The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	2669435	2757468	6437015	tRNA,tail,plate,head,portal,protease,holin,integrase,transposase,terminase,capsid	Brevibacillus_phage(29.41%)	102	2703171:2703203	2745166:2745198
WP_157696764.1|2669435_2670875_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088907945.1|2670816_2671584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907946.1|2671599_2672967_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088907947.1|2673212_2674103_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007718970.1|2674805_2675069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088907948.1|2675227_2675866_+	FusB/FusC family EF-G-binding protein	NA	NA	NA	NA	NA
WP_088907949.1|2675928_2676444_-	ATPase	NA	NA	NA	NA	NA
WP_088907950.1|2676475_2676820_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088910929.1|2676992_2677973_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088907951.1|2678068_2678575_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157696765.1|2679874_2680012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083995000.1|2681495_2681582_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_088907954.1|2682091_2682574_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088907955.1|2683110_2684103_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088907956.1|2685260_2686292_-	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_088907957.1|2688493_2688910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088907958.1|2689371_2689674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088907959.1|2690012_2690960_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088907960.1|2691323_2691962_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_157696766.1|2691964_2692108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907961.1|2692212_2693010_+	putative protein N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_088907963.1|2694196_2694574_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	34.6	1.8e-13
WP_167385087.1|2695004_2695208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907964.1|2695363_2695846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907966.1|2696810_2697113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088907967.1|2697689_2698199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157696767.1|2698341_2698491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907968.1|2699067_2699376_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_088907969.1|2699580_2699892_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_088907970.1|2700702_2701248_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088907971.1|2702023_2702848_+	hypothetical protein	NA	NA	NA	NA	NA
2703171:2703203	attL	TTTGTGGGTGATTTGTGGGTGCGTTTGTGGGTG	NA	NA	NA	NA
WP_088907972.1|2703284_2703614_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_088910930.1|2704612_2704957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088907973.1|2705344_2706031_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	77.9	1.2e-66
WP_088907974.1|2706030_2706318_-|holin	holin	holin	NA	NA	NA	NA
WP_088907975.1|2706314_2706680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907976.1|2706847_2708182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907977.1|2708199_2708742_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_088907978.1|2708734_2709793_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	41.0	1.3e-59
WP_088907979.1|2709792_2710098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907980.1|2710097_2710535_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_088910931.1|2710531_2710969_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_088907981.1|2711007_2712024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088910932.1|2712028_2712442_-	hypothetical protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	36.3	3.5e-10
WP_088907982.1|2712462_2714283_-	tape measure protein	NA	M1HMP3	Bacillus_virus	33.8	1.6e-30
WP_088907983.1|2714496_2714886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907984.1|2714912_2715344_-|tail	phage tail tube protein	tail	A0A0A8WF55	Clostridium_phage	38.5	7.7e-16
WP_088907985.1|2715363_2716422_-|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	45.8	7.8e-70
WP_088907986.1|2716434_2716857_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_088907987.1|2716849_2717284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907988.1|2717285_2717609_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	40.5	1.4e-06
WP_088907989.1|2717605_2717902_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7SBZ6	Paenibacillus_phage	57.4	2.6e-23
WP_088907990.1|2717882_2718230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907991.1|2718287_2719475_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	65.3	9.5e-141
WP_088910934.1|2719511_2720093_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	83.1	3.9e-87
WP_088910933.1|2720076_2721390_-|portal	phage portal protein	portal	A0A2I7SBY0	Paenibacillus_phage	75.2	1.1e-195
WP_088907992.1|2721447_2723043_-|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	80.0	5.2e-267
WP_088907993.1|2723032_2723641_-|terminase	terminase	terminase	A0A2I7SBY3	Paenibacillus_phage	84.1	1.6e-91
WP_088907994.1|2723660_2724176_-	hypothetical protein	NA	A0A2H4J6F5	uncultured_Caudovirales_phage	40.8	3.0e-22
WP_088910935.1|2724268_2724661_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	56.2	8.8e-35
WP_088907995.1|2724795_2725335_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	51.4	1.6e-42
WP_157696768.1|2725380_2726625_-	DEAD/DEAH box helicase	NA	A0A2I7QIK9	Bacillus_phage	68.9	1.8e-166
WP_088907996.1|2726757_2727261_-	HNH endonuclease	NA	A0A2I7QIM4	Bacillus_phage	39.2	2.4e-21
WP_088907997.1|2727250_2727538_-	VRR-NUC domain-containing protein	NA	S5MUC8	Brevibacillus_phage	57.5	1.3e-19
WP_088907998.1|2727530_2727770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088907999.1|2728054_2730397_-	virulence protein E	NA	S5M5Y2	Brevibacillus_phage	62.6	2.2e-298
WP_088908000.1|2730436_2730808_-	hypothetical protein	NA	A0A0A0YSW1	Flavobacterium_phage	32.8	2.4e-10
WP_088908001.1|2730826_2731060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908002.1|2731096_2731474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908003.1|2731819_2732125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908004.1|2732242_2732788_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_088908005.1|2732875_2733268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908006.1|2733281_2733464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908007.1|2733552_2733735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908008.1|2733829_2735788_-	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	58.7	2.0e-220
WP_088910936.1|2736066_2736660_-	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	69.4	1.6e-67
WP_088908010.1|2736835_2738032_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	54.2	6.7e-110
WP_088908011.1|2738028_2738481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908012.1|2738753_2738933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908013.1|2738972_2739203_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	48.1	4.5e-07
WP_157696770.1|2739199_2739496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088910937.1|2739611_2739848_-	group-specific protein	NA	S5MC08	Brevibacillus_phage	65.8	1.8e-27
WP_088908015.1|2739941_2740187_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088908016.1|2740356_2740692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088908017.1|2741309_2742536_-	transcriptional regulator	NA	S5MC02	Brevibacillus_phage	30.0	5.2e-49
WP_088908018.1|2742754_2743564_-	helix-turn-helix domain-containing protein	NA	S5M5V5	Brevibacillus_phage	62.2	3.0e-85
WP_088908019.1|2743765_2743975_+	helix-turn-helix domain-containing protein	NA	S5MNP8	Brevibacillus_phage	59.4	6.8e-18
WP_088908020.1|2744031_2745165_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	67.8	9.6e-66
WP_088908021.1|2745270_2746605_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.3	9.7e-09
2745166:2745198	attR	TTTGTGGGTGATTTGTGGGTGCGTTTGTGGGTG	NA	NA	NA	NA
WP_007719086.1|2746640_2747051_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088908022.1|2747219_2748497_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_088910938.1|2748504_2749797_-	GTPase HflX	NA	NA	NA	NA	NA
WP_088908023.1|2749882_2750800_-	RNA ligase family protein	NA	U5J9W3	Bacillus_phage	57.8	1.8e-91
WP_088908024.1|2750898_2751195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908025.1|2751339_2752290_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	46.4	1.2e-58
WP_088908026.1|2752349_2753102_-	DUF4184 family protein	NA	NA	NA	NA	NA
WP_088908027.1|2753123_2753609_-	translation initiation factor IF-3	NA	NA	NA	NA	NA
WP_167385169.1|2753860_2754277_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088908029.1|2754324_2755557_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_088908030.1|2755669_2756101_+	VOC family protein	NA	NA	NA	NA	NA
WP_007719110.1|2756239_2756479_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_088908031.1|2756508_2757468_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	2874968	2934930	6437015	tRNA,tail,portal,protease,capsid,holin,terminase	Bacillus_phage(26.92%)	68	NA	NA
WP_088908113.1|2874968_2876390_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	26.5	1.3e-40
WP_015891764.1|2876386_2876929_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_088908114.1|2876944_2877886_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	32.2	4.3e-35
WP_088908115.1|2877947_2879261_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_088908116.1|2879300_2881379_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	36.1	5.6e-104
WP_088908117.1|2881485_2882604_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_015891769.1|2882738_2883641_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016743310.1|2883794_2884955_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_088908118.1|2885141_2886197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908119.1|2886233_2887127_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_088908120.1|2887211_2887550_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088908121.1|2887621_2887936_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_088908122.1|2888059_2888872_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_017249346.1|2888868_2889225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908123.1|2889254_2889977_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088908124.1|2890470_2890779_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_157696841.1|2891400_2891550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908126.1|2891674_2891950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088910941.1|2892791_2893055_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYN0	Paenibacillus_phage	36.4	1.9e-09
WP_088908127.1|2893205_2893760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908128.1|2893848_2895300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908129.1|2895463_2895931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908130.1|2895937_2896213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908132.1|2897013_2897397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908133.1|2897446_2897887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167385088.1|2898014_2898230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908134.1|2898172_2898505_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088908135.1|2898799_2899210_+	oxidoreductase	NA	NA	NA	NA	NA
WP_167385122.1|2899568_2899739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088910942.1|2901562_2901835_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYN0	Paenibacillus_phage	41.7	2.7e-11
WP_088908138.1|2902243_2903611_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CP77	Brevibacillus_phage	43.2	5.7e-97
WP_088908139.1|2903876_2904179_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_088908140.1|2904419_2905004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908141.1|2905070_2905865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908142.1|2905919_2906381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157696771.1|2906502_2906655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908143.1|2906660_2907467_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0M4S688	Bacillus_phage	53.9	1.7e-32
WP_088908144.1|2907469_2907928_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_167385123.1|2908025_2908178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157696772.1|2908174_2908339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908145.1|2908354_2911675_-	hypothetical protein	NA	S5M9X7	Brevibacillus_phage	50.7	5.6e-13
WP_088908146.1|2911690_2912023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908147.1|2912036_2913158_-	hypothetical protein	NA	F8WQ05	Bacillus_phage	31.7	8.6e-51
WP_088908148.1|2913160_2915233_-	DUF4815 domain-containing protein	NA	F8WQ05	Bacillus_phage	36.3	2.9e-129
WP_088910943.1|2915245_2915737_-	hypothetical protein	NA	A0A110A292	Bacillus_phage	33.3	2.2e-14
WP_088908149.1|2916501_2917242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908150.1|2917213_2917687_-	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	29.4	3.2e-07
WP_088908151.1|2917683_2917962_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_088908152.1|2917973_2918954_-	hypothetical protein	NA	A0A249XXF8	Clostridium_phage	21.4	1.7e-10
WP_088908153.1|2918959_2919400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908154.1|2919432_2922072_-	hypothetical protein	NA	A0A2H4ET74	Aeromonas_phage	61.9	1.4e-06
WP_088908155.1|2922281_2922698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157696773.1|2922723_2923119_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_088908157.1|2923186_2924263_-|tail	phage tail sheath protein	tail	A0A0A7S0D2	Clostridium_phage	39.6	2.7e-62
WP_088908158.1|2924265_2924700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908159.1|2924696_2925092_-	HK97 gp10 family phage protein	NA	A0A0A7RVN8	Clostridium_phage	37.7	5.8e-18
WP_088908160.1|2925091_2925454_-	hypothetical protein	NA	A0A090EUC2	Clostridium_phage	33.6	5.9e-09
WP_088908161.1|2925450_2925771_-	hypothetical protein	NA	A0A0A7RTF6	Clostridium_phage	31.5	1.7e-07
WP_157696774.1|2925802_2925976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908162.1|2925975_2927064_-	DUF5309 family protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	50.7	5.9e-97
WP_088908163.1|2927079_2927766_-	DUF4355 domain-containing protein	NA	A0A1L2K2N1	Aeribacillus_phage	49.2	4.5e-42
WP_088908164.1|2927859_2928885_-|capsid	minor capsid protein	capsid	A0A090D822	Clostridium_phage	40.4	9.3e-68
WP_088910944.1|2928881_2930282_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	50.4	4.1e-119
WP_157696775.1|2930303_2931515_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1J0MC16	Streptomyces_phage	31.7	5.3e-46
WP_088908166.1|2931504_2932455_-|terminase	terminase	terminase	A0A1B1P7C9	Bacillus_phage	39.9	2.4e-33
WP_088908167.1|2932961_2933198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908168.1|2933333_2934377_-	DNA cytosine methyltransferase	NA	A0A1B1P7C6	Bacillus_phage	63.9	3.6e-128
WP_088908169.1|2934363_2934930_-	ParB N-terminal domain-containing protein	NA	A0A1B1P7B5	Bacillus_phage	59.6	2.1e-53
>prophage 3
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	2945836	2954420	6437015		Clostridium_phage(28.57%)	14	NA	NA
WP_167385124.1|2945836_2945995_-	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	45.8	6.5e-05
WP_088908185.1|2945991_2946201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088910946.1|2946188_2947586_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	47.6	1.3e-104
WP_157696778.1|2947608_2948460_-	ATP-binding protein	NA	A0A075KJB7	Lactobacillus_phage	27.5	1.1e-08
WP_088908187.1|2948392_2949400_-	hypothetical protein	NA	S5MUL0	Brevibacillus_phage	43.0	2.3e-26
WP_167385170.1|2949419_2950154_-	hypothetical protein	NA	A0A0A7RVR3	Clostridium_phage	46.5	1.3e-60
WP_167385171.1|2950170_2951025_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.8	2.9e-91
WP_088908190.1|2951481_2951703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908191.1|2951686_2951950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908192.1|2951999_2952431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908193.1|2952423_2952975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167385125.1|2953414_2953573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908194.1|2953585_2953840_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088908195.1|2954018_2954420_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	39.1	4.1e-11
>prophage 4
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	3119231	3127583	6437015	tail	Arthrobacter_phage(50.0%)	10	NA	NA
WP_088908334.1|3119231_3120731_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	36.9	1.0e-78
WP_088908335.1|3120829_3121450_-	arylformamidase	NA	NA	NA	NA	NA
WP_088908336.1|3121586_3122765_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	28.4	7.5e-13
WP_088908337.1|3122947_3123472_-|tail	phage tail protein	tail	A0A222ZG41	Arthrobacter_phage	34.9	7.2e-16
WP_088908338.1|3123487_3123997_-|tail	phage tail protein	tail	A0A221J6G5	Arthrobacter_phage	38.0	7.4e-18
WP_088908339.1|3124024_3124540_-|tail	phage tail protein	tail	A0A222ZG41	Arthrobacter_phage	39.6	8.6e-22
WP_088908340.1|3124594_3125071_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007728447.1|3125399_3125717_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088908341.1|3125816_3126914_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_088908342.1|3126947_3127583_-	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	35.7	3.5e-25
>prophage 5
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	3449333	3490863	6437015	tail,plate,head,portal,protease,holin,integrase,terminase,capsid	Paenibacillus_phage(21.21%)	50	3445303:3445349	3489721:3489767
3445303:3445349	attL	TATGGTGATCCGGACTGGGTTCGAACCAGCGACCCCCACCCTGTCAA	NA	NA	NA	NA
WP_088908561.1|3449333_3449792_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_088908562.1|3449995_3451330_-	hypothetical protein	NA	S6B1J7	Thermus_phage	33.1	1.2e-06
WP_088907977.1|3451347_3451890_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_088908563.1|3451882_3452941_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	40.0	4.0e-58
WP_088908564.1|3452912_3453245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908565.1|3453244_3453682_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_088910962.1|3453678_3454116_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_088908566.1|3454154_3455171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088910963.1|3455175_3455589_-	hypothetical protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	37.0	1.1e-11
WP_088908567.1|3455609_3457430_-	tape measure protein	NA	M1HMP3	Bacillus_virus	34.1	1.6e-30
WP_088908568.1|3457643_3458033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908569.1|3458059_3458494_-|tail	phage tail tube protein	tail	A0A0K2SUB8	Clostridium_phage	42.3	1.1e-17
WP_088908570.1|3458510_3459572_-|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	45.6	1.5e-68
WP_088907986.1|3459584_3460007_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_088908571.1|3459999_3460434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908572.1|3460435_3460759_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	34.7	3.7e-07
WP_088908573.1|3460755_3461052_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7SBZ6	Paenibacillus_phage	61.7	2.8e-25
WP_088908574.1|3461032_3461380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908575.1|3461437_3462625_-|capsid	phage major capsid protein	capsid	A0A2I7SBY4	Paenibacillus_phage	65.6	3.3e-141
WP_088908576.1|3462661_3463243_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	83.1	1.9e-86
WP_167385173.1|3463226_3464549_-|portal	phage portal protein	portal	A0A2I7SBY0	Paenibacillus_phage	79.2	7.7e-208
WP_088908577.1|3464625_3465438_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_088908578.1|3465499_3467107_-|terminase	terminase large subunit	terminase	A0A2I7SBY8	Paenibacillus_phage	80.2	1.2e-266
WP_088908579.1|3467096_3467705_-|terminase	terminase	terminase	A0A2I7SBY3	Paenibacillus_phage	83.6	9.3e-92
WP_088910965.1|3468061_3468478_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.3	5.1e-33
WP_088908581.1|3468611_3469157_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	49.2	3.4e-37
WP_088908582.1|3469203_3470562_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	55.4	6.6e-146
WP_088908583.1|3470558_3470849_-	VRR-NUC domain-containing protein	NA	A0A1L6BZE4	Pasteurella_phage	46.0	6.7e-16
WP_088908584.1|3471128_3473525_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	46.3	8.7e-210
WP_088908585.1|3473634_3474300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088908586.1|3474307_3475150_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	35.6	2.6e-23
WP_088908587.1|3475146_3476712_-	PcfJ family protein	NA	A0A2H4J308	uncultured_Caudovirales_phage	44.7	4.0e-22
WP_088908588.1|3476724_3477093_-	hypothetical protein	NA	A0A2H4J073	uncultured_Caudovirales_phage	45.9	2.6e-20
WP_088910966.1|3477191_3477470_-	DUF3310 domain-containing protein	NA	E2GLY2	Acinetobacter_phage	53.3	3.7e-11
WP_088908589.1|3477995_3479969_-	DNA polymerase	NA	H7BVQ1	unidentified_phage	59.2	2.4e-229
WP_088908590.1|3479972_3480797_-	DUF2815 family protein	NA	W8CPL2	Croceibacter_phage	48.9	3.3e-39
WP_088908591.1|3480789_3481998_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	49.0	1.5e-93
WP_088908592.1|3481994_3482492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908593.1|3482585_3482843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908594.1|3483017_3483245_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	62.7	4.4e-23
WP_088908595.1|3483308_3483563_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	45.3	7.0e-09
WP_088908596.1|3483603_3483936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088908597.1|3484191_3484464_-	helix-turn-helix domain-containing protein	NA	B3RH39	Bacillus_virus	45.5	3.1e-07
WP_088908598.1|3484683_3485058_+	helix-turn-helix transcriptional regulator	NA	A6XML9	Bacillus_virus	34.7	2.2e-06
WP_157696783.1|3485436_3485598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088908599.1|3485624_3486881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157696784.1|3487205_3487856_-	hypothetical protein	NA	S5M5V5	Brevibacillus_phage	67.4	4.8e-78
WP_088908601.1|3488168_3488378_+	helix-turn-helix transcriptional regulator	NA	S5MNP8	Brevibacillus_phage	66.7	2.7e-22
WP_088908602.1|3488390_3489605_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	52.9	2.9e-113
WP_088908603.1|3490269_3490863_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	48.8	3.2e-36
3489721:3489767	attR	TATGGTGATCCGGACTGGGTTCGAACCAGCGACCCCCACCCTGTCAA	NA	NA	NA	NA
>prophage 6
NZ_CP018145	Brevibacillus formosus strain NF2 chromosome, complete genome	6437015	4292034	4350656	6437015	protease,transposase,plate	Staphylococcus_phage(30.77%)	56	NA	NA
WP_157696844.1|4292034_4292928_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	82.4	1.0e-110
WP_088909242.1|4293029_4293716_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	76.1	3.3e-61
WP_088909243.1|4294027_4294330_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	45.9	1.5e-10
WP_088909244.1|4294709_4295726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088910998.1|4295824_4296367_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_157696800.1|4296432_4297074_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	46.8	3.5e-41
WP_088909246.1|4298242_4300459_-	S8 family serine peptidase	NA	D7NW64	Streptomyces_phage	34.0	2.0e-06
WP_088909247.1|4300728_4301181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088909248.1|4301262_4301715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088909250.1|4302647_4302956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157696801.1|4302952_4303831_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	1.2e-44
WP_047073393.1|4303970_4304600_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_088909251.1|4304711_4305146_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_016742285.1|4305156_4305264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047073006.1|4305545_4306520_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_088909252.1|4306532_4306802_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_088909253.1|4306955_4307399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088909254.1|4307457_4308123_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_088909255.1|4308211_4309153_+	sporulation protein	NA	NA	NA	NA	NA
WP_047073014.1|4309225_4310128_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_088909256.1|4310234_4312430_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_088909257.1|4312426_4313554_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_015893041.1|4313689_4314241_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_088909258.1|4314448_4315456_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	39.0	3.3e-09
WP_088909259.1|4315562_4316189_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088909260.1|4316192_4317725_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088909261.1|4317745_4318864_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_088909262.1|4318860_4319949_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_088909263.1|4319953_4321456_-	spore germination protein	NA	NA	NA	NA	NA
WP_088909264.1|4321582_4322047_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	56.2	3.3e-41
WP_088909265.1|4322063_4323263_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.3	3.7e-108
WP_088909266.1|4323279_4323936_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.0	4.4e-39
WP_088909267.1|4323955_4325062_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	41.3	8.5e-59
WP_088909268.1|4325668_4326337_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_088909269.1|4326975_4327701_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_088911000.1|4327768_4328938_-	MFS transporter	NA	NA	NA	NA	NA
WP_088909270.1|4329338_4329818_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_088909271.1|4329835_4331152_-	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.8	3.8e-13
WP_088909272.1|4331282_4332074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088909273.1|4332481_4333417_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_088909274.1|4333417_4334512_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_047073052.1|4335766_4336069_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_088909275.1|4336139_4336379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088909276.1|4336426_4337881_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_088909277.1|4337905_4338730_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_088909278.1|4338751_4339609_-	DUF72 domain-containing protein	NA	A0A1S5XY79	Kurlavirus	26.9	1.9e-13
WP_088909279.1|4339661_4340168_+	M67 family metallopeptidase	NA	NA	NA	NA	NA
WP_088909280.1|4340098_4341502_-	aspartate kinase	NA	NA	NA	NA	NA
WP_088909281.1|4342463_4344005_-	flotillin family protein	NA	NA	NA	NA	NA
WP_088909282.1|4344004_4344544_-|protease	serine protease	protease	NA	NA	NA	NA
WP_088909283.1|4344631_4346068_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_088909284.1|4346214_4347156_+	DMT family transporter	NA	NA	NA	NA	NA
WP_088909285.1|4347205_4347712_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_088909286.1|4347686_4348223_-	Suppressor of fused protein (SUFU)	NA	NA	NA	NA	NA
WP_157696802.1|4348467_4348839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088909289.1|4350047_4350656_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
