The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	73474	82855	5242839	integrase,capsid	Enterobacteria_phage(83.33%)	9	71253:71275	83016:83038
71253:71275	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_071687099.1|73474_75808_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.2	0.0e+00
WP_000743144.1|75822_76143_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_071685029.1|76139_76367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071685028.1|76363_76915_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	62.2	2.2e-31
WP_071687098.1|77714_78458_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_001572531.1|78460_78679_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	66.7	5.1e-16
WP_071687097.1|78707_79271_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.8	6.0e-61
WP_088731755.1|79925_81446_+	cytidine deaminase	NA	A0A126HHX6	Vibrio_phage	31.3	4.7e-07
WP_071687038.1|81667_82855_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	5.1e-211
83016:83038	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	823029	862181	5242839	transposase,tRNA,integrase	Bacillus_phage(17.65%)	34	829756:829771	844816:844831
WP_003026944.1|823029_824010_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_003026938.1|824266_824533_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_003026936.1|824513_824921_+	protein YgfX	NA	NA	NA	NA	NA
WP_003026933.1|824965_825487_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_003026928.1|825600_826497_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_003825520.1|826520_827234_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_016150943.1|827239_828973_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.3e-61
WP_096878465.1|829064_830162_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
829756:829771	attL	GATATCGATATCAACC	NA	NA	NA	NA
WP_003026911.1|830172_831690_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_032948043.1|831767_832322_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016150941.1|832488_833247_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_048998164.1|833564_834755_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.2	3.6e-140
WP_085950818.1|834781_835902_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000790483.1|836439_836871_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_032433718.1|837121_838597_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
WP_038633715.1|838589_839270_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
WP_038633711.1|839459_840845_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|840873_841227_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_049016439.1|841340_842633_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|842643_845790_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
844816:844831	attR	GATATCGATATCAACC	NA	NA	NA	NA
WP_000758228.1|845876_846317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070559443.1|846443_848891_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	7.6e-84
WP_000843497.1|848931_849129_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|849162_849900_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_000427614.1|850388_851393_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_049016474.1|851471_854456_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.5	3.6e-306
WP_070558874.1|854615_855194_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.0	9.6e-22
WP_004206572.1|855369_856575_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206574.1|856585_856891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_070558872.1|857472_857898_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	4.3e-51
WP_000427614.1|858072_859077_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|860331_860661_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_000780222.1|860641_860923_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000019450.1|861200_862181_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 3
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	1473471	1542319	5242839	portal,holin,protease,head,tRNA,terminase,tail,integrase,capsid	Enterobacteria_phage(21.15%)	83	1476250:1476272	1519545:1519567
WP_032936544.1|1473471_1475370_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	8.4e-14
WP_071687852.1|1475544_1476174_+	DNA-binding protein	NA	NA	NA	NA	NA
1476250:1476272	attL	TATATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
WP_088731839.1|1476467_1477637_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	87.1	2.7e-204
WP_008323108.1|1477620_1477878_-	hypothetical protein	NA	A0A2R2Z2X2	Escherichia_phage	61.4	8.6e-15
WP_088731842.1|1477887_1478667_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	57.8	1.2e-14
WP_088731845.1|1478670_1478979_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	72.7	1.9e-32
WP_088731848.1|1478982_1479540_-	hypothetical protein	NA	K7P6J7	Enterobacteria_phage	31.7	7.1e-06
WP_057520407.1|1479536_1479749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731851.1|1480356_1480581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731854.1|1480567_1480819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731857.1|1480815_1481040_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.0	1.0e-11
WP_088731863.1|1481158_1481968_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.7e-72
WP_088731866.1|1482045_1482858_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_088731869.1|1482901_1483261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001488222.1|1483273_1483438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086529504.1|1483789_1484233_+	hypothetical protein	NA	U5P096	Shigella_phage	34.7	4.3e-14
WP_088731872.1|1484901_1485156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088731875.1|1485382_1485589_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	2.5e-17
WP_086529502.1|1485665_1486376_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	67.0	4.4e-77
WP_086529501.1|1486475_1486718_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	67.1	3.8e-20
WP_000528109.1|1486746_1487277_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	62.4	1.8e-54
WP_025711394.1|1487318_1487597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731878.1|1487758_1488034_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	41.7	7.8e-06
WP_088731881.1|1488026_1489556_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.5	7.5e-207
WP_088731884.1|1489552_1490524_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	61.2	6.6e-108
WP_088731886.1|1490493_1491138_+	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	60.7	3.1e-45
WP_088731888.1|1491292_1491937_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.8	1.3e-83
WP_088731892.1|1491926_1492337_+	antitermination protein	NA	A0A088CD47	Shigella_phage	77.3	4.1e-51
WP_001446083.1|1492492_1493026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732446.1|1493476_1493806_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	93.6	6.0e-53
WP_060854482.1|1493792_1494212_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	54.0	2.2e-39
WP_088731894.1|1494214_1494745_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	35.2	6.3e-12
WP_060854480.1|1494741_1494972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731898.1|1495441_1495642_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	1.0e-18
WP_088731902.1|1496535_1497075_-	YfbU family protein	NA	NA	NA	NA	NA
WP_088731904.1|1497214_1497565_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	3.9e-50
WP_003841734.1|1497721_1498219_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	73.9	9.7e-63
WP_088731906.1|1498218_1499976_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.1	0.0e+00
WP_088731911.1|1499986_1500172_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	4.9e-12
WP_016240220.1|1500171_1501401_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.9	3.3e-205
WP_008323324.1|1501387_1502041_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.0	1.0e-104
WP_061550054.1|1502054_1503263_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	83.2	2.1e-188
WP_061550056.1|1503552_1503876_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	5.0e-20
WP_061550057.1|1503886_1504225_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	6.6e-39
WP_061550058.1|1504221_1504671_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	86.6	2.2e-66
WP_061550059.1|1504667_1505015_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	77.4	7.5e-46
WP_061550060.1|1505072_1505777_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.9	2.2e-92
WP_079970517.1|1505804_1506194_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	84.5	9.6e-58
WP_079970516.1|1506202_1506481_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	93.5	5.3e-42
WP_080100483.1|1506535_1506877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088731915.1|1506935_1510238_+|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	80.4	0.0e+00
WP_022648882.1|1510240_1510579_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_016240208.1|1510575_1511334_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_088731917.1|1511336_1512047_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	70.2	1.0e-97
WP_044701244.1|1512046_1512631_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.1	4.3e-54
WP_088731919.1|1512684_1515930_+	host specificity protein J	NA	O64335	Escherichia_phage	61.4	0.0e+00
WP_071687891.1|1515922_1516240_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	53.9	3.7e-23
WP_071687892.1|1516240_1516915_+	hypothetical protein	NA	O64337	Escherichia_phage	52.4	2.9e-54
WP_071687893.1|1517023_1517260_+	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	3.4e-18
WP_088731921.1|1517322_1518582_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	49.2	2.4e-102
WP_088731923.1|1518717_1518960_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	2.6e-29
WP_088731925.1|1519039_1519429_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.9	7.8e-52
WP_003839292.1|1519642_1520584_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.3	7.5e-149
1519545:1519567	attR	TATATCCATTTAACTAAGGGGAC	NA	NA	NA	NA
WP_003028190.1|1520872_1521628_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_003845058.1|1521687_1522968_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_003834838.1|1523339_1523624_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_016150715.1|1523800_1525111_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_044714073.1|1525110_1527258_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_003028179.1|1527466_1527952_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_071687853.1|1528032_1528584_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_003028173.1|1528750_1529683_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003028170.1|1529722_1530808_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.0	5.9e-89
WP_071687854.1|1530811_1531636_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_003028167.1|1531635_1532445_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003834819.1|1532444_1532993_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_003028163.1|1533025_1533301_+	YfcL family protein	NA	NA	NA	NA	NA
WP_088731927.1|1533415_1535476_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_003834815.1|1535575_1536790_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_044701208.1|1537003_1538182_+	MFS transporter	NA	NA	NA	NA	NA
WP_003845068.1|1538178_1539180_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_048217302.1|1539288_1540425_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	2.3e-19
WP_003839313.1|1540493_1541507_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071687856.1|1541506_1542319_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	1741116	1749535	5242839	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_016150643.1|1741116_1742064_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.8	2.0e-08
WP_003844383.1|1742047_1742779_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1742759_1742867_-	protein YohO	NA	NA	NA	NA	NA
WP_003844381.1|1742918_1743650_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|1743875_1745561_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|1745557_1746277_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_071687571.1|1746323_1746794_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.3	1.1e-63
WP_046670055.1|1746835_1747294_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	67.3	1.5e-49
WP_071687529.1|1747501_1749535_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.5e-53
>prophage 5
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	1799342	1808920	5242839	protease,tRNA	Bacillus_phage(28.57%)	8	NA	NA
WP_071687519.1|1799342_1801289_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	1.8e-40
WP_003036813.1|1801363_1801588_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1801911_1802232_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1802262_1804539_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003841757.1|1804808_1806170_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	93.2	1.8e-204
WP_003841759.1|1806329_1806662_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|1806797_1807520_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003844344.1|1807516_1808920_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
>prophage 6
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	1859682	1868647	5242839		Acanthocystis_turfacea_Chlorella_virus(16.67%)	8	NA	NA
WP_088731977.1|1859682_1860645_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.4	1.1e-86
WP_088731979.1|1860654_1861101_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_131445364.1|1861137_1862538_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.6	1.3e-48
WP_088731981.1|1862527_1863271_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088731983.1|1863273_1864644_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	7.1e-31
WP_032936740.1|1864813_1866220_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.4e-37
WP_044701934.1|1866417_1867584_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.5e-114
WP_032949582.1|1867642_1868647_-	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	31.7	5.6e-17
>prophage 7
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	1882582	1920380	5242839	tail,plate,integrase,holin	Salmonella_phage(40.48%)	52	1882353:1882371	1920536:1920554
1882353:1882371	attL	TCTCGTAATCGTGGAAGAG	NA	NA	NA	NA
WP_088731999.1|1882582_1883764_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	90.6	1.1e-210
WP_061549023.1|1883744_1883936_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	77.4	2.3e-20
WP_061549062.1|1884086_1884416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549022.1|1884546_1884771_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	2.9e-19
WP_003826255.1|1884960_1885173_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	51.4	1.1e-10
WP_003826258.1|1885165_1885528_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	76.0	1.9e-44
WP_003826262.1|1885819_1886206_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	59.5	5.8e-39
WP_044702873.1|1886268_1886487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061549021.1|1886486_1886699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702870.1|1886870_1887539_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	94.6	2.3e-120
WP_032625779.1|1887637_1887862_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	89.6	1.0e-24
WP_044702867.1|1887833_1888136_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	79.0	1.2e-28
WP_088732003.1|1888565_1890182_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	87.4	4.4e-282
WP_061549019.1|1890178_1891147_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	87.3	8.2e-167
WP_061549018.1|1891146_1892007_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	88.8	6.0e-145
WP_061549017.1|1892003_1892807_+	antitermination protein	NA	F1C595	Cronobacter_phage	70.7	1.5e-102
WP_061549016.1|1893005_1893575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048236547.1|1894476_1894755_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	98.9	5.1e-45
WP_088732005.1|1894726_1895275_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	1.6e-98
WP_061549060.1|1895286_1895832_+	DUF2514 domain-containing protein	NA	A0A193GYI0	Enterobacter_phage	33.2	5.2e-09
WP_071891841.1|1895835_1896051_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_048236545.1|1896311_1896518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048214540.1|1896621_1897626_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9T1Z2	Lactococcus_phage	24.7	2.0e-06
WP_061549013.1|1897872_1898475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048236541.1|1898673_1900290_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	80.6	2.8e-268
WP_088732007.1|1900291_1901761_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	56.5	6.9e-157
WP_032629703.1|1901831_1902365_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	57.5	2.2e-49
WP_061549010.1|1902626_1903892_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	41.5	2.5e-78
WP_088732009.1|1903903_1904407_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.4	5.4e-29
WP_061549009.1|1904418_1905366_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	59.2	1.0e-105
WP_088732012.1|1905410_1905818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044702729.1|1905789_1906200_+	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	52.6	1.5e-29
WP_088732014.1|1906196_1906703_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.5	6.5e-22
WP_061549006.1|1906702_1907107_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	70.0	2.4e-43
WP_044702732.1|1907099_1907645_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.4	6.7e-49
WP_061549005.1|1907648_1908794_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.1	9.1e-165
WP_000257260.1|1908805_1909246_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_061549004.1|1909249_1909702_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	80.0	2.2e-61
WP_061549003.1|1909879_1911862_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	75.6	1.9e-274
WP_061549002.1|1911861_1912437_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	92.7	2.8e-90
WP_061549001.1|1912436_1912739_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	1.1e-48
WP_061549000.1|1912741_1913806_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.4	3.4e-158
WP_088732016.1|1913808_1914153_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.3	1.6e-27
WP_061548998.1|1914165_1914531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061548997.1|1914596_1915349_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	60.9	2.0e-75
WP_003826334.1|1915348_1915702_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	94.0	8.7e-58
WP_061548996.1|1915702_1916902_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	91.0	3.5e-199
WP_061548995.1|1916898_1917579_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.9	1.7e-110
WP_088732018.1|1918728_1919145_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	35.8	3.1e-14
WP_088732020.1|1919219_1919771_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.7	9.0e-86
WP_141211287.1|1919901_1920135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061548885.1|1920140_1920380_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.4	3.5e-34
1920536:1920554	attR	TCTCGTAATCGTGGAAGAG	NA	NA	NA	NA
>prophage 8
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	2082551	2126370	5242839	tail,terminase,integrase,holin	Escherichia_phage(38.3%)	62	2084769:2084796	2134100:2134127
WP_003034925.1|2082551_2082782_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003841654.1|2082925_2083300_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003034931.1|2083303_2084176_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|2084196_2084535_+	YebY family protein	NA	NA	NA	NA	NA
2084769:2084796	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_054528500.1|2084871_2085957_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	7.3e-148
WP_071684411.1|2085925_2086198_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	1.9e-28
WP_088732060.1|2086261_2086504_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	3.9e-33
WP_054528499.1|2086490_2086694_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
WP_071687321.1|2086686_2087031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687320.1|2087065_2088157_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	59.2	1.7e-115
WP_071687319.1|2088169_2090986_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	62.2	5.3e-307
WP_016156718.1|2091298_2091505_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	98.5	1.6e-32
WP_054528494.1|2091818_2092043_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	4.7e-17
WP_016063143.1|2092178_2093111_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	100.0	9.0e-171
WP_016063144.1|2093107_2093587_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	100.0	7.8e-94
WP_008322488.1|2093857_2094556_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.3	1.0e-102
WP_071687773.1|2094666_2094888_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	1.3e-22
WP_019076922.1|2094913_2095453_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	86.6	1.1e-80
WP_016156235.1|2095620_2096568_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.7	3.8e-23
WP_071687775.1|2096570_2097320_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	1.2e-120
WP_071687776.1|2097338_2097650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081366234.1|2097676_2098249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687777.1|2098245_2098749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687778.1|2098750_2099059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086539053.1|2100649_2101249_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	99.0	4.8e-109
WP_071692457.1|2101248_2101455_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	78.8	2.3e-26
WP_086539052.1|2101457_2102105_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	65.1	2.5e-71
WP_088732062.1|2102101_2102743_+	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.9	2.7e-33
WP_086539050.1|2102739_2102880_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	91.3	5.9e-18
WP_086539049.1|2102876_2103692_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	84.5	6.3e-128
WP_086539048.1|2104282_2104507_+|holin	class II holin family protein	holin	M9NZI9	Enterobacteria_phage	82.4	1.4e-29
WP_086539047.1|2104484_2105048_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	86.6	2.0e-80
WP_086539046.1|2105047_2105440_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	58.9	2.9e-30
WP_131341232.1|2105324_2105582_+	peptidase	NA	Q8SBD8	Shigella_phage	77.4	3.1e-28
WP_086539044.1|2105618_2105843_+	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	58.3	5.0e-19
WP_086539075.1|2106286_2106523_-	ATP-dependent RNA helicase HrpA	NA	NA	NA	NA	NA
WP_086539042.1|2106570_2106780_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_086539041.1|2106807_2107380_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	78.0	3.1e-65
WP_086539040.1|2107376_2108948_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.5	4.3e-306
WP_086539039.1|2108952_2110356_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.3	1.3e-237
WP_086539038.1|2110357_2111464_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.2	2.2e-187
WP_019076565.1|2111784_2112537_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.0	1.9e-123
WP_016156686.1|2112554_2113694_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	84.0	4.8e-174
WP_088732064.1|2113732_2114086_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	89.7	2.2e-13
WP_063929361.1|2114088_2114571_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	83.8	1.1e-74
WP_054528469.1|2114572_2114926_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	85.5	3.5e-51
WP_063929362.1|2114928_2115528_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.4	1.6e-96
WP_063929364.1|2115517_2115967_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	75.8	1.8e-60
WP_032943639.1|2116013_2116946_+	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	93.9	3.0e-158
WP_071687883.1|2117089_2117569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032943635.1|2117635_2117974_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	86.6	4.4e-51
WP_071687884.1|2117991_2118279_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	64.6	2.9e-19
WP_071687885.1|2118278_2121332_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	67.8	0.0e+00
WP_131445465.1|2121375_2121795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687887.1|2121847_2122150_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_114141104.1|2122239_2122407_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_081366236.1|2122443_2123325_+	hypothetical protein	NA	I6S627	Salmonella_phage	48.7	4.5e-71
WP_158513309.1|2123404_2123581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065554634.1|2123924_2124275_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	91.4	4.4e-54
WP_081366237.1|2124271_2125045_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	89.5	3.3e-134
WP_071687889.1|2125057_2125789_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	91.7	2.6e-141
WP_071687890.1|2125776_2126370_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	81.4	3.2e-81
2134100:2134127	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 9
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	2129618	2134920	5242839	tail	Enterobacterial_phage(25.0%)	8	NA	NA
WP_071687891.1|2129618_2129936_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	53.9	3.7e-23
WP_071687892.1|2129936_2130611_+	hypothetical protein	NA	O64337	Escherichia_phage	52.4	2.9e-54
WP_071687893.1|2130719_2130956_+	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	3.4e-18
WP_088732066.1|2131018_2132278_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	49.2	1.4e-102
WP_088731923.1|2132413_2132656_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	2.6e-29
WP_047357985.1|2132735_2133125_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	7.8e-52
WP_071687800.1|2133125_2133794_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.0e-80
WP_071687801.1|2134278_2134920_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	3.0e-56
>prophage 10
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	2359158	2497635	5242839	holin,coat,protease,transposase,tRNA,plate,head,lysis,terminase,tail,integrase,capsid	Escherichia_phage(29.35%)	151	2391173:2391189	2498360:2498376
WP_000427614.1|2359158_2360163_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_071687769.1|2360565_2361798_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	9.0e-17
WP_003843936.1|2361865_2363980_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.0	3.4e-16
WP_016150306.1|2364391_2365501_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
WP_003020379.1|2365655_2366639_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_003843930.1|2367110_2368484_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	8.6e-53
WP_071667473.1|2368577_2369513_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	6.3e-140
WP_071667474.1|2369562_2370801_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	64.4	4.1e-155
WP_060854831.1|2370802_2371015_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_071667475.1|2371079_2371322_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	3.0e-33
WP_071687771.1|2371361_2372402_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	75.1	2.5e-153
WP_088732076.1|2372416_2375743_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	71.4	0.0e+00
WP_088732080.1|2376055_2376262_-	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	97.1	9.6e-33
WP_071687318.1|2376721_2377093_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.8	2.5e-31
WP_071687317.1|2377064_2378132_-	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	40.0	5.9e-65
WP_071687316.1|2378156_2378564_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	65.6	5.3e-43
WP_071687315.1|2378663_2378882_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	62.0	9.8e-20
WP_071687314.1|2378893_2379433_+	regulator	NA	K7PJT7	Enterobacteria_phage	79.9	2.4e-75
WP_081366219.1|2379560_2380562_+	replication protein	NA	A5VW95	Enterobacteria_phage	72.1	8.8e-55
WP_071687330.1|2380558_2381254_+	phage replication protein	NA	G8C7U6	Escherichia_phage	47.4	3.2e-56
WP_071687313.1|2381268_2381580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687312.1|2381576_2382053_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.9	2.8e-59
WP_071687311.1|2382121_2382523_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_000089143.1|2382531_2382807_-	hypothetical protein	NA	A0A2P1CKQ3	Pantoea_phage	45.3	1.0e-05
WP_001131407.1|2382794_2383160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131445491.1|2383520_2383778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687309.1|2384383_2384656_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	50.0	1.7e-13
WP_071687308.1|2384691_2385300_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	93.5	2.4e-103
WP_071687307.1|2385290_2385497_+	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	80.3	1.0e-26
WP_071687306.1|2385499_2386108_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	60.8	2.8e-48
WP_016156248.1|2386104_2386242_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	88.4	9.2e-16
WP_071687305.1|2386238_2386928_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	9.6e-61
WP_071687304.1|2387170_2387446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568784.1|2387605_2387884_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_071687303.1|2387855_2388404_+	lysozyme	NA	K7PM52	Enterobacteria_phage	91.8	1.0e-97
WP_081366217.1|2388400_2388862_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.1	2.3e-42
WP_088732082.1|2388960_2389185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687957.1|2389273_2389471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687958.1|2389494_2390067_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	80.6	3.7e-66
WP_088732084.1|2390063_2391635_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.2	1.8e-304
2391173:2391189	attL	TGAACCCGAAGAAATAA	NA	NA	NA	NA
WP_088732086.1|2391639_2393043_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	88.9	1.2e-235
WP_088732088.1|2393044_2394148_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	89.4	6.2e-187
WP_088732090.1|2394272_2395025_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	88.0	5.5e-118
WP_088732092.1|2395042_2396182_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	3.7e-174
WP_071687827.1|2396221_2396407_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	95.1	1.0e-25
WP_071687826.1|2396409_2396892_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	88.1	2.5e-79
WP_071687825.1|2396893_2397247_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	1.6e-51
WP_071687824.1|2397249_2397849_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	89.4	1.3e-98
WP_071687823.1|2397838_2398288_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	92.6	3.2e-73
WP_071687822.1|2398334_2399267_+	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	90.6	1.7e-153
WP_071687821.1|2399389_2399965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687820.1|2400051_2400390_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	89.3	2.3e-52
WP_071687819.1|2400407_2400695_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	2.1e-17
WP_071687818.1|2400694_2403748_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	62.6	0.0e+00
WP_071687817.1|2403965_2404295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732094.1|2404353_2404704_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	90.5	2.9e-53
WP_088732096.1|2404700_2405474_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	86.7	1.4e-132
WP_088732098.1|2405486_2406218_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	88.4	1.8e-137
WP_088732100.1|2406205_2406805_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.5	8.6e-98
WP_071667516.1|2406884_2407253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732102.1|2407305_2410515_+	host specificity protein J	NA	G8C7R4	Escherichia_phage	83.0	0.0e+00
WP_088732104.1|2410514_2410829_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	56.7	2.0e-26
WP_088732106.1|2410829_2411504_+	hypothetical protein	NA	O64337	Escherichia_phage	52.0	5.0e-54
WP_071687064.1|2411911_2413468_+|tail	tail fiber domain-containing protein	tail	O64338	Escherichia_phage	43.2	1.0e-86
WP_071687063.1|2413601_2415053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687062.1|2415052_2415898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071687061.1|2415919_2416810_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_071687059.1|2417548_2418220_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.0e-78
WP_003020369.1|2418803_2419238_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_003020366.1|2419319_2419532_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_016150305.1|2419677_2420832_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	1.1e-114
WP_049015535.1|2421207_2424732_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_003020360.1|2425006_2425273_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_003840829.1|2425286_2425706_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_003020354.1|2425818_2426808_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
WP_003833193.1|2427062_2427275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687158.1|2427423_2430063_+	YdbH family protein	NA	NA	NA	NA	NA
WP_003020350.1|2430059_2430251_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_003020347.1|2430258_2430585_+	YdbL family protein	NA	NA	NA	NA	NA
WP_003020344.1|2430707_2430899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071687159.1|2430942_2431548_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_071687160.1|2431749_2435652_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_032935655.1|2435738_2436530_+	YdcF family protein	NA	NA	NA	NA	NA
WP_003843758.1|2436729_2438169_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_054528418.1|2438210_2439137_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_071687162.1|2439263_2440265_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_044700084.1|2440454_2440985_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.4e-19
WP_003020321.1|2441157_2441577_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_048232098.1|2441579_2442848_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	78.4	3.4e-197
WP_003020312.1|2442970_2443624_-	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_003020306.1|2443616_2444504_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_071687163.1|2444516_2447567_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_003836083.1|2448091_2448694_+	YkgB family protein	NA	NA	NA	NA	NA
WP_003020298.1|2448818_2449187_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_003833178.1|2449308_2449584_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_003836086.1|2449616_2450735_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	8.1e-33
WP_058842667.1|2450904_2452593_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	1.4e-15
WP_071687178.1|2452633_2453557_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071687164.1|2453788_2454691_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_003020282.1|2454811_2456155_+	VOC family protein	NA	NA	NA	NA	NA
WP_003836107.1|2456348_2458004_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_003020276.1|2458171_2458396_+	YdcH family protein	NA	NA	NA	NA	NA
WP_049015548.1|2458462_2459689_-	alanine racemase	NA	NA	NA	NA	NA
WP_003836113.1|2459907_2460453_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_032949359.1|2460444_2461425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003020259.1|2461538_2462540_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_003836119.1|2462539_2463136_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_003030312.1|2463987_2464548_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	72.4	5.2e-73
WP_003030314.1|2464753_2465176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732110.1|2465222_2465639_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	35.8	3.1e-14
WP_063922175.1|2466740_2467313_-	YmfQ family protein	NA	F6MIL7	Haemophilus_phage	37.3	3.4e-27
WP_088732112.1|2467309_2468374_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	43.6	1.4e-63
WP_088732115.1|2468373_2468724_-	phage GP46 family protein	NA	A0A0M3LQK5	Mannheimia_phage	58.3	5.8e-30
WP_063922173.1|2468813_2469401_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	32.9	1.0e-15
WP_003030329.1|2469390_2470647_-	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	34.6	2.3e-68
WP_088732117.1|2470630_2471962_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	22.1	3.1e-23
WP_088732119.1|2471958_2474112_-|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	30.4	6.1e-37
WP_088732121.1|2474267_2474636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003030339.1|2474635_2475010_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	57.4	1.5e-31
WP_088732123.1|2475023_2476778_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	42.9	4.0e-10
WP_088732125.1|2476966_2477632_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	37.6	1.0e-22
WP_088732127.1|2477631_2478060_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_088732129.1|2478063_2478504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003030348.1|2478503_2479412_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	61.9	2.4e-104
WP_063922166.1|2479425_2479833_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	43.6	1.7e-20
WP_063922165.1|2479832_2480945_-|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	39.3	4.0e-56
WP_003030352.1|2481162_2481705_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	1.6e-23
WP_063922164.1|2481701_2482955_-|capsid	minor capsid protein	capsid	Q6TM74	Pseudomonas_phage	36.4	4.5e-56
WP_088732131.1|2482941_2484519_-	DUF935 domain-containing protein	NA	A0A125RNC0	Pseudomonas_phage	44.7	3.5e-122
WP_088732133.1|2484518_2486183_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	67.2	1.1e-214
WP_003030359.1|2486172_2486382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003030360.1|2486374_2486875_-	DUF1804 family protein	NA	L7P7Y5	Pseudomonas_phage	53.4	2.6e-47
WP_003030362.1|2486877_2487162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003030364.1|2487158_2487401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732135.1|2487418_2488048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061548745.1|2488013_2488280_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	62.2	1.1e-15
WP_088732137.1|2488270_2488921_-	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.3	2.6e-63
WP_063922160.1|2489003_2489477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732139.1|2489485_2489923_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	45.5	7.0e-25
WP_088732141.1|2489974_2490382_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	59.0	1.3e-36
WP_074174354.1|2490384_2490771_-	hypothetical protein	NA	O64354	Escherichia_phage	36.0	1.5e-07
WP_088732143.1|2490758_2490953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732145.1|2490973_2491525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732149.1|2492282_2493002_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	34.2	7.8e-29
WP_082327349.1|2493082_2493271_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	50.8	2.6e-08
WP_088732151.1|2493260_2493485_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088732153.1|2493486_2494131_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	60.5	2.2e-67
WP_088732155.1|2494120_2494327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568895.1|2494339_2494618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732157.1|2494638_2495532_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	57.7	4.0e-91
WP_088732454.1|2495577_2497635_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	50.0	3.5e-183
2498360:2498376	attR	TGAACCCGAAGAAATAA	NA	NA	NA	NA
>prophage 11
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	2846297	2908116	5242839	holin,transposase,tRNA,head,lysis,terminase,tail,integrase	Enterobacteria_phage(27.94%)	85	2859914:2859936	2908297:2908319
WP_071686984.1|2846297_2847077_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	1.3e-10
WP_071686983.1|2847073_2848516_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	4.5e-52
WP_071686982.1|2848577_2849291_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2849607_2850072_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_071686981.1|2850149_2850899_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|2850898_2851450_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2851510_2852491_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2852644_2852944_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2852948_2855336_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2855351_2856335_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|2856534_2856666_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|2856704_2857061_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|2857116_2857314_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|2857410_2857953_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|2857956_2859885_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
2859914:2859936	attL	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
WP_088732184.1|2860279_2860642_+	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	3.6e-51
WP_088732186.1|2860638_2861556_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	88.5	2.8e-156
WP_088732188.1|2861555_2862977_+	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_088732190.1|2864941_2867419_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	86.5	0.0e+00
WP_088732192.1|2867405_2867822_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.8	2.9e-68
WP_088732194.1|2867784_2868255_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.3	3.1e-79
WP_088732196.1|2868254_2868752_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.3	1.4e-85
WP_088732461.1|2868751_2871094_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	52.9	1.9e-145
WP_172730633.1|2871206_2871617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732200.1|2871680_2872352_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.1	3.7e-57
WP_088732202.1|2872409_2873153_-	Ig-like domain-containing protein	NA	F1C5E5	Cronobacter_phage	82.7	8.5e-71
WP_000427614.1|2873416_2874421_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_088732204.1|2874602_2875097_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	43.3	8.2e-22
WP_088732206.1|2875196_2875580_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	8.9e-40
WP_088732208.1|2875576_2875984_-	hypothetical protein	NA	A0A291AXD9	Shigella_phage	52.6	8.0e-31
WP_088732210.1|2875986_2876337_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	3.1e-39
WP_006820518.1|2876336_2876510_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_088732212.1|2876509_2876911_-	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.9	1.6e-55
WP_088732214.1|2876973_2877267_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	7.2e-42
WP_088732216.1|2877276_2878353_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.3	1.0e-189
WP_023330664.1|2878370_2878820_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.2	7.1e-65
WP_088732218.1|2878832_2880098_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	92.2	1.2e-221
WP_088732220.1|2880100_2881027_-|head	phage head morphogenesis protein	head	A0A1V0E5Q2	Salmonella_phage	91.6	1.4e-160
WP_088732222.1|2880986_2882336_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	78.4	1.3e-207
WP_088732224.1|2882351_2883599_-|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.3	3.0e-214
WP_023300389.1|2883595_2884051_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.0	1.4e-63
WP_088732226.1|2884082_2884721_-	hypothetical protein	NA	I6S676	Salmonella_phage	93.4	9.7e-116
WP_088732228.1|2884882_2885101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732230.1|2885257_2885641_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	89.8	9.1e-61
WP_088732232.1|2885698_2886184_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	76.4	3.8e-56
WP_088732234.1|2886180_2886657_-	glycoside hydrolase family 104 protein	NA	C6ZR65	Salmonella_phage	88.4	3.9e-77
WP_026080593.1|2886643_2886949_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	86.0	4.0e-43
WP_088732236.1|2887584_2888061_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	52.6	7.9e-38
WP_088732238.1|2888060_2888744_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.3	8.6e-54
WP_088732240.1|2888743_2888881_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	78.9	7.1e-08
WP_088732242.1|2888877_2889240_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.7	2.5e-52
WP_015964709.1|2889236_2889527_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_032936001.1|2889519_2889690_-	NinE family protein	NA	G8C7V4	Escherichia_phage	60.0	6.5e-11
WP_049003308.1|2889682_2890132_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	2.4e-36
WP_088732244.1|2890331_2890586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732246.1|2890585_2890843_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	8.9e-28
WP_088732248.1|2891001_2891394_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	75.4	1.2e-47
WP_088732250.1|2891393_2892053_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	65.3	1.6e-52
WP_088732252.1|2892042_2892243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732254.1|2892244_2892703_-	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	47.5	2.5e-09
WP_088732256.1|2892699_2892912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732257.1|2893246_2893546_-	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	4.4e-18
WP_088732259.1|2893545_2894973_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	61.7	1.3e-168
WP_088732260.1|2894969_2895788_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	47.9	5.9e-65
WP_151237386.1|2895780_2896014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088732262.1|2896010_2896553_-	regulator	NA	M9NZI6	Enterobacteria_phage	93.9	1.3e-89
WP_025913385.1|2896583_2896811_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	2.0e-23
WP_088732463.1|2896922_2897627_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	77.8	5.2e-102
WP_088732264.1|2897674_2898055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088732465.1|2898104_2898314_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	88.4	1.2e-25
WP_151237390.1|2898789_2899167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121567094.1|2899306_2899870_+	HNH endonuclease	NA	A5PJ37	Escherichia_virus	37.6	3.8e-23
WP_088732270.1|2899905_2900286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704464.1|2900437_2900644_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	98.5	4.8e-32
WP_088732272.1|2900720_2901692_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.7	2.3e-76
WP_088732274.1|2901699_2901978_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	76.3	2.4e-34
WP_088732276.1|2901987_2902905_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	99.0	4.4e-170
WP_088732278.1|2902901_2903582_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	93.8	8.4e-126
WP_088732280.1|2904039_2905167_+	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	47.8	6.4e-86
WP_088732282.1|2905457_2905679_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	53.0	1.4e-13
WP_088732284.1|2905678_2906089_+	DUF2591 family protein	NA	A0A075B8G3	Enterobacteria_phage	39.8	2.1e-10
WP_088732286.1|2906051_2906291_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	44.9	8.6e-09
WP_088732288.1|2906300_2906606_+	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	32.4	5.6e-05
WP_032936075.1|2906713_2906950_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_088732290.1|2906907_2908116_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	76.7	9.6e-181
2908297:2908319	attR	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
>prophage 12
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	2999284	3006320	5242839		uncultured_Caudovirales_phage(50.0%)	9	NA	NA
WP_060855345.1|2999284_2999770_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	1.7e-08
WP_072271956.1|3000296_3000500_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.2	1.1e-20
WP_003030760.1|3000743_3001169_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_088732294.1|3001181_3002471_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	5.4e-166
WP_003030762.1|3002515_3002836_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_071687223.1|3002921_3003620_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	66.8	3.2e-88
WP_003840850.1|3004007_3004250_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|3004424_3004934_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_071687222.1|3005069_3006320_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	5.5e-22
>prophage 13
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	3647179	3751025	5242839	protease,transposase,holin	Escherichia_phage(39.29%)	77	NA	NA
WP_000019445.1|3647179_3648160_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_088732328.1|3648707_3662105_+	tandem-95 repeat protein	NA	A0A2L0UZ53	Agrobacterium_phage	25.7	6.3e-07
WP_021570679.1|3662181_3664101_+	TolC family protein	NA	NA	NA	NA	NA
WP_001549866.1|3664115_3664997_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000020380.1|3664993_3666343_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001192442.1|3666344_3668477_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000019445.1|3669294_3670275_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_023205299.1|3671625_3671952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023205298.1|3672002_3672458_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001118619.1|3673311_3674235_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_085950818.1|3676260_3677380_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000167917.1|3677865_3678789_+	cation transporter	NA	NA	NA	NA	NA
WP_001567358.1|3678972_3679677_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_024555186.1|3679723_3680863_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016246540.1|3681091_3681694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|3683855_3684260_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000784387.1|3684866_3685724_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001224687.1|3685739_3686048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043843.1|3686596_3687022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|3687275_3688091_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000985911.1|3688103_3688514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|3688615_3688822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088046.1|3688882_3690208_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_024136327.1|3690212_3690506_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023205287.1|3691109_3691502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718520.1|3691742_3694751_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
WP_001067855.1|3694946_3695651_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001721693.1|3695921_3696887_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000843382.1|3696864_3697362_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_016156527.1|3697358_3699074_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786816.1|3699077_3699518_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
WP_001723515.1|3699507_3700653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001090783.1|3700732_3701344_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001721696.1|3701440_3702328_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001022486.1|3702430_3703345_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|3703367_3703826_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023205099.1|3703913_3704054_-|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_001295707.1|3704800_3704992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101613.1|3704991_3707841_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_004152117.1|3707946_3708516_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004118812.1|3708550_3708832_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295708.1|3709025_3709289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567358.1|3709736_3710441_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_021553334.1|3711324_3711612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021553335.1|3711611_3711869_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	81.3	4.4e-27
WP_088732331.1|3711909_3714360_+	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.5	5.9e-12
WP_085950818.1|3714369_3715490_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_088732333.1|3715611_3715986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021553337.1|3715982_3717407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|3717964_3718348_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000609174.1|3718344_3718692_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|3718741_3720277_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_021553338.1|3721026_3721425_+	ester cyclase	NA	NA	NA	NA	NA
WP_023205625.1|3722625_3723402_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_008325030.1|3726127_3728125_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	2.0e-21
WP_000625672.1|3728188_3729466_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_008324860.1|3730213_3730507_+	helix-turn-helix domain-containing protein	NA	Q1MVP4	Enterobacteria_phage	85.5	2.3e-27
WP_001567357.1|3730515_3730920_+	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000065758.1|3730950_3731376_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_000922630.1|3731388_3732678_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_001556710.1|3732726_3734478_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000783215.1|3734495_3734858_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|3734905_3735259_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_044133241.1|3735574_3736168_+	hypothetical protein	NA	Q5QBN4	Enterobacteria_phage	45.0	3.0e-34
WP_000611681.1|3736729_3737251_+	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	53.8	6.4e-49
WP_000121260.1|3737247_3737577_+	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	66.0	1.8e-36
WP_023205090.1|3737569_3738772_+	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	63.4	3.9e-126
WP_000990392.1|3738808_3739228_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000558568.1|3739224_3739536_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000532315.1|3739689_3740127_+	gluconate transporter	NA	NA	NA	NA	NA
WP_000370412.1|3740176_3740872_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023895.1|3740864_3742292_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102107.1|3742302_3743022_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_023205089.1|3743096_3744794_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000545263.1|3745230_3746784_+	L-lactate permease	NA	NA	NA	NA	NA
WP_016236905.1|3749493_3749994_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001567358.1|3750320_3751025_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
>prophage 14
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	4702147	4711048	5242839	transposase	uncultured_Caudovirales_phage(42.86%)	7	NA	NA
WP_072058795.1|4702147_4703671_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	3.0e-46
WP_088732386.1|4704808_4705908_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	7.9e-49
WP_088732388.1|4706018_4707129_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.2	8.4e-06
WP_088732386.1|4707182_4708282_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	7.9e-49
WP_000060257.1|4708576_4708927_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	2.4e-23
WP_040232041.1|4709320_4710610_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	1.5e-171
WP_040232040.1|4710622_4711048_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.0e-48
>prophage 15
NZ_CP022151	Citrobacter freundii strain 705SK3 chromosome, complete genome	5242839	4944956	5033173	5242839	portal,holin,protease,plate,tRNA,head,terminase,tail,integrase,capsid	Salmonella_phage(82.05%)	89	5000748:5000789	5030388:5030429
WP_032938427.1|4944956_4946057_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_003028863.1|4946139_4946499_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_003028862.1|4946514_4947150_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_003028860.1|4947341_4948742_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_003028858.1|4948724_4949642_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_003028856.1|4949905_4951279_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_032950733.1|4951387_4952161_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_008323185.1|4952171_4953176_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003028848.1|4953331_4954483_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_003840542.1|4954752_4957404_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_071687575.1|4957616_4959350_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_071687576.1|4959501_4960350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016151282.1|4960597_4961260_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.1e-29
WP_016151281.1|4961272_4962376_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_071687577.1|4962462_4964643_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_003028830.1|4964811_4965699_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_071687578.1|4965856_4966765_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071687588.1|4966854_4967232_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_071687579.1|4967270_4968827_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_057063109.1|4968960_4970136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003028820.1|4970171_4972604_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_003847854.1|4972606_4973767_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_003028816.1|4974031_4974349_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_048216987.1|4974401_4975826_-	MFS transporter	NA	NA	NA	NA	NA
WP_003028811.1|4975904_4976585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003028810.1|4976924_4977137_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_071687580.1|4977341_4979540_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003028807.1|4979696_4980722_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_071687581.1|4980815_4981790_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_003028805.1|4981881_4982412_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003028803.1|4982421_4983753_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
WP_003028801.1|4983820_4984750_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_088732408.1|4984842_4985328_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_071687582.1|4985515_4986259_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_088732415.1|4986461_4986707_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_003028793.1|4987135_4987981_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
WP_003028792.1|4988002_4989511_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003840506.1|4989646_4990657_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_003840504.1|4990752_4991499_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_003840502.1|4991562_4991991_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003028785.1|4992091_4992688_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_003028783.1|4992799_4993567_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_016151273.1|4993606_4995079_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003840496.1|4995192_4996497_-	anion permease	NA	NA	NA	NA	NA
WP_016151272.1|4996570_4997320_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_003840489.1|4997424_4998414_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_003028778.1|4998617_4999580_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_003028775.1|4999763_5000666_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
5000748:5000789	attL	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_087855236.1|5000902_5001550_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_001229865.1|5001546_5001879_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001251454.1|5001980_5002223_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_087855237.1|5002271_5003390_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	100.0	1.7e-192
WP_087855238.1|5003547_5004741_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M4S6M1	Salmonella_phage	98.7	3.7e-225
WP_001207578.1|5004753_5005269_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_000047593.1|5005283_5005619_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763324.1|5005627_5005744_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	100.0	6.6e-15
WP_088732417.1|5005744_5008915_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	74.1	0.0e+00
WP_023276958.1|5008925_5009375_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	92.6	2.2e-74
WP_088732419.1|5009506_5009923_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	36.5	4.8e-15
WP_088732422.1|5011239_5011854_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	98.4	5.9e-110
WP_016246759.1|5011846_5012758_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.3	8.3e-161
WP_000108899.1|5012754_5013117_-	GPW/gp25 family protein	NA	A0A0M4S6L5	Salmonella_phage	99.2	3.3e-60
WP_088732424.1|5013113_5013743_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	96.2	7.8e-110
WP_088732426.1|5013900_5014545_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	97.2	1.3e-115
WP_088732428.1|5014559_5015000_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	93.8	5.4e-73
WP_088732430.1|5014999_5015530_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	93.8	3.9e-46
WP_088732432.1|5015630_5016071_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	97.3	5.2e-76
WP_000543937.1|5016054_5016390_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_001102549.1|5016400_5016601_-|tail	tail protein X	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|5016600_5017089_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_088732434.1|5017191_5018040_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	96.8	4.7e-134
WP_001246221.1|5018082_5019129_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.8	9.1e-196
WP_088732479.1|5019169_5020015_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	96.4	6.5e-152
WP_001090183.1|5020168_5021881_+|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	98.4	0.0e+00
WP_000014576.1|5021881_5022931_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_088732436.1|5023472_5025863_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	88.9	0.0e+00
WP_048275531.1|5025862_5026168_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.8e-27
WP_088732438.1|5026167_5027139_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.7	9.5e-139
WP_069899228.1|5027140_5027353_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	94.3	1.9e-31
WP_054628204.1|5027444_5027675_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	76.0	7.2e-29
WP_000290619.1|5027664_5027871_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_054628203.1|5027881_5028085_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	95.5	4.8e-29
WP_000130011.1|5028095_5028377_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	98.9	5.3e-50
WP_000343126.1|5028467_5028707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000229411.1|5028906_5029227_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	98.1	1.3e-52
WP_023276977.1|5029296_5030277_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_003028767.1|5030453_5030954_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
5030388:5030429	attR	AAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_003028763.1|5031104_5031803_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
WP_003840485.1|5031799_5033173_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
>prophage 1
NZ_CP022152	Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence	296175	61245	158944	296175	integrase,transposase	Escherichia_phage(26.09%)	89	68487:68506	123571:123590
WP_000019445.1|61245_62226_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_072146302.1|62829_63021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372176.1|63227_63998_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_007372177.1|64101_65751_-	glycerone kinase	NA	NA	NA	NA	NA
WP_007372178.1|65825_67244_-	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372179.1|67254_67887_-	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_007372180.1|67897_68968_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
68487:68506	attL	CCGACCAGTTTTTCAATCAG	NA	NA	NA	NA
WP_007372182.1|69524_70622_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372183.1|70811_71090_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372185.1|71650_72748_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_009653098.1|72837_74763_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_007372187.1|74740_75271_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_007372188.1|75271_75625_-	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_007372189.1|75641_76805_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372190.1|76827_77256_-	heme-binding protein	NA	NA	NA	NA	NA
WP_016241522.1|77648_79316_+	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_009652918.1|79327_79912_+	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_007372193.1|79914_80343_+	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_007372194.1|80353_82165_+	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_007372195.1|82218_83022_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	2.1e-14
WP_024196074.1|83073_83403_-	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_007372197.1|83437_83842_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_009652914.1|83868_84255_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_007372199.1|84268_85231_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_009652923.1|86094_86409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099531012.1|86695_86971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241518.1|86984_87410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087121881.1|87562_88710_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.1e-146
WP_007372203.1|89178_89685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531002.1|89842_90244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652915.1|90356_91547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372207.1|91582_91771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016807536.1|91922_93380_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001515737.1|95896_97174_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_016151347.1|98500_99022_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|99018_99972_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_007898891.1|100058_102383_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_016156513.1|102427_103330_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_016156512.1|103326_104325_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|104321_105278_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|105278_106046_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_016156511.1|106144_106438_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.0e-48
WP_071526715.1|106768_107011_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|107308_108313_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_087450602.1|108487_108913_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_007898880.1|108925_110215_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_004206577.1|110259_110580_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_024241646.1|111720_112803_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_016156506.1|112924_115999_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|116050_117304_+	lactose permease	NA	NA	NA	NA	NA
WP_016156505.1|118310_118946_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	53.2	3.5e-25
WP_016156504.1|119030_119471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016156503.1|119597_121805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016156502.1|122171_124793_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.6	1.1e-16
123571:123590	attR	CCGACCAGTTTTTCAATCAG	NA	NA	NA	NA
WP_000533745.1|125478_125841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654269.1|125858_126668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|127017_128180_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_047389788.1|128274_128979_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_088732502.1|128990_130991_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088732505.1|130983_131844_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_045284274.1|132149_133358_+	DUF4071 domain-containing protein	NA	NA	NA	NA	NA
WP_043495620.1|133362_133761_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_043495618.1|134037_134442_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_043495617.1|134482_135346_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_040115241.1|135362_135920_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	46.1	3.8e-39
WP_043495614.1|136079_139088_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.3	0.0e+00
WP_088732507.1|139105_140101_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000792636.1|140100_140634_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_088732510.1|140806_141121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|141375_141732_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|141721_142123_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|142119_142410_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016156530.1|142693_143398_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	9.0e-139
WP_016236480.1|143826_144807_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_001515713.1|144907_145273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000045622.1|145269_145755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515712.1|146424_147225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016156524.1|147227_147401_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	90.6	1.2e-07
WP_088732512.1|148645_149446_+	DsbA family protein	NA	NA	NA	NA	NA
WP_085950818.1|149998_151119_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_016241600.1|151926_152901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372209.1|152924_154040_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_032155232.1|154046_154697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241597.1|154987_155404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372211.1|155408_156137_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016241596.1|156143_156779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241595.1|156775_157084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131334126.1|157451_157643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653618.1|157675_158944_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
