The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022120	Salmonella bongori serovar 66:z41:- str. SA19983605 chromosome, complete genome	4468959	617016	653960	4468959	tail,head,capsid,terminase,plate,lysis,portal,holin,tRNA,integrase	Salmonella_phage(56.1%)	46	616897:616945	647593:647641
616897:616945	attL	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_000218395.1|617016_618054_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_001217271.1|618053_618632_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000135597.1|618762_619026_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_000459332.1|619056_619566_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000920168.1|619573_619801_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000085639.1|619787_619988_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_001246236.1|620057_620285_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752604.1|620284_620509_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_153655389.1|620530_621124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000503833.1|621149_623369_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
WP_000373435.1|623486_623927_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	94.2	2.6e-67
WP_000381894.1|624009_624741_+	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	5.1e-129
WP_000033213.1|624851_625400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338485.1|625779_626784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517958.1|626861_627908_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_000156054.1|627907_629677_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_001085936.1|629842_630697_+|capsid	capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	98.6	8.9e-157
WP_001248604.1|630772_631840_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.5	2.3e-178
WP_000203474.1|631843_632593_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	88.0	1.8e-113
WP_000214255.1|632686_633193_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_015703020.1|633192_633396_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	98.5	4.0e-31
WP_000134659.1|633399_633696_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|633682_634180_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866102.1|634176_634590_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|634561_634735_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_001169076.1|634697_635165_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	2.5e-84
WP_001293103.1|635157_635607_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	99.3	2.5e-73
WP_001094753.1|635675_636317_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	98.1	3.5e-113
WP_000127150.1|636313_636661_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_000246675.1|636667_637576_+|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.0	1.3e-158
WP_001000071.1|637568_638099_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	98.3	7.8e-103
WP_000104701.1|638109_640086_+|tail	tail protein	tail	S4TP62	Salmonella_phage	98.6	0.0e+00
WP_000122994.1|640098_640647_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	99.5	1.7e-100
WP_001279032.1|640781_641969_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	5.8e-223
WP_001207675.1|641984_642503_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029727.1|642565_642901_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_085984508.1|642897_643053_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_000069527.1|643045_645487_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_000978861.1|645501_645987_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	1.0e-85
WP_000627825.1|645983_647153_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.9e-210
WP_000468307.1|647219_647438_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000237774.1|647796_648303_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
647593:647641	attR	ATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_001519776.1|648447_650295_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918858.1|650444_652190_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	4.7e-72
WP_001144069.1|652493_652709_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264346.1|652946_653960_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	4.5e-107
>prophage 2
NZ_CP022120	Salmonella bongori serovar 66:z41:- str. SA19983605 chromosome, complete genome	4468959	1580816	1589406	4468959	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_000569161.1|1580816_1581764_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.5	6.2e-10
WP_000824740.1|1581747_1582479_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001234243.1|1582459_1582567_-	protein YohO	NA	NA	NA	NA	NA
WP_001240383.1|1582626_1583367_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.1	1.3e-100
WP_000272843.1|1583589_1585275_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	89.3	4.6e-274
WP_000598645.1|1585271_1585991_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950424.1|1586037_1586508_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.7	1.1e-76
WP_000703144.1|1586646_1587105_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.9	7.1e-52
WP_000195328.1|1587372_1589406_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.8e-55
>prophage 3
NZ_CP022120	Salmonella bongori serovar 66:z41:- str. SA19983605 chromosome, complete genome	4468959	2701124	2725136	4468959	integrase,holin	Salmonella_phage(50.0%)	35	2696083:2696142	2725225:2725302
2696083:2696142	attL	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTC	NA	NA	NA	NA
WP_141024939.1|2701124_2701628_-	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	45.6	1.7e-19
WP_015702803.1|2702074_2703187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480907.1|2703188_2703446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111091.1|2703530_2703881_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	74.8	8.1e-48
WP_000819054.1|2703983_2704289_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	53.1	6.2e-20
WP_001222152.1|2704377_2704788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109263.1|2705187_2705718_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	96.6	9.9e-90
WP_001050816.1|2705979_2706522_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000372743.1|2706518_2707133_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.6	2.7e-107
WP_000226306.1|2707132_2707414_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294877.1|2707400_2707790_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.4e-40
WP_141024936.1|2708027_2708729_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.0	5.0e-81
WP_141024934.1|2708799_2709228_-	pertussis toxin	NA	NA	NA	NA	NA
WP_000509712.1|2710157_2710337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151608.1|2710347_2710848_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000211402.1|2710989_2711562_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	71.1	3.5e-40
WP_000793789.1|2711830_2712502_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	57.1	1.5e-63
WP_000929795.1|2712890_2713493_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.3e-109
WP_015702798.1|2713527_2713776_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	3.6e-42
WP_001217667.1|2713892_2714126_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	7.3e-37
WP_000128278.1|2714311_2715058_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	61.8	4.5e-64
WP_015702797.1|2715130_2715958_-	hypothetical protein	NA	I6S627	Salmonella_phage	52.2	2.7e-57
WP_000409416.1|2716031_2716199_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	75.5	6.6e-16
WP_000085729.1|2716321_2716753_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	55.8	9.7e-27
WP_024134978.1|2717039_2717366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025837.1|2718375_2718633_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	89.4	1.8e-36
WP_000788824.1|2718646_2719339_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	58.9	4.3e-77
WP_000024047.1|2719335_2720241_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.0	1.3e-174
WP_015702794.1|2720332_2720707_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	3.3e-63
WP_000145711.1|2720672_2720900_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_000214259.1|2720913_2721381_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	85.2	4.7e-67
WP_000097141.1|2721552_2722401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846936.1|2722397_2723204_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000196400.1|2723891_2724116_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_015702793.1|2724116_2725136_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	8.3e-93
2725225:2725302	attR	TAACCCCTTGTTTAATCTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGG	NA	NA	NA	NA
>prophage 4
NZ_CP022120	Salmonella bongori serovar 66:z41:- str. SA19983605 chromosome, complete genome	4468959	2809812	2884182	4468959	tail,protease,tRNA,plate	Salmonella_phage(25.0%)	63	NA	NA
WP_000886701.1|2809812_2811105_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067777.1|2811361_2812705_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.9	1.8e-79
WP_015702786.1|2812714_2813326_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076975.1|2813468_2817440_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_000228469.1|2817574_2818069_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537395.1|2818615_2819584_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	7.2e-62
WP_001044529.1|2819698_2821465_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.3	2.0e-22
WP_001202240.1|2821465_2823187_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.1	1.3e-13
WP_001241653.1|2823231_2823936_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2824228_2824447_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597933.1|2824685_2825597_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809976.1|2825705_2826566_+	pirin family protein	NA	NA	NA	NA	NA
WP_000203410.1|2826585_2827263_+	hydrolase	NA	NA	NA	NA	NA
WP_000934068.1|2827883_2830160_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	8.1e-165
WP_000520786.1|2830190_2830511_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_000447498.1|2830834_2831056_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125868.1|2831206_2833153_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.7	3.1e-40
WP_001201757.1|2833149_2834268_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.1	1.8e-08
WP_000192850.1|2834413_2835364_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599777.1|2835360_2837019_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000490988.1|2837219_2838119_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458840.1|2838261_2839914_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178699.1|2839924_2840893_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815328.1|2841084_2842803_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.3e-29
WP_000566417.1|2842841_2843843_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136512.1|2843853_2845287_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866899.1|2845382_2846396_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202301.1|2846392_2847223_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	3.3e-07
WP_001160725.1|2847219_2847543_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000701348.1|2848144_2849917_+	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_001270718.1|2850677_2851193_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027180.1|2851416_2852145_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.4	8.7e-28
WP_000756594.1|2852162_2852894_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001674.1|2852900_2853617_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000895391.1|2853616_2854285_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_000737541.1|2854519_2855251_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015702782.1|2855427_2856840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644037.1|2856925_2858413_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_015702781.1|2858422_2858743_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000399312.1|2858774_2860118_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001149768.1|2860399_2861530_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.8	7.4e-26
WP_000506267.1|2861572_2862046_-	YbjO family protein	NA	NA	NA	NA	NA
WP_000183361.1|2862118_2862964_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105458.1|2862960_2863914_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001000692.1|2863923_2865057_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	3.2e-29
WP_000126167.1|2865142_2866255_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000624815.1|2866603_2867080_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684312.1|2867176_2868079_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.6	2.6e-34
WP_001070124.1|2868137_2868860_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001259125.1|2868843_2869134_-	YbjC family protein	NA	NA	NA	NA	NA
WP_000495514.1|2869303_2869567_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	3.5e-27
WP_000681116.1|2869598_2869976_-	membrane protein	NA	NA	NA	NA	NA
WP_001024857.1|2870247_2871933_+	transporter	NA	NA	NA	NA	NA
WP_000972393.1|2872168_2872387_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.6	1.3e-19
WP_001102270.1|2872477_2873530_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	89.1	4.0e-175
WP_000980410.1|2873526_2874012_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.7	1.2e-73
WP_000763316.1|2876980_2877100_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280962.1|2877114_2877417_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000584703.1|2879177_2879642_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	1.0e-18
WP_001285260.1|2879863_2881021_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	29.1	1.9e-29
WP_001086799.1|2882329_2882935_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	5.0e-114
WP_000268334.1|2882927_2883836_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	98.0	1.5e-157
WP_000177407.1|2883822_2884182_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	96.6	1.8e-58
