The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022133	Idiomarina piscisalsi strain 10PY1A chromosome, complete genome	2587498	1210059	1227137	2587498		Catovirus(28.57%)	12	NA	NA
WP_088768100.1|1210059_1211694_-	NAD(P)-binding protein	NA	A0A1V0S9J5	Catovirus	30.3	3.3e-59
WP_088768101.1|1211671_1213111_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_088768102.1|1213209_1213449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768103.1|1213538_1214570_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_088768104.1|1214581_1218505_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.8	3.3e-57
WP_053953811.1|1218540_1218807_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	67.9	6.0e-27
WP_088768105.1|1218922_1219183_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	47.2	1.3e-15
WP_088768106.1|1219186_1220320_-	ribonucleotide-diphosphate reductase subunit beta	NA	I3UMG4	Colwellia_phage	68.3	1.2e-148
WP_088768107.1|1220337_1222668_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	67.6	6.4e-311
WP_088768108.1|1222938_1223625_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_088768109.1|1223628_1224360_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_088768110.1|1224509_1227137_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.3	4.4e-106
>prophage 2
NZ_CP022133	Idiomarina piscisalsi strain 10PY1A chromosome, complete genome	2587498	1372945	1415039	2587498	integrase,tRNA,transposase,protease	uncultured_Mediterranean_phage(12.5%)	41	1390296:1390351	1425089:1425144
WP_088768231.1|1372945_1374238_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	8.0e-93
WP_088768232.1|1374245_1374635_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_088768233.1|1374627_1375968_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	2.0e-78
WP_088768234.1|1375973_1376576_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_088768235.1|1376579_1378961_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	48.3	4.9e-88
WP_088768236.1|1379033_1379525_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_088768237.1|1379668_1380796_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_088768238.1|1380865_1381060_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_088768239.1|1381076_1381508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768240.1|1381627_1382587_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.2	6.4e-63
WP_088768241.1|1382594_1383320_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_088768242.1|1383304_1384015_+	arginyltransferase	NA	NA	NA	NA	NA
WP_053953583.1|1384042_1384261_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_088768243.1|1384311_1386579_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.0e-167
WP_088768244.1|1386605_1386914_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	46.7	6.7e-14
WP_053953580.1|1387131_1387347_+	cold shock domain-containing protein CspD	NA	Q9AZD3	Lactococcus_phage	57.8	3.6e-14
WP_088768245.1|1387433_1388477_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	36.1	7.0e-55
WP_088768246.1|1388544_1390185_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
1390296:1390351	attL	TGTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCACGCCGACCAATTCTTC	NA	NA	NA	NA
WP_088768247.1|1390915_1392442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768248.1|1392438_1392681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157776073.1|1392690_1392927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768249.1|1393566_1393749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768250.1|1394124_1395291_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088768251.1|1395287_1396886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088768252.1|1396882_1398757_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088768253.1|1398749_1399145_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157776074.1|1399141_1399990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768255.1|1400435_1400666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157776075.1|1400968_1402522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088768257.1|1402905_1403271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088768258.1|1403357_1404521_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088768259.1|1404617_1405361_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088768260.1|1405401_1406544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768262.1|1406986_1407415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768263.1|1408064_1408928_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_088768264.1|1409090_1410053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768265.1|1410146_1411070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768266.1|1411229_1411811_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_088768267.1|1411819_1413109_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_157776076.1|1413235_1413757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088768269.1|1414013_1415039_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1425089:1425144	attR	TGTCATGGGGTGTCAGGGGTCGGAGGTTCAAATCCTCTCACGCCGACCAATTCTTC	NA	NA	NA	NA
>prophage 3
NZ_CP022133	Idiomarina piscisalsi strain 10PY1A chromosome, complete genome	2587498	1487415	1495721	2587498		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_088768329.1|1487415_1488498_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.9	4.8e-115
WP_088768330.1|1488605_1489103_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	51.0	5.0e-27
WP_088769378.1|1489134_1491711_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.4	9.9e-34
WP_088768331.1|1491770_1492760_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	2.4e-36
WP_088768332.1|1492838_1493723_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	34.3	4.3e-05
WP_088768333.1|1493743_1494328_-	DedA family protein	NA	NA	NA	NA	NA
WP_088769379.1|1494324_1494969_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	7.9e-33
WP_088768334.1|1494968_1495721_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.2	5.8e-67
