The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	201249	232636	7783862	integrase,transposase	Mycobacterium_phage(33.33%)	29	201043:201059	212407:212423
201043:201059	attL	CAATGGCACTCGGTTAG	NA	NA	NA	NA
WP_088915861.1|201249_202518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088915862.1|202652_202901_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088915863.1|202974_204699_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088915864.1|204695_205133_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088915865.1|205132_205576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088915866.1|205659_206259_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157735679.1|206465_207227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735680.1|208173_208341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735681.1|208616_208727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915870.1|208882_212164_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157735682.1|212528_212705_+	hypothetical protein	NA	NA	NA	NA	NA
212407:212423	attR	CAATGGCACTCGGTTAG	NA	NA	NA	NA
WP_088915871.1|212803_213040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088915872.1|213039_213462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735683.1|216028_216331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088915873.1|216467_217061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915874.1|217217_218243_-	serine hydrolase	NA	A0A2H4PBG0	Mycobacterium_phage	25.6	2.9e-13
WP_088915875.1|218516_219044_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_088915877.1|219667_221245_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	33.3	3.1e-14
WP_157735684.1|221791_222487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915880.1|222496_222997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088915881.1|223503_223845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735686.1|224717_225050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915883.1|225063_225327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915884.1|225375_225708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915885.1|225847_227911_+	recombinase family protein	NA	NA	NA	NA	NA
WP_088915887.1|228202_229966_-	recombinase family protein	NA	E9P5U5	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	42.9	3.5e-107
WP_088915888.1|229962_230169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088915889.1|230249_230999_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_088921623.1|231289_232636_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	1051029	1057796	7783862	transposase	Salmonella_phage(100.0%)	8	NA	NA
WP_088916494.1|1051029_1052268_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	56.8	1.4e-131
WP_088916495.1|1052594_1053935_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_088916496.1|1054157_1054667_+	DinB family protein	NA	NA	NA	NA	NA
WP_169727407.1|1054739_1054892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088916498.1|1055225_1055591_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157735758.1|1055663_1055927_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088916500.1|1056032_1057508_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088916501.1|1057592_1057796_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	1756544	1833894	7783862	integrase,transposase	Enterobacteria_phage(17.39%)	67	1766835:1766856	1795206:1795230
WP_088917042.1|1756544_1758020_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088917043.1|1758452_1759451_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.8	8.1e-85
WP_157735828.1|1759564_1761787_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_157735829.1|1762265_1762607_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157735830.1|1762764_1764831_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088917048.1|1764830_1765454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169727425.1|1765657_1766008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735831.1|1766378_1766723_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.8	5.2e-23
1766835:1766856	attL	CCGCGGCTATTTGCCGCGGACC	NA	NA	NA	NA
WP_088917051.1|1766871_1767096_-	hypothetical protein	NA	NA	NA	NA	NA
1766835:1766856	attL	CCGCGGCTATTTGCCGCGGACC	NA	NA	NA	NA
WP_088917052.1|1767092_1767902_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.1	1.4e-34
WP_157735832.1|1769230_1769416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735833.1|1769518_1770397_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088917054.1|1770393_1771320_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088917055.1|1771316_1772315_+|integrase	site-specific integrase	integrase	B8R670	Lactobacillus_phage	24.5	1.3e-05
WP_088917056.1|1772373_1772811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917057.1|1773590_1773881_+|transposase	transposase	transposase	NA	NA	NA	NA
1773512:1773533	attR	GGTCCGCGGCAAATAGCCGCGG	NA	NA	NA	NA
WP_088917058.1|1773982_1775323_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
1773512:1773533	attR	GGTCCGCGGCAAATAGCCGCGG	NA	NA	NA	NA
WP_088917059.1|1775834_1777682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917060.1|1777758_1778145_+	capsular biosynthesis protein	NA	M4QRS4	Synechococcus_phage	45.5	4.9e-14
WP_088917061.1|1778141_1779716_+	phosphotransferase	NA	B2ZYD9	Ralstonia_phage	28.5	1.3e-41
WP_088917062.1|1779712_1780438_+	capsular biosynthesis protein	NA	A0A222YX14	Synechococcus_phage	30.5	2.2e-15
WP_088921731.1|1780708_1781416_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.7	1.7e-60
WP_088917063.1|1781548_1782295_-	hypothetical protein	NA	K4I413	Acidithiobacillus_phage	47.4	1.6e-53
WP_088917064.1|1782341_1782521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917065.1|1782532_1783453_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088916798.1|1783449_1784124_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088916797.1|1784104_1784587_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088917066.1|1784718_1785045_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088917067.1|1785041_1785956_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	29.4	1.5e-08
WP_088917068.1|1785952_1786339_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088917069.1|1786392_1787907_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_088917070.1|1787899_1788673_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.5	2.3e-34
WP_088917071.1|1789431_1790694_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	2.4e-25
WP_088917072.1|1790632_1791067_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088917073.1|1791121_1791631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917074.1|1791627_1792419_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.7	8.5e-37
WP_088917075.1|1792399_1793941_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	28.1	8.6e-25
WP_088917076.1|1795101_1795965_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	44.8	5.1e-51
WP_088917077.1|1796266_1797529_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.6	1.5e-27
WP_157735834.1|1798451_1799231_-	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_157735835.1|1799565_1800495_+	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_157735836.1|1800488_1800767_+	DUF563 domain-containing protein	NA	NA	NA	NA	NA
WP_088916227.1|1801044_1803336_+|transposase	IS4 family transposase	transposase	Q8QNB6	Ectocarpus_siliculosus_virus	29.3	1.3e-24
WP_088917082.1|1803865_1804858_+	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.5	1.2e-83
WP_088917083.1|1804879_1805779_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.7	1.0e-94
WP_088917084.1|1805791_1806850_-	glycosyltransferase family 29 protein	NA	NA	NA	NA	NA
WP_157735837.1|1806846_1808046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917086.1|1808053_1809130_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_088917087.1|1809188_1809458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735838.1|1809471_1811145_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_088917089.1|1811670_1812618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917090.1|1812601_1814719_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_157735839.1|1815050_1816397_+	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_088917092.1|1816711_1817995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735841.1|1818123_1818468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917094.1|1818464_1819997_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_088917095.1|1820291_1821815_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	30.9	3.4e-42
WP_088921732.1|1821817_1822420_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	60.5	3.0e-66
WP_088917096.1|1822429_1823455_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	49.7	8.9e-87
WP_088921733.1|1823475_1824285_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.0	7.3e-60
WP_088917097.1|1824491_1825133_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_088917098.1|1825299_1825716_+	OsmC family protein	NA	NA	NA	NA	NA
WP_088921734.1|1826252_1826690_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_088917099.1|1826692_1827085_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_088917100.1|1827259_1831153_+	DUF3683 domain-containing protein	NA	NA	NA	NA	NA
WP_088917101.1|1831268_1832579_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_088917102.1|1832946_1833894_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	2194018	2256153	7783862	transposase	Staphylococcus_phage(50.0%)	52	NA	NA
WP_088917405.1|2194018_2195380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088921772.1|2195871_2197218_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157735881.1|2197490_2198621_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_169727433.1|2198928_2199093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917407.1|2199220_2199568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917408.1|2200045_2200468_+	GFA family protein	NA	NA	NA	NA	NA
WP_088917409.1|2200574_2201345_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_088917410.1|2201454_2202264_-	methyltransferase	NA	NA	NA	NA	NA
WP_088917411.1|2202291_2202963_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_088917412.1|2203081_2203966_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088921773.1|2204096_2204966_-	DMT family transporter	NA	NA	NA	NA	NA
WP_088917413.1|2205166_2205631_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_088917414.1|2205809_2207762_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088917415.1|2207810_2209250_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_088917416.1|2209679_2210453_+	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_088921774.1|2210479_2211769_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157735883.1|2211943_2212876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088921775.1|2213583_2214321_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	6.1e-13
WP_088921776.1|2214351_2215470_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088917418.1|2215522_2216659_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_088917419.1|2216877_2217321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917420.1|2217521_2218982_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_169727434.1|2219341_2219827_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088917422.1|2219865_2220369_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088917423.1|2220447_2221362_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_088917424.1|2221369_2221852_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088917425.1|2221988_2223008_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_088921777.1|2223064_2223640_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_088917426.1|2223642_2224929_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_088917427.1|2224940_2225378_+	universal stress protein	NA	NA	NA	NA	NA
WP_088917428.1|2225447_2226278_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_088917429.1|2226274_2227288_+	hydroxyectoine utilization dehydratase EutB	NA	NA	NA	NA	NA
WP_088917430.1|2227280_2228270_+	cyclodeaminase	NA	NA	NA	NA	NA
WP_088917431.1|2228290_2229478_+	ectoine hydrolase DoeA	NA	NA	NA	NA	NA
WP_088917432.1|2229480_2230473_+	N-alpha-acetyl diaminobutyric acid deacetylase DoeB	NA	NA	NA	NA	NA
WP_088921778.1|2230626_2232000_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_157735884.1|2232028_2232178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735885.1|2232301_2232496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917434.1|2232851_2233322_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_088917435.1|2233405_2233786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735886.1|2234005_2235349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917437.1|2235826_2237128_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_088917438.1|2237368_2237911_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_157735887.1|2238816_2238987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735888.1|2239218_2239407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917440.1|2239604_2241068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917441.1|2241082_2245345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917442.1|2245341_2247939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917443.1|2247935_2251286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917444.1|2251282_2253097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917445.1|2253466_2254489_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_169727435.1|2254914_2256153_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	22.5	7.1e-06
>prophage 5
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	2262165	2321965	7783862	integrase,tRNA,transposase	Leptospira_phage(20.0%)	46	2280640:2280657	2308319:2308336
WP_157735889.1|2262165_2262330_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_088917449.1|2262696_2265162_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_157735890.1|2265738_2266623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917451.1|2266823_2267840_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_157735891.1|2267946_2268276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917454.1|2268849_2269311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917455.1|2269325_2270582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917456.1|2270641_2274064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917457.1|2274060_2274897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917458.1|2274909_2275329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917459.1|2275453_2276077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917460.1|2277009_2277897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735892.1|2278162_2278963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917462.1|2279088_2279688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735893.1|2279857_2280454_-	hypothetical protein	NA	NA	NA	NA	NA
2280640:2280657	attL	CACCTTTGTCTCGATAGT	NA	NA	NA	NA
WP_088917464.1|2281006_2281330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917465.1|2281326_2281695_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5WJH4	Leptospira_phage	34.3	1.2e-09
WP_088921781.1|2281815_2283396_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.5	3.1e-54
WP_088917073.1|2283889_2284399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917074.1|2284395_2285187_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.7	8.5e-37
WP_088917075.1|2285167_2286709_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	28.1	8.6e-25
WP_088921782.1|2289688_2289916_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157735894.1|2289974_2290409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735895.1|2292547_2293756_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157735896.1|2293748_2295548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735897.1|2295535_2297386_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088917471.1|2297369_2297981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917472.1|2298048_2298537_+	single-stranded DNA-binding protein	NA	A0A2I7RNY1	Vibrio_phage	63.2	2.4e-37
WP_088917473.1|2298606_2299926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735898.1|2299974_2300511_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_088917475.1|2300537_2302064_-	DUF4403 family protein	NA	NA	NA	NA	NA
WP_088921783.1|2302120_2302822_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_088917476.1|2302980_2303919_+	DMT family transporter	NA	NA	NA	NA	NA
WP_088921784.1|2304094_2305264_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.4	3.2e-125
WP_088917477.1|2305308_2306619_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	32.6	9.4e-49
WP_169727578.1|2306964_2307918_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088917479.1|2307989_2308880_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
2308319:2308336	attR	CACCTTTGTCTCGATAGT	NA	NA	NA	NA
WP_088917480.1|2308869_2309958_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.5	4.9e-27
WP_088917481.1|2309935_2310715_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_088917482.1|2310804_2311641_+	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_157735899.1|2311697_2313074_-	BNR-4 repeat-containing protein	NA	NA	NA	NA	NA
WP_169727436.1|2313257_2315465_+	esterase-like activity of phytase family protein	NA	E3SJA5	Synechococcus_phage	43.3	1.6e-85
WP_088917484.1|2315995_2316385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917485.1|2316740_2318657_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.1	9.9e-31
WP_088921786.1|2318656_2319625_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_088917486.1|2320606_2321965_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	3080611	3137816	7783862	transposase	Wolbachia_phage(25.0%)	38	NA	NA
WP_088918063.1|3080611_3081658_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	37.9	6.9e-26
WP_169727381.1|3081880_3082165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918065.1|3082161_3083208_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	31.9	3.3e-36
WP_088918066.1|3083250_3083922_-	cysteine hydrolase family protein	NA	NA	NA	NA	NA
WP_088918067.1|3083950_3085753_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	5.5e-15
WP_088918068.1|3085759_3086704_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_088918069.1|3086706_3088332_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088918070.1|3088372_3089293_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_088921833.1|3089363_3090254_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_157735962.1|3090759_3091200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918072.1|3091633_3092974_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088918073.1|3093382_3094528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735963.1|3094872_3095097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157735964.1|3095213_3095459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918076.1|3095678_3096542_-	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_088918077.1|3096999_3097968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735965.1|3098741_3100163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918080.1|3100159_3100975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918081.1|3101033_3102176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918082.1|3102336_3103266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918084.1|3103689_3109068_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_088918085.1|3109416_3109680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088918086.1|3109874_3110651_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_088918087.1|3110650_3113920_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.4	1.2e-55
WP_088918088.1|3113912_3114953_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	40.9	4.8e-64
WP_157735966.1|3114986_3116300_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088918089.1|3116289_3117810_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.9	7.3e-85
WP_088918090.1|3117806_3118394_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088918091.1|3118926_3119925_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_088918092.1|3120359_3122741_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	34.7	9.1e-42
WP_088918093.1|3122737_3124048_+	McrC family protein	NA	NA	NA	NA	NA
WP_157735967.1|3124826_3126449_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_088918096.1|3126503_3127124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157735968.1|3127116_3127446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088918098.1|3127342_3127885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088918100.1|3128958_3135501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918101.1|3135694_3136177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088918102.1|3136856_3137816_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	35.0	6.1e-37
>prophage 7
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	3832066	3919253	7783862	integrase,transposase	Enterobacteria_phage(21.43%)	82	3825536:3825550	3920098:3920111
3825536:3825550	attL	GCGATCCTGCTGATG	NA	NA	NA	NA
WP_088918624.1|3832066_3833089_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3825536:3825550	attL	GCGATCCTGCTGATG	NA	NA	NA	NA
WP_157736046.1|3833500_3834469_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_169727474.1|3834760_3835897_+	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	29.5	3.9e-35
WP_088918626.1|3835972_3836644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736047.1|3836640_3836997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088918628.1|3837599_3837824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736048.1|3837978_3838149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918629.1|3838088_3838349_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_157736049.1|3839169_3839586_-	GFA family protein	NA	NA	NA	NA	NA
WP_088918631.1|3839755_3840580_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088918632.1|3840748_3841756_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_088918633.1|3841778_3842936_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088918634.1|3842940_3843789_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	34.0	9.8e-31
WP_157736050.1|3843806_3844190_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_169727475.1|3844204_3845317_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_088918637.1|3845335_3846751_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_088918638.1|3846803_3848342_+	acyl--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.6	7.2e-16
WP_088918639.1|3848352_3849231_-	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	38.1	5.5e-53
WP_088918640.1|3849303_3850521_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_088918641.1|3850525_3852043_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_088918642.1|3852169_3854293_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_088918643.1|3854336_3855017_+	nitroreductase	NA	NA	NA	NA	NA
WP_088918644.1|3855033_3855804_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_088918645.1|3855839_3857447_+	GMC family oxidoreductase	NA	A0A1V0SI18	Klosneuvirus	30.1	1.7e-47
WP_088918646.1|3857491_3858292_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_088918647.1|3858304_3859036_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_088915928.1|3859149_3859584_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	29.2	4.7e-13
WP_088918648.1|3859763_3860969_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_088918649.1|3861033_3861924_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088918650.1|3862400_3863264_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_088918651.1|3863263_3864103_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_088918652.1|3864095_3865322_+	CoA transferase	NA	NA	NA	NA	NA
WP_088921893.1|3865348_3866992_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_088918653.1|3866984_3868370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918654.1|3868645_3869188_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_088918655.1|3869187_3870495_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_088918656.1|3870548_3871673_+	C4-dicarboxylate TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157736051.1|3872736_3873072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088916797.1|3874130_3874613_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088916798.1|3874593_3875268_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088921895.1|3875395_3876271_-	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	41.7	8.2e-57
WP_088921896.1|3876337_3876946_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157736052.1|3876948_3877128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088918659.1|3877369_3877978_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157736053.1|3878117_3879251_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_088918661.1|3879427_3880165_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088918662.1|3880245_3880515_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_088918663.1|3880537_3881749_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_088918664.1|3881794_3882049_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_088915928.1|3882157_3882592_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	29.2	4.7e-13
WP_157736054.1|3882917_3883361_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_088918666.1|3883482_3884460_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_088918667.1|3884512_3885211_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_088918668.1|3885231_3886131_+	haloalkane dehalogenase	NA	NA	NA	NA	NA
WP_088918669.1|3886218_3887301_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088918670.1|3887595_3887991_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_088918671.1|3888103_3889192_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	29.6	2.5e-10
WP_088917056.1|3891399_3891837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088917055.1|3891895_3892894_-|integrase	site-specific integrase	integrase	B8R670	Lactobacillus_phage	24.5	1.3e-05
WP_088917054.1|3892890_3893817_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157735833.1|3893813_3894692_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3894288:3894302	attR	CATCAGCAGGATCGC	NA	NA	NA	NA
WP_157735832.1|3894794_3894980_+	hypothetical protein	NA	NA	NA	NA	NA
3894288:3894302	attR	CATCAGCAGGATCGC	NA	NA	NA	NA
WP_088917052.1|3896308_3897118_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.1	1.4e-34
WP_088917051.1|3897114_3897339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736055.1|3898330_3899410_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088918674.1|3899406_3900036_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_088917300.1|3900072_3901305_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_088918675.1|3901408_3902728_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_169727476.1|3902835_3903528_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088918677.1|3903717_3904464_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088918678.1|3904622_3905828_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_088918679.1|3905851_3907300_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_088918680.1|3907364_3908306_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_088918681.1|3908362_3909298_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_088917073.1|3909696_3910206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088917074.1|3910202_3910994_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.7	8.5e-37
WP_088917075.1|3910974_3912516_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	28.1	8.6e-25
WP_088918682.1|3913846_3914245_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_088918684.1|3914729_3915533_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_088918685.1|3916379_3916946_+	hypothetical protein	NA	A0A222YYQ2	Escherichia_phage	28.7	1.4e-09
WP_088918686.1|3917288_3918242_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_088918687.1|3918458_3919253_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3920098:3920111	attR	TCCGATTCAAGCAT	NA	NA	NA	NA
>prophage 8
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	4338361	4349844	7783862	integrase,transposase	Enterobacteria_phage(100.0%)	12	4337623:4337638	4356168:4356183
4337623:4337638	attL	TAAAACAACCCTGCTC	NA	NA	NA	NA
WP_088918997.1|4338361_4339921_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	28.1	8.7e-25
WP_088918998.1|4339901_4340693_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.7	1.5e-36
WP_088917073.1|4340689_4341199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088918999.1|4341260_4342574_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_088919000.1|4345385_4345742_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_088919001.1|4345734_4346256_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_157736105.1|4346341_4346476_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157736107.1|4346450_4347008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088919003.1|4347369_4347681_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_088921932.1|4347695_4348046_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088919004.1|4348503_4348788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919005.1|4348923_4349844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
4356168:4356183	attR	TAAAACAACCCTGCTC	NA	NA	NA	NA
>prophage 9
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	5057619	5201188	7783862	transposase,tRNA	Leptospira_phage(23.53%)	107	NA	NA
WP_088919549.1|5057619_5058300_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_088919550.1|5058584_5059928_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.1	4.2e-76
WP_157736175.1|5060028_5061402_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_157736176.1|5061398_5062460_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_088919553.1|5062462_5063785_+	DUF4910 domain-containing protein	NA	NA	NA	NA	NA
WP_088922010.1|5063828_5065055_-	class I SAM-dependent methyltransferase	NA	A0A1V0SJ68	Klosneuvirus	25.4	6.4e-23
WP_157736177.1|5065411_5066329_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_088919555.1|5066501_5067566_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_088919556.1|5067695_5069006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736178.1|5072780_5074022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919558.1|5074244_5075528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919559.1|5075584_5076730_+	VanZ family protein	NA	NA	NA	NA	NA
WP_157736179.1|5076671_5077853_-	glycosyltransferase family 61 protein	NA	NA	NA	NA	NA
WP_157736180.1|5077849_5078983_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_157736181.1|5078975_5079485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919563.1|5079481_5079988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736182.1|5080000_5081479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736183.1|5081488_5082418_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_088919567.1|5082771_5083665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919568.1|5083844_5086586_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_088919569.1|5086585_5087155_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_157736184.1|5087360_5088644_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_088919571.1|5088833_5090981_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_157736185.1|5091212_5092829_+	heparinase II/III family protein	NA	NA	NA	NA	NA
WP_088919573.1|5092825_5094052_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_088919574.1|5094170_5094728_-	acyltransferase	NA	NA	NA	NA	NA
WP_088919187.1|5094845_5096321_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088919575.1|5096368_5096908_-	acyltransferase	NA	NA	NA	NA	NA
WP_088919576.1|5097138_5098620_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.1	3.2e-53
WP_088919577.1|5098814_5099747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919578.1|5099750_5101469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736186.1|5101473_5102061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736187.1|5102446_5105065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169727508.1|5105284_5107984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736189.1|5108009_5108477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736190.1|5108598_5109144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919583.1|5109451_5109796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736191.1|5110494_5111142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919585.1|5111152_5113567_-	glycoside hydrolase family 16 protein	NA	M1HYC6	Paramecium_bursaria_Chlorella_virus	23.6	1.4e-13
WP_088919586.1|5113962_5115168_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_088919587.1|5115693_5116845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919588.1|5117192_5118449_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_088919589.1|5118909_5120256_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_088919590.1|5120380_5121571_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_088919591.1|5121578_5122703_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	46.4	4.4e-103
WP_088919592.1|5122695_5123706_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	36.3	5.0e-42
WP_088922011.1|5123744_5124599_-	SDR family oxidoreductase	NA	A0A167RG57	Powai_lake_megavirus	32.5	9.5e-34
WP_088919593.1|5124643_5125708_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_088919594.1|5125805_5126897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919595.1|5127016_5127274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736192.1|5127365_5129339_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_088919597.1|5130163_5131615_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_088921977.1|5131656_5132694_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088919598.1|5132777_5133746_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088919599.1|5133819_5134140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919600.1|5134142_5134502_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.6	4.6e-14
WP_088919601.1|5134619_5136176_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.7	2.3e-41
WP_088915919.1|5136259_5136700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088915918.1|5136699_5137137_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_088915917.1|5137133_5138849_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_157736193.1|5139163_5139655_+|transposase	transposase	transposase	S5VTP8	Leptospira_phage	38.1	2.3e-24
WP_088919603.1|5140118_5140754_-	acetyltransferase	NA	NA	NA	NA	NA
WP_088919604.1|5140931_5142212_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_157736194.1|5142672_5143047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919606.1|5143071_5144019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919607.1|5144089_5145754_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	42.9	2.5e-107
WP_088919608.1|5145750_5145957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919609.1|5145997_5146783_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.6	7.7e-22
WP_169727509.1|5147529_5148762_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_157736195.1|5149215_5149563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919612.1|5149866_5151228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157736196.1|5152519_5153455_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_088919614.1|5153774_5154479_-	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	34.1	1.2e-13
WP_157736197.1|5155356_5155974_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_169727510.1|5156010_5157246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088922013.1|5158948_5160034_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_157736199.1|5160169_5161318_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_088919618.1|5161329_5161902_-	sugar transferase	NA	NA	NA	NA	NA
WP_088919619.1|5161985_5163119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919620.1|5163211_5164390_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2P1ELT3	Moumouvirus	44.7	1.2e-90
WP_088919621.1|5164914_5166192_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_088919622.1|5166188_5167505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919623.1|5169358_5171350_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_088916798.1|5171799_5172474_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_088916797.1|5172454_5172937_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157736200.1|5173278_5173836_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_088919625.1|5174013_5175348_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_088919599.1|5177370_5177691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919600.1|5177693_5178053_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.6	4.6e-14
WP_088919626.1|5178170_5179754_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.7	2.3e-41
WP_157736201.1|5180203_5180503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919628.1|5180661_5181048_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_088919629.1|5181307_5181589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088919630.1|5181668_5182997_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_157736202.1|5183084_5183939_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_169727511.1|5184122_5188037_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_088919633.1|5188607_5189648_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_088919634.1|5190026_5190356_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157736203.1|5190515_5190953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736204.1|5190949_5192272_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088919635.1|5192564_5193527_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_088919636.1|5193557_5193926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736205.1|5194157_5197325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169727512.1|5198242_5198452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919639.1|5198490_5199159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088919640.1|5199163_5199511_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088919641.1|5199700_5201188_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.2	8.2e-57
>prophage 10
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	6528192	6549827	7783862	transposase	Serratia_phage(33.33%)	22	NA	NA
WP_088920620.1|6528192_6528627_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088919669.1|6528608_6529949_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_157736324.1|6530097_6530361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157736325.1|6530357_6531392_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_088920623.1|6531430_6532165_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	34.1	6.1e-29
WP_169727539.1|6532291_6532843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088920625.1|6533730_6536430_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_088920626.1|6536729_6537065_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_088920627.1|6537061_6537337_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_088920628.1|6537495_6537663_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	52.1	2.7e-09
WP_088920629.1|6537668_6537950_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	40.0	7.7e-09
WP_088920630.1|6538115_6538496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088920631.1|6538653_6540030_-	Fic family protein	NA	NA	NA	NA	NA
WP_088920632.1|6540264_6540600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088920633.1|6540580_6540859_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088920634.1|6540967_6542443_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_157736326.1|6542451_6543588_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_088920635.1|6543584_6544766_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_088920636.1|6545264_6545849_-	dTMP kinase	NA	NA	NA	NA	NA
WP_088920637.1|6545864_6548348_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157736327.1|6548409_6549042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088920639.1|6549047_6549827_-|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP018632	Granulosicoccus antarcticus IMCC3135 chromosome, complete genome	7783862	7583563	7638895	7783862	transposase	Paramecium_bursaria_Chlorella_virus(20.0%)	52	NA	NA
WP_088921455.1|7583563_7584640_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A220NS37	Mycobacterium_phage	30.4	3.9e-24
WP_088921456.1|7584831_7585086_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_088921457.1|7585082_7585334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088921458.1|7585437_7586304_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088921459.1|7586310_7587519_-	MFS transporter	NA	NA	NA	NA	NA
WP_169727560.1|7587511_7588282_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_088921461.1|7588748_7590860_+	N,N-dimethylformamidase large subunit	NA	NA	NA	NA	NA
WP_088921462.1|7590991_7591237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088921463.1|7591375_7591777_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_088921464.1|7591856_7592783_+	DMT family transporter	NA	NA	NA	NA	NA
WP_088921465.1|7592988_7594131_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_088921466.1|7594140_7594527_+	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_088921467.1|7594573_7595509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736503.1|7595520_7596213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088921469.1|7596571_7597363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736504.1|7597362_7598361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157736505.1|7598416_7599181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921472.1|7599257_7599551_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_088921473.1|7599750_7601331_+	alkaline phosphatase D family protein	NA	NA	NA	NA	NA
WP_157736506.1|7601342_7601726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921475.1|7601741_7603370_-	family 16 glycosylhydrolase	NA	M1HXK4	Paramecium_bursaria_Chlorella_virus	30.8	1.5e-11
WP_088921476.1|7603521_7605111_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_157736507.1|7605165_7605756_-	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_088921478.1|7605955_7607308_+	MFS transporter	NA	NA	NA	NA	NA
WP_169727599.1|7607292_7608150_-	DMT family transporter	NA	NA	NA	NA	NA
WP_088921480.1|7608215_7610048_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.3	2.1e-131
WP_088921481.1|7610100_7611456_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.3	2.3e-34
WP_088921482.1|7611618_7612062_-	response regulator	NA	NA	NA	NA	NA
WP_088921483.1|7612058_7614140_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.5	2.3e-09
WP_088922209.1|7614399_7615692_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_088921484.1|7615883_7616828_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	30.8	5.8e-24
WP_088921485.1|7616830_7617877_+	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	47.7	5.9e-86
WP_088921486.1|7618320_7619553_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_088921487.1|7619663_7620932_-	MFS transporter	NA	NA	NA	NA	NA
WP_169727561.1|7621105_7623487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921489.1|7623701_7624241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921490.1|7624595_7625633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921491.1|7625874_7626153_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	43.1	8.8e-05
WP_088921492.1|7626178_7626484_+	HigA family addiction module antidote protein	NA	A0A2I7R1P1	Vibrio_phage	36.1	7.9e-07
WP_088915895.1|7626604_7627957_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	25.6	6.2e-19
WP_088921493.1|7628696_7628990_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_088921494.1|7628986_7629217_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_157736508.1|7629511_7630249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157736509.1|7630184_7631564_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_088921977.1|7631647_7632685_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157736510.1|7632984_7633464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088921496.1|7633677_7633917_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_088921497.1|7633876_7634143_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_088922210.1|7634843_7635059_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_088921498.1|7635060_7635456_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_088917405.1|7635632_7636994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_088917300.1|7637662_7638895_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
