The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	252778	260726	5329684		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|252778_253063_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|253101_254736_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743906.1|255142_256681_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_050821493.1|257066_258392_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.2	1.2e-43
WP_000929887.1|258535_259237_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	7.3e-40
WP_000719212.1|259220_260726_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.7	1.1e-32
>prophage 2
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	305305	313681	5329684		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|305305_306613_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|306701_307421_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|307413_307668_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|307664_308348_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055565.1|308331_310551_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879025.1|310535_311951_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|312056_313097_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088596.1|313093_313681_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.5e-27
>prophage 3
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	1815568	1823716	5329684		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|1815568_1816849_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_088911115.1|1816948_1817713_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_088911116.1|1817953_1819714_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.6e-272
WP_000612414.1|1819799_1820477_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231622.1|1820473_1821547_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	1.0e-186
WP_000818985.1|1821836_1822556_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258503.1|1822843_1823716_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	5.6e-66
>prophage 4
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	1996333	2003220	5329684		Bacillus_phage(33.33%)	8	NA	NA
WP_000427801.1|1996333_1996609_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000478848.1|1996806_1997070_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	3.4e-06
WP_000456233.1|1997717_1998065_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	3.0e-10
WP_000109862.1|1998251_1999325_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.9e-74
WP_000709202.1|1999321_1999447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499717.1|1999743_2000571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165966.1|2000680_2001328_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	2.5e-10
WP_000783169.1|2001324_2003220_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	8.8e-56
>prophage 5
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	2433884	2506654	5329684	protease,head,portal,transposase,integrase,bacteriocin,terminase,tail,capsid	Bacillus_phage(62.5%)	76	2433627:2433661	2510883:2510917
2433627:2433661	attL	CCCCACCTCAAAATTCAGCGGAAGCAAAGAAGTTA	NA	NA	NA	NA
WP_002006106.1|2433884_2434202_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358744.1|2434603_2435065_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_001987723.1|2435024_2435264_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_002098358.1|2435525_2435705_+	hypothetical protein	NA	H0USY0	Bacillus_phage	46.6	5.4e-08
WP_000413143.1|2436379_2437081_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675842.1|2437119_2438229_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.4	1.4e-146
WP_088911132.1|2438532_2439735_+	collagen-like protein	NA	NA	NA	NA	NA
WP_000265308.1|2440376_2441528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720922.1|2441565_2441712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000491237.1|2442031_2442385_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	85.3	1.1e-47
WP_000854268.1|2442585_2442777_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	86.9	3.7e-23
WP_088911133.1|2442833_2443100_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	92.9	3.2e-36
WP_001093547.1|2443321_2444377_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	4.7e-59
WP_088911134.1|2444380_2444659_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	1.5e-12
WP_001125978.1|2444651_2445011_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	50.8	3.0e-29
WP_000717826.1|2445029_2445197_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_000109500.1|2445222_2445474_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	37.3	2.2e-07
WP_000141882.1|2446987_2447236_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	91.5	1.9e-35
WP_154214170.1|2447524_2447671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064727.1|2449104_2449569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000166170.1|2450943_2451426_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_001012133.1|2451425_2451968_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	90.6	2.1e-87
WP_001170288.1|2452181_2453132_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000466453.1|2453655_2454180_+	ATP-binding protein	NA	S5VN83	Mycobacterium_phage	29.2	1.5e-05
WP_000424043.1|2454954_2455173_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	47.1	6.6e-08
WP_001089577.1|2455179_2455437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001008145.1|2455429_2455765_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	7.2e-54
WP_088911135.1|2455917_2456253_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_088911136.1|2456249_2457908_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	8.6e-257
WP_050552128.1|2457973_2459080_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	88.5	3.8e-184
WP_000216404.1|2459063_2459840_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	4.3e-57
WP_000234864.1|2459860_2461024_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	84.2	6.2e-185
WP_000381904.1|2461036_2461330_+	hypothetical protein	NA	D2XR19	Bacillus_phage	89.7	5.0e-43
WP_001247277.1|2461331_2461685_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	8.7e-58
WP_088911137.1|2461686_2462028_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	94.7	1.3e-53
WP_000172092.1|2462027_2462357_+	hypothetical protein	NA	D2XR22	Bacillus_phage	94.5	3.5e-53
WP_001004914.1|2462357_2462945_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	3.3e-86
WP_000415919.1|2462949_2463312_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	84.2	5.1e-53
WP_157674379.1|2463541_2464753_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	87.1	3.9e-190
WP_002098337.1|2465006_2465264_+	hypothetical protein	NA	A0A1B1P763	Bacillus_phage	85.9	1.7e-34
WP_088911139.1|2465486_2467652_+|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.9	3.0e-84
WP_000094129.1|2467693_2469157_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	56.6	1.9e-162
WP_088911140.1|2469153_2473512_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	49.1	0.0e+00
WP_000342977.1|2473523_2473898_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	77.8	2.1e-46
WP_000398738.1|2473991_2474228_+	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	100.0	1.2e-18
WP_000461725.1|2474227_2474467_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	96.2	1.0e-33
WP_088911141.1|2474463_2475528_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.9	1.3e-197
WP_000371453.1|2475828_2477217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371275.1|2477285_2478719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001023812.1|2479129_2479999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626124.1|2480435_2482118_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_000732182.1|2482325_2483093_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_000905571.1|2483232_2483649_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878372.1|2483769_2483973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416828.1|2484301_2484514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565688.1|2484722_2485727_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282680.1|2485872_2486277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062128.1|2486437_2487673_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106392.1|2487939_2489223_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069249.1|2489212_2489845_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2489915_2490071_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289122.1|2490173_2490671_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168014.1|2490811_2492026_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954437.1|2492134_2492713_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766385.1|2492888_2493740_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088568.1|2494190_2495978_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_000743768.1|2496212_2498339_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000765191.1|2498415_2498946_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932143.1|2499204_2500392_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.6	1.4e-06
WP_000864394.1|2500486_2501167_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038208.1|2501576_2502125_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088911142.1|2502135_2503836_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000556362.1|2503828_2504629_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2504765_2504873_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_002098330.1|2504974_2506234_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_029960423.1|2506450_2506654_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	68.7	2.0e-19
2510883:2510917	attR	CCCCACCTCAAAATTCAGCGGAAGCAAAGAAGTTA	NA	NA	NA	NA
>prophage 6
NZ_CP016595	Bacillus cereus strain K8, complete sequence	5329684	4428403	4436088	5329684		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221067.1|4428403_4429327_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609141.1|4429452_4430388_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.2e-21
WP_000018029.1|4430389_4431082_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001014310.1|4431423_4431618_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255966.1|4431656_4432856_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587818.1|4433151_4433475_+	heme oxygenase	NA	NA	NA	NA	NA
WP_048533848.1|4433547_4434312_-	class B sortase	NA	NA	NA	NA	NA
WP_050822117.1|4434344_4435115_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	9.9e-14
WP_003310941.1|4435104_4436088_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	6.5e-18
>prophage 1
NZ_CP016597	Bacillus cereus strain K8 plasmid pBCK802, complete sequence	71854	13140	45861	71854	head,terminase,holin,portal,tail	Bacillus_phage(71.43%)	38	NA	NA
WP_000198084.1|13140_13971_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	39.3	7.3e-39
WP_000030443.1|13985_14387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000428555.1|14418_14703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088911316.1|15138_15345_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	51.0	1.0e-05
WP_088911317.1|15341_15776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088911318.1|16082_16583_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000128983.1|16691_17279_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.4	3.9e-10
WP_000914192.1|17371_17803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088911319.1|17988_18477_-	hypothetical protein	NA	A6XML4	Bacillus_virus	53.8	6.7e-16
WP_080014686.1|18496_19072_-	hypothetical protein	NA	B3RH37	Bacillus_virus	64.2	2.8e-69
WP_000575736.1|19013_20309_-	cell division protein FtsK	NA	B3RH36	Bacillus_virus	45.4	1.8e-108
WP_000467326.1|20608_20830_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	78.1	8.4e-27
WP_025967161.1|20942_22208_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.1	1.9e-107
WP_001057811.1|22204_22546_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000056021.1|22615_23986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957442.1|24011_24314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000405788.1|24514_25450_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	88.4	5.1e-166
WP_088911320.1|25449_25875_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	95.7	7.0e-70
WP_088911321.1|25914_26283_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	61.5	1.7e-32
WP_070861234.1|26294_30611_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	58.3	0.0e+00
WP_003318990.1|30607_32080_-	Phage-related protein	NA	A0A0A7AQV1	Bacillus_phage	68.5	1.1e-199
WP_000418556.1|32092_35032_-|tail	phage tail tape measure protein	tail	A0A0A7AR36	Bacillus_phage	80.1	4.7e-282
WP_050552134.1|35032_35239_-	hypothetical protein	NA	A0A0A7AQY2	Bacillus_phage	95.6	1.1e-31
WP_000150395.1|35343_35772_-	hypothetical protein	NA	A0A0A7AQY2	Bacillus_phage	94.4	1.1e-67
WP_000729987.1|35818_36412_-	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	98.0	5.3e-108
WP_000997644.1|36426_36789_-	hypothetical protein	NA	A0A0S2MV90	Bacillus_phage	90.8	1.3e-56
WP_000061894.1|36794_37202_-	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	93.3	2.5e-64
WP_000616218.1|37176_37521_-|head,tail	head-tail adaptor protein	head,tail	A0A0A7AR32	Bacillus_phage	92.1	1.1e-57
WP_000654244.1|37517_37829_-	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	89.0	6.3e-44
WP_000116909.1|37872_38718_-	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	87.9	2.0e-137
WP_000811675.1|38835_39567_-	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	62.7	1.9e-70
WP_002099121.1|39641_40409_-|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	94.5	7.0e-137
WP_000461485.1|40482_41907_-|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	92.9	1.5e-257
WP_000062322.1|41919_43149_-|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	62.7	1.2e-146
WP_000810413.1|43145_43904_-	hypothetical protein	NA	D2XPX8	Bacillus_virus	60.3	3.9e-55
WP_000265603.1|44485_44707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074595344.1|44838_45096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018891.1|45285_45861_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	40.9	1.4e-28
>prophage 2
NZ_CP016597	Bacillus cereus strain K8 plasmid pBCK802, complete sequence	71854	48865	59146	71854		Bacillus_phage(61.54%)	15	NA	NA
WP_000441090.1|48865_49252_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	44.8	5.8e-23
WP_088911322.1|49390_50020_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	59.8	1.3e-48
WP_001145514.1|50131_50320_+	hypothetical protein	NA	A0A288WGN0	Bacillus_phage	63.0	1.5e-08
WP_025967179.1|51464_51728_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	60.2	7.5e-22
WP_002099119.1|51724_51970_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	85.9	4.1e-30
WP_088911323.1|51926_52190_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	63.8	2.7e-16
WP_088911335.1|52205_52964_-	AAA family ATPase	NA	U5PVD6	Bacillus_phage	39.6	6.3e-37
WP_088911324.1|52947_53721_-	DnaD domain protein	NA	A9CR67	Staphylococcus_phage	40.9	8.3e-37
WP_000472844.1|53721_53943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088911325.1|54134_54761_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	40.6	7.2e-31
WP_016513740.1|54956_55157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088911326.1|55991_56528_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	44.6	9.9e-29
WP_000142654.1|56702_56972_-	helix-turn-helix transcriptional regulator	NA	B5LPU7	Bacillus_virus	84.8	2.4e-28
WP_088911327.1|57176_57521_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	95.6	6.7e-55
WP_050822306.1|57997_59146_-	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	28.6	8.9e-35
>prophage 1
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	0	7686	319570		Bacillus_phage(66.67%)	5	NA	NA
WP_088911223.1|109_2053_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088911224.1|2600_3440_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_088911225.1|4915_5602_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.3	2.2e-41
WP_088911226.1|5598_6675_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	1.1e-18
WP_088911227.1|6924_7686_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	1.5e-35
>prophage 2
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	15975	16926	319570		Salmonella_phage(100.0%)	1	NA	NA
WP_088911231.1|15975_16926_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.3	1.7e-55
>prophage 3
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	27904	33499	319570		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_001067397.1|27904_30070_+	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	36.7	1.4e-25
WP_000465091.1|30234_30564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088911234.1|31082_31529_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088911235.1|32140_33499_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	40.6	3.3e-81
>prophage 4
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	39842	41847	319570		Indivirus(50.0%)	2	NA	NA
WP_016513449.1|39842_40865_+	hypothetical protein	NA	A0A1V0SDW6	Indivirus	29.3	1.0e-37
WP_000129820.1|40899_41847_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.7	1.9e-27
>prophage 5
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	54016	57322	319570		Enterobacteria_phage(50.0%)	4	NA	NA
WP_088911243.1|54016_54883_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.2	1.8e-101
WP_088911244.1|54908_55475_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	44.0	5.2e-36
WP_088911245.1|55471_56428_+	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	43.9	2.3e-76
WP_088911246.1|56473_57322_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.4	9.8e-31
>prophage 6
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	64059	94398	319570		Tupanvirus(57.14%)	11	NA	NA
WP_000914213.1|64059_65037_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	28.2	2.9e-26
WP_088911250.1|65201_66134_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.8	6.1e-18
WP_001028936.1|66924_67623_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_088911251.1|67880_74393_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.3	5.3e-185
WP_002001177.1|74634_75354_-	thioesterase	NA	NA	NA	NA	NA
WP_001187893.1|75409_79906_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	1.3e-81
WP_000031545.1|79887_80967_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_088911252.1|80963_84047_-	cyclic peptide export ABC transporter	NA	A0A2P1JQM9	Mycobacterium_phage	28.8	3.1e-10
WP_000608546.1|84062_85139_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074595690.1|85157_92846_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	26.1	1.0e-94
WP_088911253.1|92820_94398_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	31.7	7.6e-69
>prophage 7
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	103524	119285	319570		Tupanvirus(50.0%)	2	NA	NA
WP_088911255.1|103524_109248_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	6.6e-171
WP_070861437.1|109274_119285_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	35.0	1.0e-62
>prophage 8
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	122864	130463	319570		Tupanvirus(100.0%)	1	NA	NA
WP_088911256.1|122864_130463_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.0	3.0e-163
>prophage 9
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	139674	141102	319570		Bacillus_virus(100.0%)	1	NA	NA
WP_000837505.1|139674_141102_-	glucosaminidase	NA	G3MAW8	Bacillus_virus	43.6	2.9e-27
>prophage 10
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	144720	146097	319570		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001049833.1|144720_146097_-	chitin-binding protein	NA	G1FGA4	Mycobacterium_phage	39.2	5.0e-08
>prophage 11
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	157010	157226	319570		Bacillus_phage(100.0%)	1	NA	NA
WP_001167052.1|157010_157226_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	71.6	1.3e-19
>prophage 12
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	160718	162359	319570		Bacillus_phage(100.0%)	1	NA	NA
WP_000787704.1|160718_162359_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.1	1.6e-08
>prophage 13
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	173017	174433	319570		Streptococcus_phage(100.0%)	1	NA	NA
WP_000964401.1|173017_174433_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.8	3.1e-21
>prophage 14
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	185470	190942	319570		Bacillus_phage(75.0%)	5	NA	NA
WP_088911264.1|185470_186082_-	hypothetical protein	NA	W8CZ47	Bacillus_phage	74.3	1.0e-85
WP_088911265.1|186071_187238_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	83.0	3.2e-189
WP_000958232.1|187250_187445_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	57.8	3.2e-14
WP_000424050.1|188017_188254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088911266.1|188962_190942_-	DUF3472 domain-containing protein	NA	G1FGA4	Mycobacterium_phage	40.7	2.7e-07
>prophage 15
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	210097	210376	319570		Paenibacillus_phage(100.0%)	1	NA	NA
WP_025966438.1|210097_210376_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	63.9	1.0e-13
>prophage 16
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	213497	216155	319570		Streptococcus_phage(100.0%)	1	NA	NA
WP_088911274.1|213497_216155_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	26.3	9.5e-32
>prophage 17
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	222944	224072	319570		Bacillus_phage(100.0%)	1	NA	NA
WP_012263719.1|222944_224072_-	C40 family peptidase	NA	A0A0A0RPZ1	Bacillus_phage	48.3	3.1e-24
>prophage 18
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	242654	244574	319570		Lactobacillus_phage(50.0%)	2	NA	NA
WP_088911290.1|242654_243047_+	helix-turn-helix domain-containing protein	NA	A0A0P0IZG9	Lactobacillus_phage	38.3	1.1e-05
WP_088911311.1|243443_244574_-	hypothetical protein	NA	H0UST6	Bacillus_phage	37.2	2.7e-68
>prophage 19
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	265116	266639	319570	transposase	Enterococcus_phage(50.0%)	2	NA	NA
WP_088911293.1|265116_266229_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	48.4	6.1e-81
WP_088911294.1|266240_266639_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	8.9e-51
>prophage 20
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	273633	283318	319570		Mycobacterium_phage(33.33%)	5	NA	NA
WP_000527245.1|273633_275874_+	hypothetical protein	NA	G1FGA4	Mycobacterium_phage	46.2	3.5e-11
WP_050822653.1|276006_278373_+	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_088911298.1|278477_281216_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	27.0	6.2e-18
WP_000821352.1|281685_281835_+	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
WP_088911299.1|281911_283318_+	thioether cross-link-forming SCIFF peptide maturase	NA	A0A1L7N0Q5	Ralstonia_phage	23.5	6.0e-09
>prophage 21
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	286634	290349	319570		Brevibacillus_phage(33.33%)	4	NA	NA
WP_000467331.1|286634_286865_-	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	43.2	1.2e-12
WP_088911300.1|287792_289226_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447832.1|289237_289924_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	1.4e-24
WP_088911301.1|290076_290349_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	58.9	1.7e-21
>prophage 22
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	296608	301816	319570		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000994767.1|296608_297475_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	2.5e-21
WP_000691659.1|297471_297855_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088911302.1|298554_299550_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_088911303.1|299812_301816_-	chitinase	NA	M1H4X6	Acanthocystis_turfacea_Chlorella_virus	39.6	5.9e-42
>prophage 23
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	307142	307847	319570		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_088911307.1|307142_307847_+	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	35.9	4.6e-34
>prophage 24
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	312499	314101	319570		Bacillus_phage(100.0%)	1	NA	NA
WP_070861574.1|312499_314101_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.3	4.2e-43
>prophage 25
NZ_CP016596	Bacillus cereus strain K8 plasmid pBCM301, complete sequence	319570	317161	318112	319570		Salmonella_phage(100.0%)	1	NA	NA
WP_000497841.1|317161_318112_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.1	2.9e-55
