The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	98064	108096	2999326		Tupanvirus(33.33%)	7	NA	NA
WP_009924391.1|98064_99519_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
WP_072215787.1|99546_99855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951082.1|100033_101644_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_012951083.1|101701_102232_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_003722118.1|102519_103986_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_003732117.1|104146_105919_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_012951084.1|105942_108096_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
>prophage 2
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	1126762	1136315	2999326		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1126762_1127146_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1127167_1128151_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_010989660.1|1128165_1129179_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003721509.1|1129387_1130878_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_003727000.1|1130889_1131714_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_012951453.1|1131726_1132035_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003730540.1|1132094_1132499_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951454.1|1132627_1134184_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_012951455.1|1134401_1136315_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
>prophage 3
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	1233095	1340178	2999326	terminase,portal,tRNA,holin,integrase,capsid,tail,protease	Listeria_phage(68.85%)	116	1257729:1257750	1302476:1302497
WP_012951511.1|1233095_1235504_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1235664_1236366_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
WP_012951512.1|1236379_1239790_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003721623.1|1239887_1240340_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003721624.1|1240355_1243556_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003732773.1|1243662_1244337_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	7.5e-50
WP_072215733.1|1244374_1245301_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1245454_1245718_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_012951513.1|1245717_1246260_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003723851.1|1246352_1248065_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|1248087_1250445_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1250525_1250837_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003733800.1|1250912_1252724_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1252912_1254127_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1254182_1254677_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1254824_1255625_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1255637_1256384_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012951514.1|1256387_1256999_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1257035_1257560_+	metallophosphoesterase	NA	NA	NA	NA	NA
1257729:1257750	attL	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951516.1|1257845_1259000_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
WP_012951517.1|1259141_1259798_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951518.1|1259849_1260302_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951519.1|1260318_1260642_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_003730994.1|1261042_1261246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951520.1|1261312_1261504_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730996.1|1261525_1261768_+	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_003730997.1|1261770_1261956_+	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_012951522.1|1262708_1262951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951524.1|1263767_1264232_+	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951525.1|1264228_1264942_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951526.1|1264952_1265897_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951527.1|1265909_1266590_+	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951528.1|1266586_1266820_+	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951529.1|1266822_1267266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951530.1|1267458_1267938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1267938_1268568_+	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951532.1|1268586_1268820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1268816_1269035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951534.1|1269004_1269196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731668.1|1269398_1269662_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_012951535.1|1269834_1270218_+	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731665.1|1270219_1270699_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951536.1|1270718_1271408_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_074471730.1|1271486_1272728_+	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_009918373.1|1272752_1273235_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_012951538.1|1273257_1275546_+	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_012951539.1|1275879_1276197_+	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_003731659.1|1276198_1276411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1276858_1277398_+	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731657.1|1277394_1277664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009917712.1|1277883_1278309_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951542.1|1278406_1279150_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_014930130.1|1279618_1279945_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_009931610.1|1279944_1280259_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_012951543.1|1280308_1280665_+	hypothetical protein	NA	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_012951544.1|1280661_1282305_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.3	0.0e+00
WP_009917707.1|1282314_1282704_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951545.1|1282754_1283885_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_012951546.1|1283881_1284598_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951547.1|1284624_1285776_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951549.1|1285962_1286262_+	hypothetical protein	NA	A8ATA0	Listeria_phage	97.0	8.4e-46
WP_009934006.1|1286245_1286611_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_012951550.1|1286607_1287009_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009931623.1|1287005_1287389_+	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951551.1|1287409_1287997_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_012951552.1|1288067_1288400_+	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_012951553.1|1288615_1293547_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_012951554.1|1293534_1295184_+|tail	phage tail protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951555.1|1295196_1297491_+	hypothetical protein	NA	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_031644619.1|1297480_1298575_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951557.1|1298622_1298925_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_012951558.1|1298924_1299182_+|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951559.1|1299181_1300027_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951560.1|1300130_1301129_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951561.1|1301353_1301536_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951563.1|1301976_1302210_+	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951565.1|1302857_1304216_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1302476:1302497	attR	AATCCCTCTCAGGACGTAATAT	NA	NA	NA	NA
WP_012951566.1|1304256_1304850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009914084.1|1305003_1305411_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_009924169.1|1305575_1306175_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	5.8e-30
WP_003723543.1|1306206_1306467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989717.1|1306590_1308003_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	8.3e-51
WP_003723545.1|1308027_1308291_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003723546.1|1308458_1308935_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012951567.1|1308972_1309218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951568.1|1309214_1310420_-	MFS transporter	NA	NA	NA	NA	NA
WP_003723549.1|1310624_1311284_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003723550.1|1311325_1311520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723551.1|1311586_1312435_-	YitT family protein	NA	NA	NA	NA	NA
WP_009931701.1|1313054_1313768_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_012951570.1|1313798_1315445_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003723556.1|1315463_1316948_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003723557.1|1317063_1317516_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_012951571.1|1317562_1318027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723559.1|1318215_1319136_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003723560.1|1319155_1320403_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	1.2e-106
WP_003723561.1|1320386_1321217_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	4.3e-47
WP_003723562.1|1321352_1322492_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1322572_1322968_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1323118_1323334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1323452_1323986_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1324003_1324669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1324930_1325869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1325983_1327267_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1327451_1328711_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1328829_1329396_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_009924619.1|1329430_1330000_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1330101_1330644_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1330653_1331517_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723891.1|1331513_1332299_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1332432_1333293_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_012951572.1|1333564_1335643_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_009924616.1|1335705_1337010_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1337292_1338195_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1338215_1338755_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003732800.1|1338768_1340178_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
>prophage 4
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	1923216	1931502	2999326		Synechococcus_phage(33.33%)	8	NA	NA
WP_003722243.1|1923216_1923783_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_012951771.1|1923779_1924829_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722245.1|1924847_1926275_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951772.1|1926259_1928479_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722247.1|1928471_1929155_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1929158_1929404_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012951773.1|1929415_1930129_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003729814.1|1930209_1931502_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	2444766	2483997	2999326	holin,terminase,tail	Listeria_phage(98.08%)	57	NA	NA
WP_012951924.1|2444766_2445000_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
WP_012951925.1|2445440_2445650_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951926.1|2445751_2446156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951927.1|2446157_2446586_+	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951928.1|2446597_2447095_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_003722520.1|2447369_2448143_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951929.1|2448183_2449029_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722522.1|2449028_2449310_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2449322_2449688_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_012951930.1|2449726_2451889_-	hypothetical protein	NA	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_012951931.1|2451901_2453470_-	hypothetical protein	NA	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951932.1|2453466_2458266_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_074046934.1|2458270_2458582_-	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951934.1|2458578_2459010_-	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_012951935.1|2459065_2459752_-	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_010991155.1|2459756_2460128_-	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951936.1|2460124_2460442_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_003733695.1|2460431_2460797_-	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951937.1|2460796_2461150_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_012951939.1|2461331_2462204_-	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_003744996.1|2462226_2462781_-	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951940.1|2462876_2463920_-	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_012951941.1|2463924_2465481_-	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951942.1|2465495_2466815_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.3	2.9e-263
WP_012951943.1|2466807_2467548_-	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_012951944.1|2467587_2467815_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951945.1|2468100_2468535_-	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951946.1|2468675_2469059_-	DUF2481 domain-containing protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951947.1|2469062_2469467_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_031645468.1|2469411_2469594_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951948.1|2469621_2469999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951949.1|2470020_2470500_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951950.1|2470496_2470898_-	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951951.1|2470894_2471254_-	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_012951952.1|2471275_2471524_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	69.1	1.2e-18
WP_012951953.1|2471641_2472172_-	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_012951954.1|2472168_2472456_-	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951955.1|2472452_2473436_-	DnaD domain protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951956.1|2473452_2474112_-	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951957.1|2474117_2474594_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_003734953.1|2474590_2474785_-	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_003722564.1|2475090_2475279_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_012951958.1|2475387_2475603_-	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_012951959.1|2475599_2476133_-	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951960.1|2476256_2477033_-	phage antirepressor Ant	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_003733685.1|2477014_2477290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951961.1|2477295_2477577_-	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_012951962.1|2477573_2477810_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951963.1|2477874_2478234_+	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_003733687.1|2478192_2478387_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951964.1|2478390_2478642_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_012951965.1|2478804_2479110_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951966.1|2479140_2479632_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951967.1|2479658_2480366_+	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951968.1|2480424_2480859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951969.1|2481063_2482578_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012951970.1|2482638_2483997_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
>prophage 6
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	2626201	2634045	2999326		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2626201_2627173_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2627180_2628149_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2628150_2629026_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_012952017.1|2629133_2630864_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_012952018.1|2630905_2631967_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952019.1|2631983_2632967_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_003722610.1|2633085_2634045_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP007008	Listeria monocytogenes serotype 1/2a str. 04-5457, complete genome	2999326	2869001	2875526	2999326	tail	Streptococcus_pyogenes_phage(33.33%)	10	NA	NA
WP_003734720.1|2869001_2869820_-|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
WP_012952081.1|2869816_2871685_-	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_012952082.1|2871671_2872076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721745.1|2872117_2872420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721744.1|2872467_2872980_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_012952083.1|2872992_2873382_-	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003732220.1|2873659_2874076_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_003732219.1|2874087_2874516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003721740.1|2874732_2875068_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003721739.1|2875073_2875526_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
