The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	245502	311516	5332976	terminase,integrase,capsid,head,tail,tRNA,holin,portal,protease	Enterobacteria_phage(19.61%)	74	268233:268256	308542:308565
WP_002913226.1|245502_246315_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|246314_247328_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913228.1|247391_248528_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_004180772.1|248638_249616_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|249702_250878_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|251087_252308_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004180775.1|252466_254455_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|254516_254798_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|254829_255378_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|255377_256187_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|256186_257011_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_004180777.1|257013_258099_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	2.7e-89
WP_002913346.1|258140_259073_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|259240_259792_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|259812_260298_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004180780.1|260507_262652_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|262651_263962_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004180782.1|264121_264406_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_004149222.1|264773_266102_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|266163_266925_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|267214_268144_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
268233:268256	attL	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_061891448.1|268350_268722_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	4.9e-27
WP_004194318.1|268916_270401_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_088607436.1|270892_271513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088607437.1|271659_273861_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	7.5e-99
WP_088607438.1|273937_277015_-	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_032408661.1|277011_277392_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_004864228.1|277404_277881_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|277867_278341_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_032408660.1|278361_281751_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.6e-302
WP_016530182.1|281811_282045_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032408659.1|282118_282424_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_021313622.1|282426_282831_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_032408658.1|282861_283566_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_032408657.1|283622_283970_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	8.0e-32
WP_032408656.1|283966_284416_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	9.7e-62
WP_032408655.1|284412_284751_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_032408654.1|284759_285080_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_023302596.1|285076_285280_-	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_004884302.1|285318_286527_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	84.8	2.2e-193
WP_032408653.1|286541_287195_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	7.1e-106
WP_032408652.1|287181_288411_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.4	8.2e-204
WP_032408651.1|288410_288596_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_032408650.1|288606_290364_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	91.1	0.0e+00
WP_032408649.1|290363_290861_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
WP_004899645.1|291017_291368_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.2e-52
WP_004899648.1|291355_291589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004899651.1|291671_291875_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_004216876.1|291946_292192_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_004899656.1|292280_292472_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.6	2.9e-23
WP_032448071.1|292422_292698_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
WP_004899661.1|292700_293330_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	77.5	3.1e-90
WP_004899663.1|293329_293611_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	2.9e-32
WP_004213330.1|293597_293993_-	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_073970531.1|294756_295524_-	hypothetical protein	NA	A0A1B2I9V6	Erwinia_phage	75.1	3.4e-107
WP_061891348.1|296257_296836_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.1e-49
WP_061891349.1|296849_297830_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_032412833.1|297842_298220_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_061891350.1|298216_299038_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	2.1e-110
WP_061891351.1|299034_299949_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_071994923.1|299905_300118_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.9e-16
WP_004213338.1|300355_300817_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_016530206.1|300842_301040_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032408726.1|301144_301792_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
WP_032437708.1|302335_302635_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	48.6	8.5e-14
WP_061891353.1|302634_303420_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.2e-62
WP_073970530.1|304157_304733_+	hypothetical protein	NA	C6ZR30	Salmonella_phage	63.0	6.7e-07
WP_061891354.1|304944_305577_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	60.6	2.2e-43
WP_071986589.1|305512_305770_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.8	1.2e-13
WP_061891355.1|305810_307124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061891356.1|307174_308347_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	1.1e-200
WP_004174945.1|308865_309348_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
308542:308565	attR	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_004180785.1|309716_310598_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004180788.1|310607_311516_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
>prophage 2
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	3121848	3167819	5332976	integrase,head,tRNA,terminase	Enterobacteria_phage(21.82%)	65	3124732:3124777	3169215:3169260
WP_004143010.1|3121848_3123234_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|3123279_3123492_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|3123493_3124360_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3124732:3124777	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
WP_139104446.1|3124791_3125628_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	87.4	1.0e-141
WP_004223135.1|3125831_3126167_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_040186416.1|3126179_3126419_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	4.6e-10
WP_064162978.1|3126418_3126586_-	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.9	2.7e-09
WP_064162979.1|3126638_3126857_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	45.6	1.7e-08
WP_064162980.1|3126853_3127624_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.8	9.4e-65
WP_064162981.1|3127620_3128148_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
WP_072056946.1|3128144_3128303_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_064162982.1|3128299_3128980_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	7.4e-122
WP_064162983.1|3128976_3129822_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.7	1.5e-68
WP_048986756.1|3129837_3130122_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_064162984.1|3130129_3131131_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.4	4.2e-65
WP_088607463.1|3131218_3131413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087848314.1|3132057_3132747_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.7	8.7e-62
WP_004151299.1|3132874_3133108_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|3133148_3133370_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_088607464.1|3133455_3134316_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.6	4.6e-60
WP_040182092.1|3134312_3135161_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_004151295.1|3135157_3135451_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_088607465.1|3135447_3135984_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	49.7	7.1e-27
WP_086625976.1|3135980_3136475_+	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	58.5	1.1e-45
WP_088607466.1|3136471_3136933_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_080831306.1|3137650_3137956_+	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.0	1.4e-27
WP_032418538.1|3137948_3138188_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_004884220.1|3138447_3138903_+	dLP12 prophage	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_086625982.1|3138902_3139073_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	75.0	1.5e-15
WP_086625984.1|3139065_3139647_+	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	4.9e-42
WP_064147578.1|3139643_3139868_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	60.3	1.7e-22
WP_086625986.1|3139864_3140005_+	YlcG family protein	NA	NA	NA	NA	NA
WP_086625988.1|3140001_3140691_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	4.2e-64
WP_029884058.1|3141322_3141637_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
WP_080876462.1|3141639_3142143_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	1.3e-75
WP_107326673.1|3142139_3142529_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	50.0	1.6e-25
WP_086625994.1|3142987_3143623_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_019725076.1|3143654_3144140_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	4.1e-66
WP_088607467.1|3144141_3145818_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_088607468.1|3145818_3147339_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.8	4.8e-105
WP_025713735.1|3147391_3148090_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.4	8.3e-60
WP_088607469.1|3148093_3149263_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.7	6.9e-59
WP_088607470.1|3149264_3149747_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.6e-33
WP_001518132.1|3149746_3150784_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.6	1.7e-85
WP_047720246.1|3150785_3151112_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	42.5	3.6e-10
WP_004196802.1|3151111_3151555_+	DUF4054 domain-containing protein	NA	A0A1X9SF97	Acinetobacter_phage	40.5	4.3e-14
WP_020958150.1|3151557_3152121_+	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	35.6	7.0e-17
WP_029497286.1|3152117_3152486_+	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.2e-06
WP_064185370.1|3152467_3153019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050885324.1|3153022_3154504_+	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	2.3e-59
WP_023304864.1|3154503_3154947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043875683.1|3155127_3155883_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
WP_088607471.1|3155885_3156140_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
WP_025713742.1|3156192_3156669_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_088607472.1|3156873_3158790_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	36.1	4.3e-42
WP_001518120.1|3158793_3159633_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	31.4	1.3e-27
WP_019725008.1|3159634_3159940_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_088607473.1|3159936_3160806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088607474.1|3160795_3161383_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	2.2e-05
WP_088607475.1|3161382_3162036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518114.1|3162101_3162458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064169454.1|3162465_3163698_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.7	8.7e-105
WP_009308063.1|3163690_3164278_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_025987678.1|3164279_3165323_+	hypothetical protein	NA	A0A2R3UAP8	Myoviridae_environmental_samples	43.3	9.9e-17
WP_088607476.1|3165332_3167819_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	37.8	6.3e-102
3169215:3169260	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	3629962	3639425	5332976	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3629962_3631078_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3631074_3633015_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3633091_3633313_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3633638_3633956_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3633986_3636266_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3636385_3636604_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3636957_3637659_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020323882.1|3637703_3639425_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 4
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	4026090	4068010	5332976	integrase,transposase,protease	Staphylococcus_phage(15.38%)	42	4055681:4055740	4070917:4071739
WP_002901758.1|4026090_4027137_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|4027184_4027436_-	YciN family protein	NA	NA	NA	NA	NA
WP_004179471.1|4027842_4030440_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	3.7e-89
WP_002901772.1|4030785_4031760_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|4032005_4032173_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_004179474.1|4032561_4035234_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|4035280_4035883_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|4036046_4036814_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|4036949_4037258_+	LapA family protein	NA	NA	NA	NA	NA
WP_004140292.1|4037264_4038434_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|4038625_4039363_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|4039362_4039689_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151906.1|4039820_4040042_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|4040314_4041064_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|4041135_4041315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179478.1|4041473_4043408_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
WP_020324875.1|4043489_4044647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140277.1|4044837_4045626_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004196433.1|4045824_4046367_-	HutD family protein	NA	NA	NA	NA	NA
WP_004148125.1|4046563_4047994_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|4048038_4048848_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|4048849_4049842_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|4049841_4050732_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004892753.1|4050908_4052096_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_022631172.1|4052316_4052556_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_022631173.1|4052596_4053706_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
4055681:4055740	attL	AACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAG	NA	NA	NA	NA
WP_001067855.1|4055746_4056451_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|4056456_4056597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088607488.1|4057082_4057820_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|4057816_4058041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|4058251_4059745_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|4059775_4060027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|4059920_4060223_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|4060309_4061125_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000954592.1|4061454_4061631_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|4062704_4063409_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063102497.1|4063602_4063989_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_044789450.1|4064308_4064701_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001206356.1|4065185_4065977_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|4065982_4066273_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|4066384_4066882_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_088607489.1|4067026_4068010_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.4	2.5e-70
4070917:4071739	attR	AACGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 5
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	4360585	4371472	5332976		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|4360585_4361206_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|4361198_4362464_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|4362475_4363378_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|4363638_4364400_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|4364420_4365281_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|4365578_4365839_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|4365925_4367014_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|4367044_4368310_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179756.1|4368364_4371472_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP022023	Klebsiella pneumoniae strain 19051 chromosome, complete genome	5332976	5062286	5091604	5332976	tRNA,transposase,plate	Tupanvirus(25.0%)	24	NA	NA
WP_002910404.1|5062286_5063543_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|5063813_5064425_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004175551.1|5064421_5065273_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|5065456_5066404_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_020324125.1|5066528_5068208_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|5068208_5069255_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|5069476_5069752_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|5070024_5070609_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|5070726_5071818_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_020323957.1|5071898_5072228_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|5072311_5073226_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|5073357_5074773_-	membrane protein	NA	NA	NA	NA	NA
WP_004175538.1|5074792_5075236_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_021314026.1|5075238_5075781_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022631358.1|5075755_5076802_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020323961.1|5076801_5078565_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_020323959.1|5078698_5082109_-	intracellular multiplication/macrophage-killing	NA	NA	NA	NA	NA
WP_004180395.1|5082092_5083250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088607504.1|5083253_5083520_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004180406.1|5084657_5086355_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004180407.1|5086358_5087012_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_015874925.1|5087008_5088349_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001339197.1|5089057_5090266_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001352368.1|5090395_5091604_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
