980_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	2.2e-18
WP_000939597.1|4672058_4673003_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184028.1|4673018_4674338_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
>prophage 332
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4678275	4679751	4863143		Cyanophage(100.0%)	1	NA	NA
WP_000301711.1|4678275_4679751_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 333
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4687647	4695942	4863143	tail,integrase	Klebsiella_phage(28.57%)	13	4691343:4691365	4701058:4701080
WP_000944282.1|4687647_4688346_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100258.1|4688369_4689026_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856224.1|4689133_4689364_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|4689501_4689876_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|4689876_4690752_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|4690768_4691122_+	YebY family protein	NA	NA	NA	NA	NA
4691343:4691365	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|4691495_4692350_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|4692409_4692904_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|4693093_4693324_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|4693377_4693911_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|4694167_4694335_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|4694399_4694588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|4695060_4695942_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
4701058:4701080	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 334
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4701214	4708728	4863143	integrase	Enterobacteria_phage(50.0%)	10	4698328:4698341	4706086:4706099
4698328:4698341	attL	AGCAATAATAATCA	NA	NA	NA	NA
WP_000684835.1|4701214_4701583_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001617922.1|4703046_4703187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|4703352_4703622_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001526544.1|4703668_4703863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|4703991_4704411_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|4704798_4705275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|4705604_4706000_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182072.1|4706682_4707405_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
4706086:4706099	attR	AGCAATAATAATCA	NA	NA	NA	NA
WP_001134856.1|4707689_4707854_+	membrane protein	NA	NA	NA	NA	NA
WP_000986176.1|4708077_4708728_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
>prophage 335
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4716234	4718283	4863143		Moraxella_phage(100.0%)	1	NA	NA
WP_001091237.1|4716234_4718283_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
>prophage 336
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4723660	4723870	4863143		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4723660_4723870_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 337
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4731356	4732916	4863143		Moraxella_phage(100.0%)	1	NA	NA
WP_000421815.1|4731356_4732916_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
>prophage 338
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4736886	4744198	4863143	tRNA	Pandoravirus(33.33%)	7	NA	NA
WP_000978464.1|4736886_4738251_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000457328.1|4738331_4738511_+	YoaH family protein	NA	NA	NA	NA	NA
WP_000029550.1|4738516_4738861_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128807.1|4738991_4740902_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_001221014.1|4740959_4741655_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290594.1|4741726_4742308_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_000758418.1|4742512_4744198_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
>prophage 339
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4778901	4781659	4863143		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001037181.1|4778901_4780587_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.9e-23
WP_001518537.1|4780711_4781659_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 340
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4785006	4790664	4863143		Pseudomonas_phage(33.33%)	7	NA	NA
WP_000804703.1|4785006_4786089_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
WP_000347310.1|4786088_4786922_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000150667.1|4786918_4787308_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257065.1|4787311_4788121_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811046.1|4788158_4789013_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	1.9e-45
WP_000148418.1|4789066_4790167_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146392.1|4790433_4790664_+	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	1.1e-05
>prophage 341
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4801003	4802539	4863143		Escherichia_phage(100.0%)	1	NA	NA
WP_000702625.1|4801003_4802539_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 342
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4807009	4813417	4863143		Synechococcus_phage(33.33%)	7	NA	NA
WP_001191156.1|4807009_4807852_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	7.5e-15
WP_001682412.1|4807902_4808361_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001230572.1|4808471_4809377_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193432.1|4809467_4810481_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000729450.1|4810683_4811592_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_001287383.1|4811723_4812137_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068097.1|4812799_4813417_+	thymidine kinase	NA	A0A023W530	Serratia_phage	54.2	2.7e-54
>prophage 343
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4821788	4824681	4863143		Planktothrix_phage(33.33%)	3	NA	NA
WP_000058857.1|4821788_4822796_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.3e-13
WP_000994696.1|4822792_4823797_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	29.1	8.1e-16
WP_000059074.1|4823844_4824681_+	voltage-gated potassium channel	NA	A0A1B0Y2S3	Lactobacillus_phage	42.4	1.0e-08
>prophage 344
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4836350	4839308	4863143		Acinetobacter_phage(100.0%)	2	NA	NA
WP_058804883.1|4836350_4837709_-	bifunctional indole-3-glycerol phosphate synthase/phosphoribosylanthranilate isomerase	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.0e-37
WP_000763492.1|4837712_4839308_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.8	4.5e-53
>prophage 345
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4844289	4849628	4863143	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559310.1|4844289_4845051_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	7.5e-06
WP_000422082.1|4845288_4846335_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	1.6e-19
WP_000548616.1|4846376_4846628_-	YciN family protein	NA	NA	NA	NA	NA
WP_000513593.1|4847030_4849628_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	2.4e-88
>prophage 346
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4854720	4855311	4863143		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|4854720_4855311_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 347
NZ_CP022062	Salmonella enterica strain FDAARGOS_312 chromosome, complete genome	4863143	4860895	4862878	4863143		Bacillus_virus(100.0%)	1	NA	NA
WP_024143038.1|4860895_4862878_-	cyclic di-GMP phosphodiesterase	NA	G3MA91	Bacillus_virus	32.1	1.3e-17
>prophage 1
NZ_CP022063	Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence	173817	24428	101860	173817	integrase,transposase	Stx2-converting_phage(18.75%)	44	12266:12282	40057:40073
12266:12282	attL	CAATATTCTTCTGCTGG	NA	NA	NA	NA
WP_000543934.1|24428_25439_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|25441_25978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000932880.1|25970_26258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833672.1|26276_26597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833670.1|27492_28353_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.9e-07
WP_020833669.1|28437_29925_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_020833668.1|30159_30459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833667.1|31116_32448_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_020833666.1|32475_33756_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_023994191.1|33748_35551_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.1	2.7e-22
WP_023994192.1|35537_37340_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	28.0	1.7e-32
WP_020833663.1|37707_38667_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_020833662.1|38857_44965_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9KZV5	Tupanvirus	28.2	3.4e-40
40057:40073	attR	CAATATTCTTCTGCTGG	NA	NA	NA	NA
WP_020833661.1|45052_54550_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_020833660.1|54546_55647_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_023994194.1|55643_56447_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_020833658.1|56450_58028_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	A0A2K9KZV5	Tupanvirus	22.8	2.0e-08
WP_020833657.1|58158_60180_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_020833656.1|60515_61304_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.2	2.8e-08
WP_024143068.1|61802_62060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833654.1|62944_64141_+	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	28.4	9.3e-27
WP_020833653.1|64254_65553_+	transporter	NA	NA	NA	NA	NA
WP_020833652.1|65581_66796_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110613438.1|66732_67032_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024143067.1|67091_67307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833650.1|68353_69181_+	streptomycin 3''-kinase	NA	NA	NA	NA	NA
WP_077914830.1|71152_71614_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	30.5	4.1e-07
WP_077914833.1|71579_71906_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	39.4	5.8e-16
WP_020833646.1|73460_74576_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001682408.1|75581_76259_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|76258_76606_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|76625_78197_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_020833643.1|79497_80256_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_143182492.1|80372_85052_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_038406196.1|85131_85530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744305.1|86108_86546_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_020833636.1|86674_87037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|90028_90733_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000988732.1|96688_97414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001337692.1|97527_97929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|98148_98388_-	permease	NA	NA	NA	NA	NA
WP_000268337.1|98460_98739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122923.1|98725_100453_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001300563.1|100747_101860_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
