The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	257354	265302	5498820		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|257354_257639_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|257677_259312_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743909.1|259718_261257_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833082.1|261641_262967_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	6.4e-45
WP_000929885.1|263111_263813_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000719223.1|263796_265302_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.3	5.4e-32
>prophage 2
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	297579	305955	5498820		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|297579_298887_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|298975_299695_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|299687_299942_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666775.1|299938_300622_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055555.1|300605_302825_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	8.8e-164
WP_000879025.1|302809_304225_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|304330_305371_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|305367_305955_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	1832065	1840741	5498820		Bacillus_phage(66.67%)	8	NA	NA
WP_000755507.1|1832065_1833352_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194314.1|1833451_1834216_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453886.1|1834456_1836217_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.4	6.3e-274
WP_000612413.1|1836302_1836980_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	2.5e-122
WP_001231631.1|1836976_1838050_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.5	3.9e-186
WP_000823542.1|1838074_1838662_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1838858_1839578_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258500.1|1839868_1840741_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.1	7.4e-66
>prophage 4
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	2191142	2249909	5498820	tail,portal,integrase,terminase,bacteriocin	Bacillus_phage(43.75%)	60	2184703:2184725	2255723:2255745
2184703:2184725	attL	GAAGCAAAGAAGTTAGGTGGGGG	NA	NA	NA	NA
WP_073339430.1|2191142_2192279_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	35.4	2.9e-54
WP_073339433.1|2192543_2192981_+	helix-turn-helix domain-containing protein	NA	A0A142F1P0	Bacillus_phage	59.2	1.0e-36
WP_073339435.1|2193393_2193738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339438.1|2194152_2194299_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_073339440.1|2194295_2194682_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	38.2	9.3e-13
WP_073339443.1|2194760_2195468_+	DUF723 domain-containing protein	NA	G9J2C6	Bacillus_phage	55.0	1.0e-12
WP_073339445.1|2195467_2196232_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.3	9.9e-75
WP_073339447.1|2196570_2197245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073339450.1|2197374_2197656_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	48.3	3.4e-12
WP_073339452.1|2198074_2199418_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.1	1.5e-134
WP_073339455.1|2199444_2200461_+	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	42.6	2.6e-70
WP_085962721.1|2200468_2200654_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000568403.1|2200718_2200922_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073339458.1|2201036_2202254_+	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	47.7	5.4e-99
WP_073339460.1|2202565_2203213_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_073339463.1|2203725_2204478_+	single-stranded DNA-binding protein	NA	A0A0N9SJW5	Paenibacillus_phage	48.8	2.2e-58
WP_073339466.1|2204490_2204898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339472.1|2206420_2209261_+	hypothetical protein	NA	A0A0N9S7Z3	Paenibacillus_phage	40.3	5.9e-104
WP_073339474.1|2209253_2209403_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_083605814.1|2209483_2209732_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	75.0	2.0e-08
WP_083605815.1|2209848_2210901_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	59.5	5.2e-90
WP_073339479.1|2210887_2211412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339481.1|2211765_2212509_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	66.7	2.5e-86
WP_073339483.1|2212676_2213042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339486.1|2213043_2213673_+	hypothetical protein	NA	J9Q953	Bacillus_phage	42.2	1.8e-34
WP_073339489.1|2213739_2214186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073339492.1|2214642_2216130_+	DNA (cytosine-5-)-methyltransferase	NA	Q77YW9	Bacillus_phage	44.4	1.1e-106
WP_073339495.1|2216134_2216539_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0N9RZI0	Paenibacillus_phage	41.0	1.2e-15
WP_073339498.1|2216538_2217066_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	44.0	2.4e-19
WP_073339501.1|2217343_2218747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339505.1|2218819_2219059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073339508.1|2219444_2220632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339511.1|2220940_2222770_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_000673113.1|2223081_2223366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339517.1|2223608_2224046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180308.1|2224308_2224950_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	34.4	6.7e-32
WP_073339520.1|2225072_2225471_+	hypothetical protein	NA	A0A0N7GFF5	Paenibacillus_phage	65.0	4.0e-35
WP_073339522.1|2225942_2226491_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	59.0	5.9e-45
WP_073339525.1|2226935_2228381_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	52.6	1.1e-135
WP_073339528.1|2228397_2229912_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	30.7	7.3e-69
WP_073339531.1|2229997_2230651_+	scaffolding protein	NA	A0A2H4IZP8	uncultured_Caudovirales_phage	44.4	1.1e-08
WP_073339534.1|2230715_2231840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339537.1|2231890_2232085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083605817.1|2232100_2232442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339540.1|2232446_2233253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339542.1|2233256_2233631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339544.1|2233630_2233990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339547.1|2233991_2234399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339550.1|2234416_2234926_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_073339553.1|2235005_2235380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073339557.1|2235421_2235724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083605818.1|2235747_2239533_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	43.5	7.0e-12
WP_073339560.1|2239510_2241025_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	77.7	9.1e-213
WP_073339562.1|2241021_2245329_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.6	0.0e+00
WP_073339564.1|2245344_2245719_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	95.9	3.0e-64
WP_000480958.1|2245757_2245994_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B0T697	Bacillus_phage	54.1	3.9e-14
WP_073339567.1|2245990_2247088_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	66.8	2.9e-136
WP_073339570.1|2247142_2248054_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_073339573.1|2248290_2249562_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	47.1	3.8e-103
WP_073339630.1|2249567_2249909_+	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	33.3	2.9e-10
2255723:2255745	attR	GAAGCAAAGAAGTTAGGTGGGGG	NA	NA	NA	NA
>prophage 5
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	3665793	3677524	5498820	holin	Bacillus_phage(50.0%)	16	NA	NA
WP_000413738.1|3665793_3666414_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976237.1|3666504_3667308_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031387.1|3667308_3667851_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3667843_3668167_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000725955.1|3669205_3670261_-	SH3 domain-containing protein	NA	A0A1B0T6C8	Bacillus_phage	69.2	2.4e-143
WP_000570187.1|3670257_3670497_-|holin	holin	holin	A0A0A7AR38	Bacillus_phage	78.7	1.3e-25
WP_000348875.1|3670496_3670733_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	87.2	1.8e-14
WP_002026207.1|3670810_3671017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051360.1|3671365_3672187_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	38.6	1.2e-20
WP_025921790.1|3672536_3673514_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.9	1.1e-33
WP_000464425.1|3673752_3674139_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_000511413.1|3674257_3675130_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	72.3	1.9e-93
WP_001189065.1|3675282_3675477_-	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	71.0	1.7e-15
WP_000531225.1|3675488_3676247_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	9.2e-97
WP_000283431.1|3676449_3676662_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000241483.1|3676852_3677524_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	5.7e-34
>prophage 6
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	4406086	4496877	5498820	capsid,tail,tRNA,portal,protease,terminase,head,coat	uncultured_Caudovirales_phage(57.14%)	94	NA	NA
WP_000125365.1|4406086_4407226_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354018.1|4407238_4408291_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|4408310_4408511_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344449.1|4408507_4409509_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464511.1|4409514_4410132_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823606.1|4410320_4411265_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871192.1|4411278_4411809_-	BofC protein	NA	NA	NA	NA	NA
WP_000721223.1|4412238_4412673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093536.1|4412706_4413351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089030276.1|4413529_4415380_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025339.1|4415605_4416712_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092227.1|4416741_4417575_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138533.1|4417594_4419124_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973770.1|4419275_4420418_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.9	3.8e-30
WP_000812275.1|4420417_4420960_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510677.1|4421039_4421687_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621705.1|4421791_4422643_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001028684.1|4422739_4424653_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011411.1|4424702_4426625_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114528.1|4426599_4427376_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	3.5e-19
WP_000865179.1|4427469_4428552_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276723.1|4428541_4429249_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497128.1|4429389_4430676_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003584.1|4430675_4431224_-	sporulation protein	NA	NA	NA	NA	NA
WP_000270907.1|4431937_4432246_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855484.1|4432415_4433804_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599058.1|4433871_4434732_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797471.1|4434724_4435471_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4435604_4436402_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391521.1|4436404_4437091_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975764.1|4437126_4437672_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135488.1|4437686_4438538_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4438579_4439599_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_086874344.1|4440267_4441101_+	cytosolic protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	89.2	1.4e-119
WP_086874343.1|4442089_4442422_+	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	57.3	1.0e-23
WP_086874342.1|4442457_4443303_-	SH3 domain-containing protein	NA	J9PQX3	Bacillus_phage	68.4	1.2e-118
WP_033684692.1|4443302_4443515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818883.1|4443523_4443763_-	peptidase	NA	A0A1B1P7E0	Bacillus_phage	86.1	8.0e-31
WP_001032146.1|4443852_4444704_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4JE88	uncultured_Caudovirales_phage	60.1	8.7e-88
WP_089030277.1|4444756_4445263_-	hypothetical protein	NA	A0A2H4J980	uncultured_Caudovirales_phage	42.3	1.8e-16
WP_000793590.1|4445249_4445432_-	hypothetical protein	NA	A0A2H4JAY5	uncultured_Caudovirales_phage	61.7	1.1e-13
WP_000916428.1|4445433_4447521_-	hypothetical protein	NA	A0A2H4JG80	uncultured_Caudovirales_phage	80.6	4.3e-261
WP_086709340.1|4447552_4449274_-	SGNH/GDSL hydrolase family protein	NA	A0A2H4JE88	uncultured_Caudovirales_phage	34.2	1.6e-19
WP_086709342.1|4449290_4450103_-|tail	phage tail family protein	tail	A0A2H4J982	uncultured_Caudovirales_phage	67.4	4.0e-106
WP_086874341.1|4450099_4453651_-|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	71.5	9.2e-224
WP_086874340.1|4453667_4453883_-	hypothetical protein	NA	A0A2H4J849	uncultured_Caudovirales_phage	90.2	4.3e-28
WP_086874339.1|4453888_4454278_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	85.9	1.1e-56
WP_086874338.1|4454288_4454915_-|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	79.8	2.2e-88
WP_086874337.1|4454920_4455304_-	hypothetical protein	NA	A0A2H4J971	uncultured_Caudovirales_phage	93.7	9.7e-63
WP_086874336.1|4455303_4455633_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	91.7	6.0e-53
WP_142285468.1|4455622_4455952_-	hypothetical protein	NA	A0A2H4J9Y9	uncultured_Caudovirales_phage	94.5	1.3e-52
WP_086874333.1|4455932_4456193_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	87.2	7.3e-38
WP_086874331.1|4456194_4457511_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	91.7	3.9e-196
WP_136999984.1|4457512_4458094_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	94.3	3.3e-94
WP_086874327.1|4458083_4459268_-|portal	phage portal protein	portal	A0A2H4JBS9	uncultured_Caudovirales_phage	94.9	6.4e-214
WP_060851542.1|4459372_4461097_-|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	94.9	0.0e+00
WP_060851541.1|4461093_4461528_-	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	94.4	3.9e-68
WP_000872542.1|4461647_4462013_-	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	9.0e-42
WP_086874349.1|4462009_4462291_-	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	80.0	1.1e-34
WP_086874325.1|4462356_4462971_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_038413844.1|4463141_4463528_-	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	74.4	4.4e-47
WP_086874323.1|4463944_4464286_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	96.5	7.3e-54
WP_086874321.1|4464319_4464859_-	nuclease	NA	A0A2H4J819	uncultured_Caudovirales_phage	90.5	2.5e-88
WP_086874348.1|4464861_4465209_-	hypothetical protein	NA	H0USU9	Bacillus_phage	53.7	6.0e-27
WP_086874320.1|4465241_4465676_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	95.1	2.1e-74
WP_086874318.1|4465974_4468362_-	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	93.6	0.0e+00
WP_000495504.1|4468431_4468866_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	66.9	1.7e-50
WP_061884630.1|4468865_4469795_-	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	54.6	1.2e-90
WP_061884631.1|4469797_4470346_-	hypothetical protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	92.3	1.2e-90
WP_000588493.1|4470323_4470605_-	hypothetical protein	NA	A0A2H4J9A3	uncultured_Caudovirales_phage	83.7	9.7e-36
WP_001041415.1|4470597_4470804_-	hypothetical protein	NA	A0A1B1P7L2	Bacillus_phage	49.2	3.0e-10
WP_086874316.1|4470897_4471245_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	90.4	1.5e-54
WP_086874314.1|4471527_4471782_-	transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	91.7	1.1e-38
WP_016084484.1|4471952_4472639_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	97.4	9.4e-125
WP_086874312.1|4472724_4474116_+	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	92.7	3.1e-244
WP_001013397.1|4474119_4474518_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226290.1|4474564_4475140_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000361013.1|4475372_4476323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000582064.1|4476488_4477790_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072244.1|4477883_4480529_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.2e-164
WP_000350658.1|4481048_4482074_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_002026373.1|4482140_4483151_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712934.1|4483231_4484518_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087052.1|4484517_4485507_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992356.1|4485527_4486280_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226421.1|4486282_4487212_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000007721.1|4487227_4488061_-	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_000547868.1|4488078_4489413_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133916.1|4489829_4490282_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359781.1|4490284_4490701_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869116.1|4490734_4491331_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097289.1|4491327_4493658_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	1.2e-176
WP_000119176.1|4493840_4495511_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	7.4e-14
WP_000472289.1|4495617_4496877_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 7
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	4543678	4551363	5498820		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221070.1|4543678_4544602_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.4e-46
WP_000247686.1|4544726_4545662_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	26.6	7.8e-13
WP_000018056.1|4545663_4546356_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001014310.1|4546698_4546893_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001235506.1|4546931_4548131_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4548426_4548750_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086126.1|4548822_4549587_-	class B sortase	NA	NA	NA	NA	NA
WP_000403758.1|4549619_4550390_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
WP_001036832.1|4550379_4551363_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	6.5e-18
>prophage 8
NZ_CP016360	Bacillus cereus strain M13 chromosome, complete genome	5498820	4938728	4979930	5498820	protease,coat,transposase	Bacillus_virus(28.57%)	49	NA	NA
WP_000614215.1|4938728_4939730_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|4939850_4940342_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351158.1|4940365_4940845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106081.1|4941007_4942111_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856307.1|4942055_4943402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241507.1|4943407_4944520_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	31.7	5.2e-40
WP_000575372.1|4944516_4945332_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000683440.1|4945887_4946469_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000289908.1|4946503_4947034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276467.1|4947147_4947912_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503345.1|4948021_4948654_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274006.1|4948734_4949175_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|4949322_4950294_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392606.1|4950310_4950577_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_001040868.1|4950726_4952196_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	38.8	1.2e-65
WP_001174567.1|4952609_4953107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435943.1|4953152_4953455_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744132.1|4953573_4954152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178779.1|4954186_4954921_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033684597.1|4955021_4955837_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001038434.1|4955862_4956294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721022.1|4956427_4956982_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272746.1|4957056_4957536_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166372.1|4957557_4958454_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944663.1|4958643_4959627_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_033684598.1|4959700_4960432_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248466.1|4960486_4960789_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_073340003.1|4960854_4962246_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001118827.1|4963040_4964438_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|4964486_4964918_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020773.1|4964907_4966128_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.4	1.2e-117
WP_000152167.1|4966127_4967420_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929160.1|4967435_4968221_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	1.3e-08
WP_000757013.1|4968459_4969266_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000735099.1|4969337_4970150_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|4970173_4970839_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000601753.1|4970831_4971857_-	methionine ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_001242136.1|4972400_4972745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568171.1|4972897_4973197_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640870.1|4973209_4973554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026897.1|4973810_4974194_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218968.1|4974235_4974601_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000826874.1|4975011_4975539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713769.1|4975682_4976330_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666172.1|4976390_4977404_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_100650841.1|4977426_4978626_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001002981.1|4978622_4978871_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001180555.1|4978884_4979070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232994.1|4979216_4979930_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
