The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	843583	920663	5244443	integrase,transposase,protease,tRNA,plate	Escherichia_phage(14.29%)	55	883453:883470	928391:928408
WP_001390300.1|843583_845386_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173975.1|845376_846309_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000198270.1|846321_848304_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	35.6	2.2e-12
WP_000005080.1|848314_848782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001390299.1|848791_849091_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001033155.1|849094_850171_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000152746.1|850178_850730_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_001154665.1|850748_852161_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001028113.1|852499_853090_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000914956.1|853095_856500_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_000029846.1|856503_859053_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.8	4.6e-92
WP_085947771.1|861597_862759_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001391950.1|863832_864051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359994.1|864529_865684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555380.1|866998_868132_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077577697.1|868171_868534_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.5	6.4e-40
WP_000555401.1|869115_870249_+|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_000624688.1|871957_872308_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001309734.1|872304_872739_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001045649.1|873710_877829_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
WP_000227970.1|878615_879692_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189118.1|880233_881742_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001254936.1|882904_884056_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
883453:883470	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000747051.1|883975_884326_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001091149.1|884395_884689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081335.1|884777_887648_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000105162.1|887650_889279_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	42.6	4.6e-85
WP_000126413.1|889288_891676_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001273465.1|891685_892666_-	ATP-binding protein	NA	A0A1B2RW50	Lymphocystis_disease_virus	30.2	4.2e-17
WP_000286652.1|892691_895541_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	39.6	2.2e-183
WP_071530044.1|896811_897027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218809.1|898524_899787_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_000234526.1|900165_900873_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839766.1|901270_903406_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|903455_904712_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001298916.1|904913_905993_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|906057_906333_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001297399.1|906360_907413_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|907573_908293_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|908292_908619_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|908802_909522_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|909697_910744_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745217.1|910860_911868_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239939.1|912022_913159_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|913151_913745_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|913752_914043_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|914039_914606_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|914623_915328_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001349546.1|915345_916326_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|916501_916918_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|916917_917481_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|917589_918540_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|918552_919284_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|919363_920071_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|920165_920663_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
928391:928408	attR	AGATGCTGTATATTCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	1161151	1168291	5244443		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1161151_1161790_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1161786_1163049_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1163045_1163954_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1164149_1164917_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141316.1|1164967_1165624_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	1.5e-50
WP_001272924.1|1165729_1168291_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	1769240	1778682	5244443		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|1769240_1770167_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1770171_1770903_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1770883_1770991_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1771050_1771782_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1772003_1773689_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1773685_1774405_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1774451_1774922_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1774962_1775424_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001351453.1|1775548_1777549_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292767.1|1777545_1778682_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
>prophage 4
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	1993864	2074905	5244443	integrase,holin,transposase,head,capsid,tail,terminase,portal,plate	Enterobacteria_phage(71.43%)	100	2038694:2038753	2075012:2075135
WP_001254922.1|1993864_1995016_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001386868.1|1996962_1997328_+	permease	NA	NA	NA	NA	NA
WP_000365556.1|1997367_1998063_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.9	3.6e-07
WP_001157246.1|1998129_1999548_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000786004.1|1999528_1999999_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212216.1|1999987_2000908_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922679.1|2001080_2001998_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2002076_2002259_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000491522.1|2004120_2004936_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2005234_2005462_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071527558.1|2005570_2005813_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103987.1|2005856_2006480_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983976.1|2006769_2007555_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2007563_2007833_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2007842_2008580_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001059114.1|2008579_2008945_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2008947_2009361_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2009357_2010362_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2010366_2010831_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620097.1|2010935_2012063_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2012059_2012503_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2012521_2013895_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|2013894_2014581_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2014573_2015569_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994471.1|2015561_2017220_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001301376.1|2017434_2017749_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2018092_2018425_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001386867.1|2018593_2019145_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879825.1|2019154_2019952_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015674555.1|2020108_2020633_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_001336494.1|2020655_2020985_+	helix-turn-helix domain-containing protein	NA	A0A1B0VCD8	Salmonella_phage	86.6	8.1e-42
WP_000334575.1|2020866_2021364_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.5	3.8e-51
WP_000790504.1|2021472_2021706_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118890.1|2021702_2022908_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2023094_2023508_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245699.1|2023541_2025029_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001057844.1|2025106_2025472_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270663.1|2025471_2025882_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146830.1|2025897_2027313_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079759.1|2027560_2028610_+	flagellin FliC	NA	NA	NA	NA	NA
WP_001087467.1|2028773_2029493_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001386865.1|2029538_2030090_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001317901.1|2030177_2030978_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128215.1|2031082_2032069_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|2032083_2032752_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_088888689.1|2032748_2033501_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
WP_001152713.1|2033730_2034453_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|2034520_2034745_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_000590344.1|2034731_2034908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611335.1|2035203_2035860_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2035856_2037689_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2037745_2038294_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2038694:2038753	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_001303543.1|2039286_2039568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|2039756_2039897_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488112.1|2040088_2040349_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132776.1|2040391_2041501_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.1	4.1e-202
WP_000005414.1|2041658_2042843_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	3.8e-222
WP_000290443.1|2042842_2043355_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_001391627.1|2043799_2043928_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_001390260.1|2043914_2046722_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|2046734_2047223_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954195.1|2047379_2047952_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144016.1|2047995_2048574_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_032251415.1|2048573_2050706_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.0	8.0e-130
WP_001430423.1|2050708_2051239_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	2.1e-92
WP_032251416.1|2051231_2052128_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	5.7e-154
WP_000213447.1|2052131_2052482_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_032251417.1|2052478_2053060_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	4.3e-102
WP_032251418.1|2053056_2053692_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	7.6e-113
WP_000921128.1|2053684_2054152_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_000202135.1|2054175_2056056_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.8e-301
WP_000780558.1|2056194_2056602_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.2e-63
WP_000072317.1|2056598_2056991_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	6.4e-70
WP_032251421.1|2056987_2057311_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	95.3	2.0e-48
WP_000864893.1|2057313_2057514_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_000063103.1|2057513_2058008_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632318.1|2058109_2058910_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055094.1|2058955_2060008_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_032251422.1|2060031_2060868_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	7.9e-150
WP_000613754.1|2061022_2062774_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087814.1|2062773_2063820_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|2063834_2064359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224227.1|2064945_2065209_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_032251424.1|2065210_2065681_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	40.0	3.2e-15
WP_000211293.1|2065700_2066015_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_032251426.1|2066019_2066979_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	3.5e-178
WP_000123437.1|2067055_2069878_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.7	0.0e+00
WP_000599403.1|2069884_2070250_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	2.1e-59
WP_000153684.1|2070391_2070637_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985145.1|2070633_2070837_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000021668.1|2070923_2071037_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514281.1|2071033_2071276_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_000159462.1|2071287_2071566_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000739029.1|2071576_2071927_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2071948_2072152_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2072223_2072361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2072450_2072855_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290355.1|2072870_2073521_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2073550_2073898_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2073903_2074905_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2075012:2075135	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 5
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	2104308	2168370	5244443	integrase,holin,transposase,lysis,tRNA,head,capsid,terminase,tail,portal	Enterobacteria_phage(51.67%)	74	2106853:2106868	2133455:2133470
WP_001025327.1|2104308_2106042_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001326063.1|2106257_2106824_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185740.1|2106837_2107584_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
2106853:2106868	attL	ATTTGCTGTTACAGCA	NA	NA	NA	NA
WP_001214304.1|2107971_2109072_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176815.1|2109096_2111526_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000399648.1|2111795_2112776_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000564745.1|2112969_2113941_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2113937_2114681_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|2114721_2115117_-	membrane protein	NA	NA	NA	NA	NA
WP_044713004.1|2115169_2115940_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362003.1|2115921_2117232_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.4	3.0e-244
WP_000528718.1|2117287_2117524_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2117532_2117679_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2117682_2117925_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000628772.1|2118009_2118768_-	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.0	2.7e-109
WP_000065512.1|2119281_2119830_-	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	97.5	1.4e-59
WP_000476207.1|2119826_2120066_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|2120058_2120262_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242713.1|2120258_2120621_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000008178.1|2120611_2121148_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_000081306.1|2121275_2122100_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.9	1.1e-148
WP_000179185.1|2122165_2122528_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	7.5e-57
WP_001387485.1|2123230_2123923_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	6.4e-121
WP_001191669.1|2124020_2124281_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526669.1|2124273_2124831_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.1	5.3e-94
WP_001087340.1|2124827_2125973_+	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_000620687.1|2125969_2126194_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|2126190_2127009_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|2127005_2127500_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|2127499_2128153_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|2128149_2128476_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|2128472_2128868_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|2129030_2129846_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|2129853_2130843_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001205470.1|2130860_2131217_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	92.0	2.3e-58
WP_000150292.1|2131196_2132411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000355468.1|2132413_2133589_-	hypothetical protein	NA	NA	NA	NA	NA
2133455:2133470	attR	ATTTGCTGTTACAGCA	NA	NA	NA	NA
WP_000917737.1|2133855_2134053_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000301785.1|2134187_2134901_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874454.1|2135667_2137629_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.2	3.9e-240
WP_000142785.1|2137764_2137959_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	9.4e-22
WP_001289722.1|2137984_2138254_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	74.2	8.2e-08
WP_000284510.1|2138329_2138545_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000731267.1|2138549_2138894_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.4	7.2e-57
WP_001092883.1|2138944_2139478_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_001082546.1|2139776_2140244_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.4e-78
WP_000347013.1|2140594_2140735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015674556.1|2140867_2141053_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	81.4	4.1e-19
WP_000867568.1|2141447_2141996_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001390579.1|2141967_2143896_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.6	7.4e-260
WP_000259002.1|2143879_2144086_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831738.1|2144082_2145675_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	4.2e-184
WP_001254006.1|2145664_2147170_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_000256796.1|2147206_2147554_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522645.1|2147611_2148640_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	1.1e-113
WP_001390684.1|2148692_2149061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204567.1|2149053_2149407_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000975015.1|2149422_2150001_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	90.6	4.9e-74
WP_000683112.1|2149997_2150393_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_001401350.1|2150400_2151141_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479153.1|2151156_2151579_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459468.1|2151560_2151995_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_000840228.1|2151987_2154549_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000847379.1|2154545_2154875_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152493.1|2154874_2155573_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.8e-132
WP_000194780.1|2155577_2156321_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2156257_2156890_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515636.1|2156950_2160430_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001580506.1|2160497_2161097_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	95.5	1.0e-106
WP_000216489.1|2161248_2164419_+	hypothetical protein	NA	X2KTY7	Enterobacteria_phage	59.1	1.3e-83
WP_000885566.1|2164418_2165003_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	4.3e-102
WP_001217553.1|2165118_2165367_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000891610.1|2165721_2166288_-	hydrolase	NA	NA	NA	NA	NA
WP_001258662.1|2166597_2168370_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	2401534	2538676	5244443	integrase,holin,lysis,protease,capsid,tRNA,head,terminase,tail,portal	Escherichia_phage(34.41%)	156	2433427:2433442	2493760:2493777
WP_001339629.1|2401534_2402809_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|2402870_2403731_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2403774_2404380_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100951.1|2404485_2405988_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030339.1|2406598_2407234_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2407233_2407929_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920778.1|2407932_2408553_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|2408556_2409615_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915770.1|2409615_2411742_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2411734_2412313_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2412312_2412894_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|2412970_2413411_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2413496_2413712_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|2413984_2414110_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2414352_2415393_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|2415427_2416429_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459416.1|2416532_2417705_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125609.1|2417714_2419307_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|2419481_2420510_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483362.1|2420621_2421389_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969095.1|2421617_2422208_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000945924.1|2422596_2424408_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075893.1|2424404_2425778_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227018.1|2425816_2427082_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043342.1|2427126_2428635_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170701.1|2428735_2429911_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066636.1|2430109_2431756_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2431898_2433302_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001387709.1|2433298_2434228_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
2433427:2433442	attL	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_000732487.1|2434303_2435605_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
2433427:2433442	attL	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_001092504.1|2435608_2436328_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2436456_2436792_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|2436788_2437511_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412392.1|2437547_2438930_-	bifunctional siderophore receptor/adhesin Iha	NA	NA	NA	NA	NA
WP_000769322.1|2439115_2440060_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|2440583_2442116_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2442126_2443515_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085276.1|2444621_2445851_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953272.1|2446216_2446405_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_088888692.1|2446462_2447488_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_032346737.1|2447480_2447942_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|2447938_2448169_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336138.1|2448158_2448380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|2448372_2448738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|2448730_2448964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088888693.1|2448956_2449190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770179.1|2449195_2449495_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761836.1|2449491_2451246_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000557476.1|2451534_2451813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126693.1|2451809_2452220_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233313.1|2452232_2452505_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137337.1|2452792_2453950_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000504056.1|2453989_2454562_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001366055.1|2454599_2455775_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	3.7e-185
WP_001020662.1|2455771_2456110_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000134109.1|2456106_2456403_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001145905.1|2456402_2456843_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
2456645:2456660	attR	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_000113645.1|2457131_2457488_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
2456645:2456660	attR	CATTATCCCGATTAAT	NA	NA	NA	NA
WP_001560954.1|2457471_2459133_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000133423.1|2459146_2459428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|2460425_2460596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2460702_2461068_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2461054_2461384_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260841.1|2461422_2462244_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2462343_2462427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2462519_2462855_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091806.1|2463251_2464505_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019532.1|2464611_2465505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2465639_2466860_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2466984_2467680_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071820512.1|2467695_2468925_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2469083_2469698_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2469740_2470595_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|2470596_2471151_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001387389.1|2471188_2472352_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.7	3.8e-227
WP_126502590.1|2472207_2472654_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.9	1.9e-41
WP_000497817.1|2472613_2472865_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	91.6	3.9e-36
WP_000186783.1|2472916_2473594_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	3.0e-131
WP_000100829.1|2473590_2474376_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	97.3	9.4e-145
WP_000995032.1|2474381_2474678_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_001271587.1|2474674_2476747_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	87.2	0.0e+00
WP_000660961.1|2476854_2477241_-	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_000560214.1|2477324_2477546_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	94.4	1.1e-34
WP_000189938.1|2478002_2478212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005964.1|2478180_2478540_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	73.5	2.7e-38
WP_001140061.1|2478571_2478757_-	hypothetical protein	NA	V5URU3	Shigella_phage	97.8	1.9e-16
WP_000256291.1|2478967_2479273_-	hypothetical protein	NA	C6ZCW1	Enterobacteria_phage	83.5	1.4e-35
WP_000502040.1|2479606_2479828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846393.1|2479981_2480689_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	99.6	7.9e-127
WP_001054988.1|2480799_2481024_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	100.0	1.2e-36
WP_000084293.1|2481140_2481437_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	99.0	1.2e-47
WP_000438870.1|2481451_2481670_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_001390692.1|2481690_2482773_+	hypothetical protein	NA	V5URT9	Shigella_phage	96.7	1.8e-199
WP_000790392.1|2482779_2483520_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	87.4	2.3e-121
WP_000450864.1|2483545_2484316_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	82.4	8.1e-109
WP_001118163.1|2484331_2484727_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.9	2.0e-31
WP_000206792.1|2484783_2485368_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001278450.1|2485483_2485588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887482.1|2485776_2485989_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	62.9	8.4e-16
WP_000119356.1|2486198_2486378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818160.1|2486396_2486882_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000042397.1|2486932_2487250_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000290554.1|2487955_2488621_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	79.2	1.9e-90
WP_001076834.1|2488675_2489086_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	98.5	3.9e-70
WP_001254267.1|2489082_2489265_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	91.7	2.4e-27
WP_000211434.1|2489539_2490223_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	85.7	2.3e-107
WP_001004035.1|2490297_2491020_+	DNA-binding protein	NA	A0A0N7KZI6	Stx2-converting_phage	97.5	1.7e-124
WP_000002252.1|2491019_2491310_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	96.9	9.3e-50
WP_001008115.1|2491306_2491669_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	98.3	9.2e-63
WP_000992060.1|2491668_2491863_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204886.1|2491855_2492290_+	antitermination protein	NA	G9L695	Escherichia_phage	98.6	2.4e-81
WP_000874467.1|2493055_2494966_+	SASA family carbohydrate esterase	NA	A0A0N7CGH9	Escherichia_phage	74.8	4.9e-280
WP_000142783.1|2495105_2495288_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	91.7	1.6e-23
WP_001290235.1|2495313_2495559_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	86.4	9.1e-14
WP_000284506.1|2495635_2495851_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087450.1|2495855_2496389_+	lysozyme	NA	A0A088CC28	Shigella_phage	91.5	5.6e-93
WP_000675931.1|2496609_2496723_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_077627825.1|2496944_2497130_+|lysis	lysis protein	lysis	A0A0P0ZDR7	Stx2-converting_phage	96.7	2.8e-23
WP_000934362.1|2497263_2497845_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	100.0	6.7e-47
WP_001086085.1|2498447_2499263_+|terminase	terminase	terminase	A0A2L1IV66	Escherichia_phage	99.6	6.6e-125
WP_001387707.1|2499243_2500950_+|terminase	terminase	terminase	A0A2L1IV76	Escherichia_phage	99.1	0.0e+00
WP_032188285.1|2500949_2503094_+	hypothetical protein	NA	A0A088CE71	Shigella_phage	100.0	0.0e+00
WP_000345000.1|2503251_2504259_+	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	92.8	1.3e-167
WP_000214481.1|2504281_2505496_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	97.0	4.7e-228
WP_001140435.1|2505550_2505940_+	hypothetical protein	NA	V5UT93	Shigella_phage	97.7	1.9e-61
WP_001290746.1|2505990_2506452_+	hypothetical protein	NA	A0A2L1IV43	Escherichia_phage	96.7	1.1e-68
WP_000829400.1|2506435_2506999_+	hypothetical protein	NA	A0A2L1IV64	Escherichia_phage	99.5	8.3e-103
WP_000207928.1|2506998_2507649_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	98.6	1.2e-118
WP_000117972.1|2507645_2509661_+|tail	tail fiber protein	tail	V5USF3	Shigella_phage	63.8	1.3e-78
WP_000537686.1|2509743_2510289_+	hypothetical protein	NA	A0A088CD67	Shigella_phage	99.4	2.0e-93
WP_000276176.1|2510301_2510529_+	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	98.7	2.6e-39
WP_001146334.1|2510869_2512495_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	97.0	0.0e+00
WP_000038923.1|2512491_2513766_+	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	92.2	5.3e-206
WP_000455632.1|2513780_2514059_+	hypothetical protein	NA	A0A2L1IV69	Escherichia_phage	98.9	9.9e-49
WP_000274301.1|2514064_2514682_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	99.5	5.7e-121
WP_032179509.1|2514808_2515546_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	100.0	1.2e-136
WP_000078907.1|2515778_2515919_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_050487963.1|2515975_2516377_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.2	3.5e-71
WP_088888694.1|2516468_2517125_+	hypothetical protein	NA	A0A0H4IPM7	Shigella_phage	99.1	9.7e-103
WP_000455654.1|2517127_2517574_+	hypothetical protein	NA	V5UT82	Shigella_phage	97.3	9.9e-75
WP_000540392.1|2517583_2517835_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012440.1|2517845_2519111_+	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	94.5	8.2e-191
WP_000331665.1|2519179_2527534_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.6	0.0e+00
WP_000481379.1|2527657_2527849_+	hypothetical protein	NA	A0A088CD78	Shigella_phage	95.2	8.0e-26
WP_000628749.1|2527935_2528664_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	55.1	6.1e-82
WP_001289973.1|2529177_2529663_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.1e-42
WP_088888695.1|2529659_2530346_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.8e-38
WP_001390689.1|2530332_2530647_-	hypothetical protein	NA	B1GS43	Salmonella_phage	84.9	4.0e-38
WP_001024845.1|2530600_2530918_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	96.7	2.2e-44
WP_000763353.1|2530914_2531136_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000107181.1|2531183_2531816_-	hypothetical protein	NA	A0A088CBR4	Shigella_phage	68.2	7.3e-47
WP_000211519.1|2532070_2532700_-	phage antirepressor Ant	NA	A0A0P0ZCA2	Stx2-converting_phage	86.6	4.5e-97
WP_000184487.1|2532949_2533234_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	85.1	4.0e-45
WP_000213043.1|2533641_2533755_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001342404.1|2533765_2536189_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041536.1|2536249_2538676_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 7
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	2826552	2888022	5244443	integrase,holin,protease,capsid,head,tail,terminase,portal	Enterobacteria_phage(41.18%)	73	2876866:2876880	2895621:2895635
WP_000422045.1|2826552_2827602_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|2827821_2828580_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|2828576_2829167_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2829206_2830079_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2830179_2830800_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2830796_2831678_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|2831815_2831860_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194599.1|2831951_2833514_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2833513_2835109_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2835112_2836471_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2836482_2837676_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443069.1|2837675_2838482_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2838862_2839042_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2839127_2839628_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2839673_2840180_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000926528.1|2840953_2841223_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_000240999.1|2841279_2841948_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885576.1|2842002_2842587_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	1.7e-103
WP_000216502.1|2842586_2845421_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	59.1	5.7e-83
WP_001228314.1|2845572_2846172_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	97.0	9.1e-108
WP_000515776.1|2846239_2849719_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001332187.1|2849785_2850124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090879.1|2850197_2850800_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140761.1|2850736_2851480_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	1.8e-145
WP_001152522.1|2851484_2852183_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000847402.1|2852182_2852512_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_000082358.1|2852508_2855082_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.9	0.0e+00
WP_000533402.1|2855062_2855476_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|2855502_2855934_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235040.1|2855947_2856700_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.7e-132
WP_000683079.1|2856707_2857103_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974999.1|2857099_2857675_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	9.2e-49
WP_001204198.1|2857689_2858043_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	3.0e-42
WP_000201506.1|2858035_2858404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522596.1|2858455_2859484_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.4	2.8e-112
WP_000256823.1|2859541_2859889_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253926.1|2859925_2861431_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.8	3.0e-99
WP_001387697.1|2861420_2863013_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.8e-185
WP_000259002.1|2863009_2863216_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_088888698.1|2863199_2865170_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	1.6e-262
WP_000867569.1|2865099_2865648_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000240372.1|2866048_2866453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343118.1|2866906_2867194_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	58.9	4.0e-29
WP_001390467.1|2867272_2867425_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	2.8e-21
WP_001228710.1|2867453_2867660_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	95.6	2.9e-29
WP_032159578.1|2867881_2867968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092853.1|2868522_2869056_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	8.7e-102
WP_000731197.1|2869098_2869905_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	94.8	3.3e-145
WP_000284510.1|2869909_2870125_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874307.1|2870275_2872129_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
WP_000871291.1|2872389_2872725_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|2873005_2873137_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_000935536.1|2873935_2874985_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917746.1|2875135_2875333_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	1.4e-28
WP_000762880.1|2875559_2876381_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000904106.1|2876377_2876752_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.8e-36
WP_001265083.1|2876764_2877811_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.9e-110
2876866:2876880	attL	GCTCGTTGTGATGCT	NA	NA	NA	NA
WP_001329966.1|2877812_2878085_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|2878252_2878465_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2878645_2879311_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151211.1|2879485_2879911_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	1.3e-63
WP_000095671.1|2879951_2880914_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693888.1|2880936_2881362_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2881358_2881613_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2881692_2882112_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379548.1|2882408_2882561_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394541.1|2882572_2882911_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.5e-06
WP_012601410.1|2882899_2883166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2883660_2883849_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2883845_2884037_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048530.1|2884129_2886601_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.2	1.8e-56
WP_000113189.1|2886665_2886914_+	excisionase	NA	NA	NA	NA	NA
WP_000113684.1|2886891_2888022_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.4e-103
2895621:2895635	attR	GCTCGTTGTGATGCT	NA	NA	NA	NA
>prophage 8
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	3247066	3353607	5244443	integrase,holin,lysis,protease,terminase,tail,portal	Escherichia_phage(62.14%)	122	3251740:3251799	3352682:3352743
WP_000003662.1|3247066_3247654_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3247650_3248358_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3248376_3250170_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3250166_3251285_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3251740:3251799	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_022581964.1|3251939_3252269_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_088888702.1|3252536_3254450_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.6	6.8e-173
WP_088888703.1|3254600_3255224_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	1.8e-66
WP_088888704.1|3255292_3258988_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	80.8	0.0e+00
WP_131199704.1|3259234_3259867_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	2.1e-99
WP_088888705.1|3259812_3260556_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	4.3e-147
WP_001484085.1|3260566_3261265_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	6.8e-131
WP_000847280.1|3261264_3261594_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_088888706.1|3261590_3264239_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.9	0.0e+00
WP_000532075.1|3264282_3264591_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479054.1|3264617_3265040_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_088888707.1|3265055_3265805_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.4	9.9e-136
WP_000682704.1|3265812_3266211_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|3266220_3266847_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281347.1|3266849_3267131_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_088888708.1|3267123_3267450_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_157787306.1|3267537_3269517_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|3269506_3271009_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3271008_3271221_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_088888709.1|3271217_3273341_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
WP_016236020.1|3273337_3273814_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_000735655.1|3274271_3274496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088888710.1|3274519_3274987_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	85.8	3.3e-65
WP_088888711.1|3274983_3275517_-	lysozyme	NA	S5MQK2	Escherichia_phage	96.6	1.1e-99
WP_088888739.1|3275553_3276111_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.6	3.1e-49
WP_000284510.1|3276114_3276330_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_088888712.1|3276407_3276653_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	2.5e-19
WP_000143458.1|3276693_3276873_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_088888713.1|3277008_3278955_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.8	0.0e+00
WP_000738072.1|3279460_3279730_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_001365678.1|3279741_3280701_-	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_088888714.1|3281083_3282142_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	4.3e-193
WP_000917768.1|3282292_3282490_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000640044.1|3282706_3283267_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_021577231.1|3283275_3283635_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	8.0e-35
WP_062881283.1|3283647_3284697_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.5e-110
WP_088888715.1|3284698_3284971_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.0e-10
WP_001398985.1|3285137_3285350_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_028985605.1|3285583_3286099_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_001224672.1|3286264_3286447_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_157787302.1|3286539_3286938_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.4e-56
WP_001369935.1|3286873_3287200_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	88.5	2.0e-24
WP_001289674.1|3287200_3287512_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	1.1e-48
WP_001376361.1|3287498_3287804_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	2.9e-49
WP_087614068.1|3287800_3288082_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	7.9e-30
WP_088888717.1|3288114_3288831_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.0	5.7e-72
WP_001379651.1|3288864_3289287_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_157787303.1|3289318_3290350_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	70.4	8.1e-88
WP_000693925.1|3290418_3290844_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047083516.1|3290827_3291103_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	51.2	2.4e-15
WP_033812093.1|3291210_3291711_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_033812094.1|3291728_3291920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033812095.1|3291919_3292210_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380319.1|3292478_3292631_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_077637644.1|3292786_3293044_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_024213805.1|3293124_3293310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3293854_3294043_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_086163675.1|3294039_3294228_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088888718.1|3294320_3296723_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.6	3.7e-176
WP_000273163.1|3296789_3297041_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001367167.1|3297009_3298029_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_022581964.1|3298370_3298700_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_088888702.1|3298967_3300881_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.6	6.8e-173
WP_088888703.1|3301031_3301655_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	1.8e-66
WP_088888704.1|3301723_3305419_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	80.8	0.0e+00
WP_131199704.1|3305664_3306297_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	2.1e-99
WP_088888705.1|3306242_3306986_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	4.3e-147
WP_001484085.1|3306996_3307695_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.4	6.8e-131
WP_000847280.1|3307694_3308024_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_000532075.1|3310711_3311020_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479054.1|3311046_3311469_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_088888707.1|3311484_3312234_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	98.4	9.9e-136
WP_157787304.1|3316516_3316750_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	89.3	2.8e-28
WP_095413461.1|3319415_3319739_-	hypothetical protein	NA	S5MDQ1	Escherichia_phage	100.0	7.4e-48
WP_000682704.1|3321784_3322183_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|3322192_3322819_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281347.1|3322821_3323103_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_088888708.1|3323095_3323422_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	1.8e-49
WP_157787306.1|3323509_3325489_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|3325478_3326981_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|3326980_3327193_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_088888709.1|3327189_3329313_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
WP_016236020.1|3329309_3329786_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_012816791.1|3330299_3330485_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092875.1|3331003_3331537_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_001041949.1|3332048_3332840_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284506.1|3332843_3333059_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_088888722.1|3333429_3335403_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	78.2	2.6e-300
WP_000216624.1|3335907_3336072_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_001380362.1|3336068_3336500_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000483502.1|3336961_3338020_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000917735.1|3338170_3338368_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|3338583_3338964_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_088888723.1|3338981_3340031_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.5	1.4e-116
WP_088888715.1|3340032_3340305_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.0e-10
WP_001398985.1|3340471_3340684_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_028985605.1|3340917_3341433_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_001224672.1|3341598_3341781_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_157787302.1|3341873_3342272_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.4e-56
WP_001369935.1|3342207_3342534_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	88.5	2.0e-24
WP_001289674.1|3342534_3342846_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	1.1e-48
WP_001376361.1|3342832_3343138_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.1	2.9e-49
WP_087614068.1|3343134_3343416_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	7.9e-30
WP_088888724.1|3343448_3344165_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.1e-72
WP_033883297.1|3344198_3344621_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.3	7.4e-72
WP_033882677.1|3344652_3345663_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.5	3.7e-170
WP_000693933.1|3345749_3346187_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.0e-28
WP_000391952.1|3346170_3346452_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362156.1|3346553_3346973_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	66.3	1.4e-25
WP_088888725.1|3347238_3347394_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.0e-06
WP_042343674.1|3347553_3347772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122994669.1|3347775_3347901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3348329_3348518_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_086163675.1|3348514_3348703_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_088888727.1|3348795_3351234_+	exonuclease	NA	V5UQJ3	Shigella_phage	44.4	1.3e-107
WP_000273163.1|3351300_3351552_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001367167.1|3351520_3352540_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000375136.1|3352947_3353607_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3352682:3352743	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	3366066	3423714	5244443	integrase,transposase,protease,head,tail,plate	Shigella_phage(57.89%)	72	3364116:3364132	3417998:3418014
3364116:3364132	attL	TTTTTTCATATGCCTGA	NA	NA	NA	NA
WP_000156526.1|3366066_3367827_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_001386684.1|3367895_3368414_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3368483_3368651_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759123.1|3368906_3369470_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|3369466_3371107_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|3371111_3372365_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053089.1|3372494_3374402_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
WP_001086517.1|3374412_3376521_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000258204.1|3376764_3377874_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|3377870_3378413_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3378586_3379597_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001307090.1|3379707_3380418_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919489.1|3380410_3380926_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|3380933_3381476_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165657.1|3381487_3382558_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000077538.1|3384849_3385380_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	61.7	1.1e-35
WP_001310454.1|3385569_3385818_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289277.1|3385819_3387910_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	3.0e-166
WP_000129797.1|3387981_3388914_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.0	4.8e-71
WP_000560046.1|3388916_3389138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|3389150_3389405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827936.1|3389406_3389688_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049398.1|3389684_3389987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049308.1|3389961_3390255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129560.1|3390266_3390797_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.6	4.2e-48
WP_000323221.1|3390894_3391437_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000564282.1|3391440_3391974_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	1.8e-67
WP_000465557.1|3391973_3392489_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	1.3e-46
WP_000977064.1|3392492_3393044_+	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_000595949.1|3393040_3393226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021236.1|3393264_3393597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086885.1|3393589_3393787_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	36.2	5.6e-06
WP_000378478.1|3393776_3394073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214355.1|3394069_3394579_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	46.8	2.8e-25
WP_000852373.1|3394649_3395072_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125312.1|3395143_3395644_+	lysozyme	NA	A0A2H4J3P8	uncultured_Caudovirales_phage	42.0	6.6e-27
WP_001388992.1|3395678_3396107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048657292.1|3396036_3396309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342741.1|3396319_3396547_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270160.1|3396527_3396839_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|3396831_3397122_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_088888728.1|3397124_3397706_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	3.2e-49
WP_000255659.1|3397716_3397965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030238.1|3397964_3399629_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000532599.1|3399628_3401218_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	58.1	8.5e-169
WP_000046202.1|3401201_3402533_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.5	6.4e-154
WP_000094810.1|3402654_3403128_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.7e-37
WP_000850814.1|3403305_3404430_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	46.5	5.0e-75
WP_001142988.1|3404429_3405377_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.9	2.7e-122
WP_001002063.1|3405420_3405780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104960.1|3405776_3406196_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	54.3	6.1e-34
WP_000627436.1|3406192_3406756_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.1	4.8e-42
WP_000207437.1|3406759_3407038_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_000606778.1|3407037_3408540_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	2.7e-132
WP_000015469.1|3408548_3408914_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213225.1|3408928_3409405_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|3409531_3411607_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146118.1|3411593_3412943_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098806.1|3412926_3414051_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	47.7	1.7e-94
WP_072105406.1|3414040_3414655_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.3	2.5e-52
WP_000763299.1|3414647_3415085_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	56.9	7.7e-40
WP_001146839.1|3415084_3416167_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	8.2e-99
WP_000301578.1|3416157_3416718_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_032184567.1|3416717_3417608_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	39.9	1.3e-28
WP_000421093.1|3417659_3418181_+|tail	tail protein	tail	A0A0U2QV64	Escherichia_phage	49.1	8.6e-46
3417998:3418014	attR	TCAGGCATATGAAAAAA	NA	NA	NA	NA
WP_000904914.1|3418641_3419214_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	76.9	1.3e-74
WP_001284084.1|3419299_3421354_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	64.9	1.3e-233
WP_000143467.1|3421498_3421681_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	54.4	2.2e-09
WP_001114101.1|3421716_3421971_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001388991.1|3422046_3422247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001388990.1|3422822_3423023_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528247.1|3422976_3423714_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	3.7e-103
>prophage 10
NZ_CP016828	Escherichia coli strain FORC_043 chromosome, complete genome	5244443	4174216	4236542	5244443	tRNA,protease,plate,transposase	Cronobacter_phage(12.5%)	51	NA	NA
WP_000611748.1|4174216_4174630_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393853.1|4174633_4176484_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4176447_4177530_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|4177554_4178835_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4178831_4179356_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|4179358_4180690_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343303.1|4180694_4181456_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614396.1|4181464_4184224_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	9.4e-83
WP_000088873.1|4184220_4184964_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240544.1|4184968_4186384_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122987046.1|4186492_4189927_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|4189937_4191290_+	membrane protein	NA	NA	NA	NA	NA
WP_001284200.1|4191313_4191796_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|4191839_4192754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4192763_4193243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4193379_4194165_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|4194700_4195432_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917888.1|4195496_4195964_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298887.1|4195960_4196683_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052751.1|4196716_4197472_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4197543_4198902_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211710.1|4198949_4199720_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4199797_4200598_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648601.1|4200838_4201753_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997043.1|4201749_4202553_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140174.1|4208450_4209023_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4209210_4210242_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4210234_4210888_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4210927_4211743_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4211860_4212265_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4212261_4212969_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|4213080_4214799_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|4215878_4216859_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239154.1|4217108_4217819_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4217832_4218255_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|4218251_4218797_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4218962_4219163_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4219149_4219410_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|4219458_4220757_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4220821_4221211_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|4221267_4223409_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4223507_4224467_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|4224479_4227962_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4227998_4228595_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|4228591_4229740_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4229739_4230528_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4230531_4230987_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4231091_4232117_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4232120_4232606_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4232727_4235160_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001346129.1|4235189_4236542_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP023552	Escherichia coli strain FORC_043 plasmid pFORC43, complete sequence	77422	22632	56012	77422	transposase,protease,integrase	Escherichia_phage(27.27%)	28	29510:29528	38922:38940
WP_001388582.1|22632_23373_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.7	3.5e-24
WP_001388581.1|23657_24635_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000422741.1|25647_26073_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|26069_26420_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000555401.1|28128_29262_-|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
29510:29528	attL	AAGCGTCAATACGGTGCTC	NA	NA	NA	NA
WP_000813634.1|29872_30091_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|30092_30398_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016979.1|30398_31208_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_000239529.1|31345_31621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633911.1|31614_32259_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103689.1|32487_33459_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	43.3	3.3e-67
WP_000340832.1|33463_33856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|35288_36797_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032142224.1|37105_37477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000702698.1|39043_39796_+	aggregative adherence fimbria 3 chaperone Agg3D	NA	NA	NA	NA	NA
38922:38940	attR	AAGCGTCAATACGGTGCTC	NA	NA	NA	NA
WP_001390764.1|42409_42850_+	aggregative adherence fimbria 3 minor subunit Agg3B	NA	NA	NA	NA	NA
WP_100138626.1|43024_43525_+	aggregative adherence fimbria 3 major subunit Agg3A	NA	NA	NA	NA	NA
WP_012602932.1|43573_43801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000869859.1|45176_46205_+	class 1 isoprenoid biosynthesis enzyme	NA	NA	NA	NA	NA
WP_001387337.1|46208_46748_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000769457.1|49179_49977_-	aggregative adherence transcriptional regulator AggR	NA	NA	NA	NA	NA
WP_077628273.1|50311_50455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721276.1|50816_51167_-	dispersin Aap	NA	NA	NA	NA	NA
WP_000643555.1|51897_52098_+	AggR-activated transcriptional regulator Aar	NA	NA	NA	NA	NA
WP_001441124.1|53624_53780_+|protease	serine protease SepA autotransporter	protease	NA	NA	NA	NA
WP_000546071.1|54663_55413_+|protease	serine protease	protease	Q9LA58	Enterobacterial_phage	58.2	5.8e-51
WP_000239755.1|55384_55621_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	63.8	2.0e-18
WP_001388597.1|55763_56012_-|transposase	IS3 family transposase	transposase	A0A0N7BVE9	Escherichia_phage	83.8	4.0e-25
