The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	366162	378164	4999862	integrase	Enterobacteria_phage(33.33%)	14	354969:354982	373469:373482
354969:354982	attL	ACGCGCCAGCGGTT	NA	NA	NA	NA
WP_001043675.1|366162_367215_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|367497_368601_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|368612_369863_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001529718.1|370219_371434_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000035054.1|371862_372066_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529719.1|372065_372497_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_033567214.1|372509_373343_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000476150.1|373335_373518_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
373469:373482	attR	AACCGCTGGCGCGT	NA	NA	NA	NA
WP_032150717.1|373511_374540_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|374532_374727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|374723_374987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|374983_375205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|375197_375800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529722.1|375812_378164_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
>prophage 2
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	996734	1005466	4999862	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|996734_997853_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|997849_999796_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|999925_1000147_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1000470_1000791_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1000821_1003098_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1003289_1003748_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1004210_1005466_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	1055529	1146446	4999862	terminase,protease,integrase,tRNA,holin,lysis,tail	Salmonella_phage(58.7%)	91	1058438:1058457	1122334:1122353
WP_001154025.1|1055529_1056333_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_051120049.1|1056325_1057648_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1057628_1058333_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1058332_1062799_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1058438:1058457	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1063143_1064985_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1065244_1065793_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1065820_1066468_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1066529_1067720_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1067904_1068996_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1069602_1071003_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1071203_1071665_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1071981_1073196_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1073440_1074877_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1074954_1076157_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1076351_1077644_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1077688_1077937_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1077977_1078217_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1078259_1079417_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1079379_1082580_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1082706_1083057_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1083105_1083237_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1083533_1083968_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1084073_1084301_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1084335_1084656_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1084740_1085724_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1085726_1086476_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1086486_1086834_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1086830_1087289_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1087292_1087601_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1087604_1088249_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1088248_1088506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1088560_1089538_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1089549_1090146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1090737_1090971_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1091080_1091302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1091386_1091989_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1092197_1092809_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1092805_1092946_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1092942_1093632_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1093826_1093952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1094087_1094537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1094897_1095584_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1095859_1096189_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1096172_1096625_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1096642_1097089_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1097557_1098103_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1099223_1099556_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1099655_1100153_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1100269_1100803_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1100892_1101588_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1101597_1102335_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1102232_1102937_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000033415.1|1103008_1106359_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1106397_1106640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1106693_1109132_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1109131_1109713_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1110188_1111157_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1111804_1112431_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1112499_1112799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1112783_1113470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1113740_1113932_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1114358_1116971_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1117178_1118189_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1118354_1118897_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1118893_1120003_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1120101_1122210_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1122222_1124130_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1122334:1122353	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1124144_1125398_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1125402_1127043_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1127039_1127603_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1127858_1128026_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1128125_1128644_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1128712_1130473_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1130658_1131111_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1131182_1132235_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1132591_1133101_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1133317_1133923_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1133909_1136063_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1136081_1136528_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1136651_1138706_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1138741_1139200_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1139294_1139957_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1140127_1140544_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1140588_1140906_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1140963_1142175_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1142389_1142938_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1142963_1143743_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1143791_1144073_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1144069_1144399_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1144485_1145145_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1145765_1146446_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	1933530	1940339	4999862	integrase,tail	Salmonella_phage(33.33%)	11	1928393:1928415	1938108:1938130
1928393:1928415	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1933530_1934412_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1934884_1935073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1935137_1935305_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1935561_1936095_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1936148_1936379_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1936568_1937063_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1937122_1937977_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1938350_1938704_-	YebY family protein	NA	NA	NA	NA	NA
1938108:1938130	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1938720_1939596_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1939596_1939971_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1940108_1940339_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2015786	2095067	4999862	terminase,portal,plate,transposase,head,capsid,protease,integrase,holin,tail	Salmonella_phage(76.81%)	105	2022324:2022339	2096690:2096705
WP_000502119.1|2015786_2016245_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2016425_2017631_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2017709_2019197_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2019453_2020857_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2020871_2021279_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2021278_2021647_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2021718_2023203_+	alpha-amylase	NA	NA	NA	NA	NA
2022324:2022339	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2023242_2023668_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2023853_2025059_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2025055_2025289_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2025553_2025940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2026059_2026374_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2026590_2028273_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2028265_2029261_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2029253_2029961_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2029960_2031331_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2031352_2031796_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2031792_2033010_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2033114_2033582_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2033586_2034591_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2034587_2035001_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2035000_2035378_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2035377_2036115_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2036124_2036394_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2036402_2037197_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2037478_2038102_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2038140_2038389_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2038463_2038691_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2039000_2039816_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2039794_2041507_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2041671_2041917_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2041933_2042845_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2043020_2043941_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2043929_2044400_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2044380_2045811_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2045884_2046580_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2046671_2046971_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2047620_2048817_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2049077_2049266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2049276_2049489_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2049943_2051212_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2051214_2051634_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2051760_2051922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2053115_2053328_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2053324_2053738_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2053785_2053899_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2053973_2054207_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2054320_2054926_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2054895_2056458_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2056444_2057032_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2057034_2058114_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2058106_2058520_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2058524_2059058_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2059057_2060116_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2060112_2061453_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2061512_2061962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2061978_2063904_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2063988_2064315_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2064311_2064668_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2064667_2066164_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2066153_2066318_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2066339_2066897_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2066893_2067406_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2067377_2067782_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2067778_2068102_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2068104_2068305_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2068354_2069560_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2069574_2070225_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2070202_2071444_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605609.1|2071443_2071626_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_033567282.1|2071637_2073371_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2073367_2073862_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2073987_2074338_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2074388_2074721_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2075183_2075576_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2075572_2076187_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2076186_2076468_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2076454_2076841_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2076986_2077244_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2077394_2078147_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2078160_2079150_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2079157_2080018_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2080034_2080424_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2080432_2081308_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2081304_2081778_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2081774_2082749_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2082745_2082970_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2082966_2084109_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2084105_2084660_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2084688_2084913_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2085010_2085706_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2085911_2086250_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2086212_2086437_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2086976_2087348_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2087405_2088233_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2088369_2088909_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2088979_2089513_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2089514_2089772_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2089782_2090364_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2090367_2090937_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2090961_2091204_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2091205_2092195_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2092486_2093284_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2093655_2093946_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2094593_2095067_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2096690:2096705	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2181061	2191567	4999862		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2181061_2182375_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2182401_2183481_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2183485_2184259_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2184255_2185248_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2185253_2185805_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2185805_2186684_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2186731_2187631_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2187630_2188716_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2189092_2189986_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2190163_2191567_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2259875	2269046	4999862	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2259875_2261909_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2262149_2262608_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2262779_2263310_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2263366_2263834_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2263880_2264600_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2264596_2266282_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2266504_2267236_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2267295_2267403_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2267383_2268115_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2268098_2269046_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2341098	2370571	4999862	holin,protease,tail	Salmonella_phage(38.46%)	33	NA	NA
WP_000806401.1|2341098_2341602_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2341629_2341920_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2342267_2344097_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2344150_2344594_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_125572651.1|2344595_2344919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001215679.1|2344971_2345499_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2345501_2346743_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2347335_2347665_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2347961_2349293_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2349321_2349690_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2349704_2350694_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_088631497.1|2351022_2353269_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.7e-72
WP_001113462.1|2353437_2353641_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2353937_2354729_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001653202.1|2355031_2355235_+	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000281877.1|2355426_2355990_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001115498.1|2356719_2357367_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_033572444.1|2357410_2358454_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000828296.1|2358450_2359008_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982518.1|2359004_2360936_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001053618.1|2360932_2361412_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000074110.1|2361408_2361621_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_000266008.1|2361617_2362355_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000990028.1|2362406_2363066_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888541.1|2363062_2363680_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000431778.1|2363700_2364303_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835182.1|2364312_2364762_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013529.1|2364877_2365747_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091673.1|2365733_2366429_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778097.1|2366435_2368922_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_001260058.1|2368918_2369182_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000228070.1|2369171_2369663_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000781589.1|2370076_2370571_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 9
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2694314	2800089	4999862	terminase,portal,transposase,head,capsid,protease,integrase,tRNA,holin,lysis,tail	Salmonella_phage(40.0%)	112	2718859:2718875	2807993:2808009
WP_000940032.1|2694314_2695046_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2695164_2695968_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2696112_2696991_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2697172_2698216_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2698219_2699038_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2699048_2700062_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2700062_2701049_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2701039_2701678_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2701803_2703081_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2703075_2704215_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2704410_2705664_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2705988_2707179_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2707360_2708905_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2709265_2710597_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2710679_2712824_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2712879_2714340_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2714388_2714727_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2714803_2716141_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2716137_2716902_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2716903_2718334_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2718859:2718875	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2718983_2722871_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2722892_2723126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2723126_2724671_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2724721_2725273_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2725297_2725933_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2725936_2727298_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2727308_2728202_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2728317_2729166_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2729204_2730122_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2730143_2731340_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2731455_2732382_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2732419_2732680_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2732791_2733172_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2733171_2733903_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2733914_2734643_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2734654_2735560_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2735556_2736237_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2736510_2737485_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2737501_2739301_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2739705_2741199_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2741653_2741791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2742503_2742668_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2743247_2743313_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2743375_2743588_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2743694_2743922_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2744018_2744597_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2744586_2745411_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2745407_2747780_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2747833_2748076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2748114_2751477_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2751538_2752186_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2752083_2752821_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2752827_2753526_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2753535_2753865_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2753867_2756963_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2756934_2757273_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2757269_2757665_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2757715_2758462_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2758469_2758871_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2758979_2760110_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2760158_2760737_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2760764_2761148_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2761158_2761518_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2761575_2762604_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2762658_2763006_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2763018_2764515_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2764504_2766085_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2766081_2766285_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2766268_2768200_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2768171_2768717_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2769003_2769405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2769640_2770093_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2770110_2770563_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2770546_2770876_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2771151_2771838_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2772052_2772241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2772747_2773311_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2773583_2774261_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2774257_2774398_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2774394_2775006_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2775008_2775215_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929803.1|2775214_2775817_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2775856_2776162_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2776151_2776391_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|2777255_2777729_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2777728_2778253_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2778249_2778597_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2778607_2779357_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2779359_2780343_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2780427_2780802_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2780767_2781004_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2781133_2781538_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2781936_2782095_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2782116_2782467_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2782593_2785521_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2785483_2786641_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2786683_2786923_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2786963_2787248_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2787225_2788455_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2788952_2789432_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2789428_2790385_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2790384_2791035_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2791066_2791642_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2791638_2791803_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2792066_2793689_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2793673_2794411_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2794541_2795876_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2795893_2796793_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2796895_2797483_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2797544_2797928_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2798246_2798936_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2799051_2800089_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2807993:2808009	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	2826899	2888234	4999862	transposase,integrase,tRNA	Escherichia_phage(45.45%)	49	2842118:2842132	2889823:2889837
WP_000469804.1|2826899_2827667_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2827711_2828260_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2828278_2828527_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2828840_2830202_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2830367_2831159_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2831178_2832465_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2832585_2833191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2833225_2833816_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2833938_2834817_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2834902_2836564_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2836712_2837051_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2837216_2837507_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2837496_2837973_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2838121_2838604_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2839217_2850692_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
2842118:2842132	attL	CGCGCGTGTCGAAGT	NA	NA	NA	NA
WP_000533858.1|2850756_2852166_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2852162_2854343_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2854350_2855514_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2856114_2857179_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2857192_2857360_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2857406_2858000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2858389_2859583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2859917_2860745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2861195_2861411_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2861446_2863516_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2863936_2865220_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2865264_2866083_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2866236_2866593_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2866687_2866972_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2867084_2867606_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2867602_2867977_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2867973_2868954_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2868964_2869978_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2870272_2871475_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2871548_2872184_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_031603456.1|2872207_2872771_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2872770_2873613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2873742_2875284_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2875506_2877186_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|2878236_2878941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2879525_2880386_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|2880535_2880937_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2880983_2881688_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2881748_2882585_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2882584_2883388_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|2883448_2884264_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2884571_2885423_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2886178_2886883_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2886929_2888234_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2889823:2889837	attR	CGCGCGTGTCGAAGT	NA	NA	NA	NA
>prophage 11
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	3362100	3403630	4999862	terminase,portal,capsid,head,integrase,tRNA,holin,tail	Cronobacter_phage(68.42%)	47	3357437:3357452	3400852:3400867
3357437:3357452	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3362100_3363114_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3363341_3363557_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3363792_3365538_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3365687_3367535_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3367658_3368165_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3368488_3368791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3370159_3371860_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3371862_3372408_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3372379_3373105_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3373094_3373649_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3373661_3375896_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3375905_3376493_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3376485_3377670_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3377666_3377996_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3377992_3379963_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3380150_3380408_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001670161.1|3380394_3380583_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000376373.1|3380554_3380887_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3380886_3381228_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3381224_3381518_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3381527_3381983_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3381979_3383107_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3383103_3383811_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3383807_3384314_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3384310_3384799_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3384859_3385561_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3385564_3386587_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3386648_3387452_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3387612_3389388_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3389384_3390446_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3390442_3390766_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3390739_3390946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3391065_3393087_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3393083_3393944_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3393934_3394168_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3394235_3394637_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3394636_3395062_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3395051_3395279_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000460878.1|3395288_3395792_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3395822_3396044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3396187_3396769_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3396785_3397352_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3397355_3398393_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3398382_3400164_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3400421_3401189_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3400852:3400867	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3401420_3402068_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3402064_3403630_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	4438960	4459380	4999862	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4438960_4439689_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4439885_4440176_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4440424_4440880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4440876_4441482_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4441486_4443232_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4443234_4443867_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4443859_4444975_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4444965_4445325_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4445488_4447036_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4447035_4447965_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4447961_4448324_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4448651_4449374_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4449383_4450427_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4450414_4450624_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4450623_4451577_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4451576_4453931_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4454027_4454156_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4454115_4454433_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4454484_4455009_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4455008_4456436_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4456425_4456623_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4456619_4457075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4457234_4457549_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4457561_4458167_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4458169_4458457_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4459032_4459380_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 13
NZ_CP019649	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 chromosome, complete genome	4999862	4485829	4529693	4999862	terminase,portal,plate,capsid,head,protease,integrase,tRNA,holin,tail	Shigella_phage(44.07%)	63	4476401:4476416	4537526:4537541
4476401:4476416	attL	GGCAGTTTTTGTCGCT	NA	NA	NA	NA
WP_000549966.1|4485829_4486264_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4486290_4486563_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_001061343.1|4486599_4487172_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_000206745.1|4487171_4487981_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4487980_4488343_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4488333_4488870_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_033567165.1|4488997_4489822_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_001323604.1|4489887_4490268_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_001514782.1|4490850_4491126_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4491134_4491338_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000848748.1|4491509_4492184_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4492274_4492475_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4492518_4493076_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4493251_4493431_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|4493420_4494362_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086936917.1|4494358_4494853_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_001433188.1|4494852_4495506_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4495502_4495829_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4495825_4496215_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4496234_4497044_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_033567167.1|4497051_4498041_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_048306282.1|4498054_4498807_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_001624505.1|4498957_4499215_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|4499360_4499747_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4499733_4500015_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|4500014_4500629_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|4500625_4501018_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|4501480_4501813_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|4501863_4502214_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_048306293.1|4502339_4502825_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_000088161.1|4502838_4504572_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000605606.1|4504583_4504766_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001514795.1|4504765_4506007_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_021578635.1|4505984_4506635_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_021567480.1|4506649_4507855_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021577001.1|4507904_4508132_+	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000927719.1|4508106_4508430_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4508426_4508837_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_022630978.1|4508811_4509318_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000779279.1|4509314_4509875_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|4509883_4510054_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_022630977.1|4510037_4511534_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|4511533_4511890_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4511889_4512159_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_023200330.1|4512300_4514133_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_001439754.1|4514214_4514727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|4514817_4516146_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|4516142_4517222_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|4517221_4517770_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|4517769_4518195_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|4518181_4519240_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|4519230_4519815_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_023200332.1|4519818_4521351_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_006678265.1|4521320_4521938_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4521941_4522349_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678262.1|4522350_4523079_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_000639149.1|4523404_4523968_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_033567204.1|4524111_4524360_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
WP_000332264.1|4524421_4525519_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4525607_4526645_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4526812_4527055_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235551.1|4527229_4528213_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|4528277_4529693_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
4537526:4537541	attR	AGCGACAAAAACTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP019647	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence	275801	51650	97131	275801	integrase,protease,transposase	Escherichia_phage(40.0%)	51	44028:44042	98398:98412
44028:44042	attL	AAGGGAACAACAGCA	NA	NA	NA	NA
WP_085948178.1|51650_52864_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_042634306.1|53154_54111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004201.1|54374_54650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578892.1|54694_55285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371933.1|55292_55550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042634305.1|55623_56160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549069.1|56176_56623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012006603.1|56695_57676_+	DNA replication protein	NA	NA	NA	NA	NA
WP_001198594.1|57685_58591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001805195.1|58526_58871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|58892_60068_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60238_60451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|60811_61894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|62060_63560_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|63585_65223_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|65222_66263_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66348_66987_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|66986_67628_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|67650_68289_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|68751_69219_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|69236_70445_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|70455_71412_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|71411_72491_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|72492_73266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|73258_74401_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|74410_75469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|75792_76374_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_088631489.1|76373_77531_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|77553_78009_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78031_79072_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|79120_79699_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|79766_80342_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|80770_82012_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|82574_82856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|82905_83097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|83188_83560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|83902_84295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|84898_85192_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|85196_86522_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|86582_86789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985910.1|86890_87181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|87222_88059_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|88058_88862_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067858.1|89050_89755_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001351729.1|90188_90581_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|90718_91603_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|91634_92834_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|92939_93590_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|93621_93864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000027057.1|95324_96185_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|96426_97131_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
98398:98412	attR	TGCTGTTGTTCCCTT	NA	NA	NA	NA
>prophage 2
NZ_CP019647	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence	275801	100272	125176	275801	integrase,transposase	Escherichia_phage(55.56%)	20	107961:108020	118141:118798
WP_001067858.1|100272_100977_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_042634516.1|103939_104131_-	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|104455_105160_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000034420.1|105297_106089_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|106557_106803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|106840_107704_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_077876817.1|107849_108047_-	hypothetical protein	NA	NA	NA	NA	NA
107961:108020	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|108023_108728_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_085948178.1|110163_111377_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001206316.1|111708_112500_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|112592_113852_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|114113_114905_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|114962_115571_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|115666_116509_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_088631490.1|116675_117542_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.4	1.3e-38
WP_001067855.1|117432_118137_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000090707.1|119178_120021_+|transposase	transposase	transposase	NA	NA	NA	NA
118141:118798	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCTTCTCAACTATATTGATGATGAGGACTATCGCCGCAGGATCCTAACACAGCTTAACCGGGGCGAAGGTCGCCATGCCGTGGCAAGAGCCATTTGCTACGGTCAGCGTGGTGAGATCAGAAAACGTTACCGCGAGGGGCAGGAAGATCAGTTGGGTGCGCTGGGTCTGGTGACAAACGCAGTGGTGCTGTGGAATACGCTTTATATGCAGGAAGCCTTGTCGCACCTGCGTAGCACTGGGGAAGGGCCAGAAGATGAACATATCGCGCGGCTTTCGCCTCTGATGCATGGTCATATCAACATGCTGGGACATTATACGTTCACACTACCGGAGGATATTATGAAGGGGGAATTGAGGCCGTTAAATCTCAATTTAAACAATGAATTACCTCCTTAGCGTGGTTTTTTACATCATTGGCCCTCAAACCCCGTATATCTCTCATCAATTTTTATATCCGCCCTGGAGTGCACCGTTCAAGCACACCGATTAGGCAGATAGTCACTAGTTAACTCTTTACTAGTGACTAAATTCCATTGATATACGTGACAACGTCACGTCATGAAAGCTTATAAATGCCTATTTTTCATACAATGGGATTT	NA	NA	NA	NA
WP_000351437.1|120007_122131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|122130_123579_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|123619_125176_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP019647	Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence	275801	212514	253918	275801	transposase	Escherichia_phage(40.0%)	48	NA	NA
WP_001300563.1|212514_213627_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000783758.1|213821_213980_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|214078_215448_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_042634503.1|215780_216386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703843.1|216601_216883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424621.1|217257_217569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814954.1|217791_217992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|218031_218256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088631492.1|218310_218514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424592.1|219066_219558_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|219562_219874_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001133831.1|220389_220710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276410.1|220889_221117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248242.1|221344_221956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241454.1|222067_222601_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	2.6e-45
WP_000159618.1|222661_222850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172889.1|222846_223158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|223220_223460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469466.1|223709_226094_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000182314.1|226266_226716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774870.1|226767_227559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634392.1|227785_228043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|228108_228435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104323.1|229277_230528_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_000833773.1|230696_231305_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	39.8	5.4e-23
WP_001290637.1|231460_231718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133498.1|231782_232211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853477.1|232305_232683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424497.1|233090_234272_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000581857.1|234280_234577_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_000170638.1|234626_235097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012006566.1|235531_237949_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000803860.1|237994_238162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634467.1|238482_238665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|238698_239403_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000121743.1|240519_240771_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220561.1|240760_241042_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_051124567.1|241538_242738_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|242747_242936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572405.1|244514_245309_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
WP_001067858.1|245615_246320_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_063102497.1|246513_246900_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_000084745.1|247995_248388_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_000731968.1|249670_250204_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.5	2.0e-21
WP_000128596.1|250203_251199_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_000101711.1|251240_252401_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_042634477.1|252400_253204_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_001067858.1|253213_253918_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
