The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	756156	886874	5865644	integrase,transposase	Mycobacterium_phage(42.86%)	97	768782:768799	821854:821871
WP_129560167.1|756156_756519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089150873.1|756506_758876_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.2	1.7e-85
WP_033718771.1|758931_759228_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_033718775.1|759456_761745_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	4.3e-89
WP_033718759.1|761809_762106_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_007170255.1|762187_762544_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065018912.1|762615_763437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085981751.1|763516_764533_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033719466.1|764529_766488_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099459185.1|766610_767351_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_007172144.1|767618_767924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042910679.1|767920_768148_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_007172147.1|768633_770124_+	type VII secretion protein EccB	NA	NA	NA	NA	NA
768782:768799	attL	TGGGTGTGGTGCTCGTGG	NA	NA	NA	NA
WP_007172148.1|770197_771253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172149.1|771242_774341_+	type VII secretion protein EccCb	NA	A0A0A0RUH6	Bacillus_phage	30.1	1.2e-20
WP_007172150.1|774337_774754_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_101930858.1|774993_775287_+	PE domain-containing protein	NA	NA	NA	NA	NA
WP_007172152.1|775302_776784_+	PPE family protein	NA	NA	NA	NA	NA
WP_007172153.1|776862_777165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042910680.1|777213_777507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172155.1|777503_778445_+	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_007172156.1|779213_780095_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_007172157.1|780091_781588_+	type VII secretion integral membrane protein EccD	NA	V5UN55	Mycobacterium_phage	26.3	4.0e-11
WP_040624272.1|781587_783225_+	S8 family serine peptidase	NA	V5UPA7	Mycobacterium_phage	35.1	1.8e-60
WP_007172159.1|783224_784769_+	type VII secretion protein EccE	NA	NA	NA	NA	NA
WP_080691135.1|784834_785656_+	DUF2637 domain-containing protein	NA	V5UP70	Mycobacterium_phage	32.1	1.6e-17
WP_040624275.1|785750_787154_+	type IV secretory system conjugative DNA transfer family protein	NA	V5UN59	Mycobacterium_phage	38.4	3.0e-16
WP_007172162.1|787353_787632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172163.1|787731_788550_-	hypothetical protein	NA	V5UQM8	Mycobacterium_phage	28.8	2.4e-10
WP_073877511.1|788539_788923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172165.1|789053_789500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046182038.1|789496_790579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073877513.1|790589_791513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101930857.1|791622_791865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080691140.1|792119_794774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172171.1|794770_796930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172172.1|796926_798732_+	AAA family ATPase	NA	V5UQM2	Mycobacterium_phage	27.2	1.8e-53
WP_154074410.1|798721_798895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172175.1|799448_801245_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	23.8	8.2e-11
WP_007172176.1|801291_802848_-	serine/threonine protein kinase	NA	M1HJA5	Acanthocystis_turfacea_Chlorella_virus	35.0	1.9e-19
WP_046182041.1|803054_808910_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_007172179.1|809205_809718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172180.1|809745_810240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073877504.1|811439_811958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101930856.1|812029_812662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_007172184.1|812838_813309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172185.1|813305_815507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172186.1|815503_817228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162839945.1|817227_818697_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_007172195.1|822476_822803_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
821854:821871	attR	CCACGAGCACCACACCCA	NA	NA	NA	NA
WP_087139680.1|823858_825128_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	41.7	3.7e-50
WP_040624281.1|825215_825500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040624304.1|825629_826664_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.5	7.0e-31
WP_087139632.1|826914_828062_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	32.4	9.2e-32
WP_033717415.1|829183_829783_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101930920.1|830211_830823_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172201.1|830898_831345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042910691.1|831459_832356_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_008263955.1|832352_835298_-	RND family transporter	NA	NA	NA	NA	NA
WP_007172204.1|836243_836885_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172205.1|837133_837298_+	DUF5078 domain-containing protein	NA	NA	NA	NA	NA
WP_042909973.1|837337_840271_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_008263966.1|840267_840687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033721600.1|841294_842305_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042909972.1|844219_845494_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	48.0	4.8e-98
WP_042909917.1|846339_847482_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042909971.1|847558_848215_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_042909918.1|848211_849669_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007172211.1|851179_851632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172212.1|851646_852159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172213.1|852155_852491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033721564.1|852477_853869_-	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_007172215.1|853865_854039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172216.1|854495_855650_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_033721567.1|855690_856878_+	thiolase family protein	NA	NA	NA	NA	NA
WP_033721568.1|856889_857279_+	Zn-ribbon domain-containing OB-fold protein	NA	NA	NA	NA	NA
WP_157679851.1|857330_857876_+	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	61.8	6.7e-41
WP_007172220.1|858269_859817_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.6	9.4e-48
WP_007172221.1|859879_861079_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_136244867.1|861718_862501_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046184313.1|862715_863516_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_007172224.1|863903_865457_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.2	1.4e-35
WP_007172225.1|865549_866608_+	BtrH N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_033721541.1|866952_868404_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046184315.1|868851_869463_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172228.1|869519_870818_+	cytochrome P450	NA	NA	NA	NA	NA
WP_007172229.1|870829_871021_+	ferredoxin	NA	NA	NA	NA	NA
WP_007172230.1|871142_872201_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046186391.1|875090_876878_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	1.8e-82
WP_007172236.1|877590_878829_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.6	1.9e-06
WP_007172237.1|879161_879485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165589952.1|879652_880513_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_007172240.1|880558_882124_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087588774.1|883795_885053_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.7	1.0e-68
WP_165589950.1|885533_885929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007172251.1|885962_886100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007172252.1|886094_886874_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	919653	973388	5865644	integrase,transposase	Staphylococcus_phage(33.33%)	41	917246:917261	954394:954409
917246:917261	attL	CGCGCGCGAACACCCC	NA	NA	NA	NA
WP_046182709.1|919653_922119_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042909842.1|922115_923339_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033721569.1|924499_926008_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	32.8	8.1e-28
WP_033721570.1|926140_927037_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007172283.1|927089_927530_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_046182710.1|927578_928226_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007172286.1|928346_929840_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_007172287.1|929836_930934_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_007172288.1|932455_933001_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_087139643.1|935235_936499_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.4	1.9e-70
WP_046187034.1|937660_940594_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_042909907.1|940590_941001_-	membrane protein	NA	NA	NA	NA	NA
WP_007172294.1|941105_942299_-	cytochrome P450	NA	NA	NA	NA	NA
WP_007172295.1|942364_942946_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033717424.1|943591_944215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087139652.1|944199_944811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101930934.1|945452_946706_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.1	6.1e-29
WP_075630243.1|947137_948373_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.2	1.7e-84
WP_069434871.1|948906_949329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007168379.1|949832_950477_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007168380.1|950526_950967_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_007168381.1|951019_951916_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019732564.1|951963_952179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042909903.1|952708_954157_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.1	3.3e-55
WP_007168385.1|954903_955494_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
954394:954409	attR	GGGGTGTTCGCGCGCG	NA	NA	NA	NA
WP_007168386.1|955581_956883_+	cytochrome P450	NA	NA	NA	NA	NA
WP_074021704.1|956894_957086_+	ferredoxin	NA	NA	NA	NA	NA
WP_033717470.1|957218_958235_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033712834.1|958427_959297_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_057969459.1|959373_960078_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_074021707.1|960104_960704_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007168393.1|960907_961744_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007168394.1|961762_962686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042909902.1|962682_964329_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_007168396.1|964403_965927_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007168397.1|965923_966892_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075630242.1|967069_968527_+	cytochrome P450	NA	NA	NA	NA	NA
WP_042909899.1|968523_969180_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_085981616.1|969212_970829_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.5	1.6e-26
WP_042909895.1|970877_972020_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_008256196.1|972314_973388_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	996940	1046960	5865644	integrase,transposase	Staphylococcus_phage(42.86%)	32	991843:991859	1037445:1037461
991843:991859	attL	CCCGGCATCGCCGCGGT	NA	NA	NA	NA
WP_046184758.1|996940_998293_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	6.3e-32
WP_007168431.1|998920_999247_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042909891.1|1001829_1003065_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.2	1.0e-84
WP_007168435.1|1003916_1004435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101930905.1|1004503_1005598_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007168437.1|1006989_1008156_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.1	1.6e-07
WP_007168443.1|1011010_1011442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007168449.1|1014082_1015711_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.3	6.7e-28
WP_007168450.1|1015763_1016705_+	R2-like ligand-binding oxidase	NA	NA	NA	NA	NA
WP_007168451.1|1016911_1017337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101930904.1|1017354_1018479_+	thiolase family protein	NA	NA	NA	NA	NA
WP_007168453.1|1018545_1019439_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_007168454.1|1019469_1021089_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	1.1e-30
WP_050790029.1|1021336_1022458_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_007168458.1|1024132_1025350_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_074021181.1|1025876_1026374_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_007168461.1|1026481_1027888_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_007168462.1|1027934_1028081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168467.1|1030210_1030537_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_007168468.1|1030885_1031164_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154074411.1|1031160_1031316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007168470.1|1031391_1031841_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_040622630.1|1033101_1034184_+	dihydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_136244823.1|1036609_1036891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167310147.1|1037020_1037209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157137495.1|1037807_1038254_-	hypothetical protein	NA	A0A220NQR7	Corynebacterium_phage	40.8	2.9e-10
1037445:1037461	attR	ACCGCGGCGATGCCGGG	NA	NA	NA	NA
WP_075362207.1|1038879_1039191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042910040.1|1040527_1041592_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007168486.1|1044183_1044525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007168487.1|1044545_1044953_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_033711258.1|1044956_1045229_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_042909886.1|1045724_1046960_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.0	2.2e-84
>prophage 4
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	2087472	2152587	5865644	integrase,transposase	Mycobacterium_phage(16.67%)	42	2098822:2098881	2105822:2106089
WP_080691159.1|2087472_2088138_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_087139680.1|2088246_2089516_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	41.7	3.7e-50
WP_042911237.1|2089545_2091660_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080691160.1|2091665_2092835_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158090653.1|2092973_2095451_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2098822:2098881	attL	TGTCAATGGCCAAGTTGAAGTATCCGCTGGTGGCCAGATGAAAGTATCCAGCCCGTGCGG	NA	NA	NA	NA
WP_042909842.1|2100068_2101292_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_046182709.1|2101288_2103754_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_042909843.1|2103750_2104038_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_042910261.1|2105002_2105815_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.5	2.9e-32
WP_042910200.1|2106787_2107159_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
2105822:2106089	attR	CCGCACGGGCTGGATACTTTCATCTGGCCACCAGCGGATACTTCAACTTGGCCATTGACAGCCGTCGCGGCGGCAGCCGCGAGGGCGCAGGTTCCCAGCGCGACTCGGCGTCGAAGATTGGTCGTCATTCCGTAACCCCTTTCCACAAAACGCAATTCAGCGGTCTCAGCAGGTTGAGAGATGACATACTCGCGGGGCATGTCGTGGGCGAAGTTGACTTGATAGGGGTGACCCGCTCGGCTATCCGACCAACAGAGCAGTGGGTCAA	NA	NA	NA	NA
WP_042910201.1|2107172_2108096_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_087139686.1|2108238_2108502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154074414.1|2108637_2108787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139315491.1|2108990_2109266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082408970.1|2109565_2110960_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.4	2.2e-48
WP_042910204.1|2112092_2113511_-	NADH-quinone oxidoreductase subunit N	NA	NA	NA	NA	NA
WP_042910205.1|2113514_2115005_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_087139688.1|2115008_2116856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042910207.1|2116852_2117155_-	NADH-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_042910208.1|2117151_2117715_-	NADH:ubiquinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_042910209.1|2117718_2118654_-	NADH-quinone oxidoreductase subunit H	NA	NA	NA	NA	NA
WP_072501252.1|2118646_2119816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042910211.1|2119806_2120151_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_080691115.1|2121434_2122601_+	PLP-dependent cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	33.0	2.6e-34
WP_042910213.1|2125006_2125306_+	PE family protein	NA	NA	NA	NA	NA
WP_042910214.1|2125320_2126496_+	PPE family protein	NA	NA	NA	NA	NA
WP_042910215.1|2126594_2126891_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_042910216.1|2126899_2127184_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_051445804.1|2127452_2128247_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_072501503.1|2128615_2129638_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_074021264.1|2130248_2130440_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_042910217.1|2134546_2136523_-	protein kinase	NA	A0A2K9L111	Tupanvirus	26.0	1.1e-08
WP_042910219.1|2136540_2137638_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_051445801.1|2137747_2139280_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_072501253.1|2139539_2140730_-	PPE family protein	NA	NA	NA	NA	NA
WP_042910221.1|2140752_2141046_-	PE family protein	NA	NA	NA	NA	NA
WP_042910246.1|2142730_2143978_+	MFS transporter	NA	NA	NA	NA	NA
WP_080691117.1|2146327_2147569_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_054585452.1|2147663_2148683_+	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_080691118.1|2148757_2150041_+	amino acid decarboxylase	NA	NA	NA	NA	NA
WP_087139692.1|2150052_2151294_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_087139643.1|2151322_2152587_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	53.4	1.9e-70
>prophage 5
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	2844386	2862386	5865644	integrase,transposase	uncultured_virus(33.33%)	15	2839767:2839781	2864155:2864169
2839767:2839781	attL	GGCGAAGCCGATCAG	NA	NA	NA	NA
WP_129560167.1|2844386_2844749_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089150873.1|2844736_2847106_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.2	1.7e-85
WP_033718771.1|2847161_2847458_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_033718775.1|2847686_2849975_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.3	4.3e-89
WP_033718759.1|2850039_2850336_-	DUF1490 family protein	NA	NA	NA	NA	NA
WP_007170255.1|2850417_2850774_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065018912.1|2850845_2851667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085981751.1|2851746_2852763_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033719466.1|2852759_2854718_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_099459185.1|2854840_2855581_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_072501290.1|2856228_2857167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082402557.1|2857170_2858274_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_054585429.1|2858198_2860076_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_087139680.1|2860256_2861527_-|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	41.7	3.7e-50
WP_157679857.1|2861624_2862386_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
2864155:2864169	attR	GGCGAAGCCGATCAG	NA	NA	NA	NA
>prophage 6
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	3702002	3711092	5865644		Shahe_endorna-like_virus(50.0%)	8	NA	NA
WP_042912268.1|3702002_3703259_+	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	34.4	4.3e-06
WP_042912270.1|3703266_3704046_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009953302.1|3704141_3704945_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020822883.1|3705060_3705867_-	methyltransferase MtfC	NA	A0A2R8FDY2	Brazilian_cedratvirus	53.1	7.6e-57
WP_072501358.1|3705962_3707249_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	44.4	1.2e-08
WP_042912274.1|3707662_3708931_-	glycosyltransferase	NA	A0A1L3KK54	Shahe_endorna-like_virus	38.7	4.3e-06
WP_041298244.1|3709022_3709829_-	macrocin O-methyltransferase	NA	A0A2R8FDY2	Brazilian_cedratvirus	53.1	6.4e-56
WP_042912275.1|3709982_3711092_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	24.3	8.9e-16
>prophage 7
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	4382405	4388981	5865644		Bacillus_phage(33.33%)	7	NA	NA
WP_042912786.1|4382405_4384571_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.6	3.3e-208
WP_008259183.1|4384540_4384993_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.2	5.8e-14
WP_008259184.1|4385024_4385264_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	63.2	1.3e-20
WP_008259185.1|4385792_4386347_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.4	1.2e-05
WP_008259186.1|4386438_4387053_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008259187.1|4387061_4388105_+	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	29.1	3.9e-21
WP_008259188.1|4388039_4388981_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	28.8	1.2e-05
>prophage 8
NZ_CP015278	Mycobacterium chimaera strain DSM 44623 chromosome, complete genome	5865644	4957957	4966603	5865644		Burkholderia_phage(50.0%)	8	NA	NA
WP_014385777.1|4957957_4959484_+	cyclic nucleotide-binding domain-containing protein	NA	W8CYF6	Bacillus_phage	37.4	1.3e-12
WP_042913325.1|4959523_4960363_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042913327.1|4960359_4961226_+	LLM class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008260499.1|4961253_4962249_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.5	5.8e-75
WP_042913511.1|4962250_4962868_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	38.8	1.3e-27
WP_042913329.1|4963067_4964189_+	acyltransferase	NA	A9YX16	Burkholderia_phage	27.7	2.9e-14
WP_042913331.1|4964318_4965455_+	acyltransferase	NA	A9YX16	Burkholderia_phage	28.0	2.6e-18
WP_042913512.1|4965514_4966603_+	acyltransferase	NA	A9YX16	Burkholderia_phage	29.4	1.3e-16
>prophage 1
NZ_CP015279	Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence	157126	431	64966	157126	protease,integrase,transposase	Mycobacterium_phage(60.0%)	60	3691:3706	52775:52790
WP_047323915.1|431_1484_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047323904.1|1498_2233_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156181225.1|2630_2807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323903.1|2809_3019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089150880.1|3203_3830_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
3691:3706	attL	GCCACCGCGTCCACCG	NA	NA	NA	NA
WP_074021058.1|4185_5220_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.8	4.7e-11
WP_136246050.1|5323_5959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167384288.1|5951_6296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323914.1|6433_6946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323898.1|7392_9345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323897.1|9600_11157_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_047323896.1|11344_11584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323895.1|11810_12590_+	SseB family protein	NA	NA	NA	NA	NA
WP_047323913.1|12787_13324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136246052.1|13480_13660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082147663.1|13881_14319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323893.1|14641_15463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082147662.1|15518_16139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047323891.1|16271_17300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323890.1|17913_18252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136246053.1|18265_18928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052955347.1|19118_19361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136246054.1|19828_21685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047323886.1|23661_24252_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_047323885.1|25539_26508_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	27.4	1.1e-06
WP_047323911.1|26504_27122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323884.1|27129_29028_-	hypothetical protein	NA	V5UNW4	Mycobacterium_phage	39.2	6.7e-112
WP_047323883.1|29032_29746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052955346.1|30286_31189_+	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_052955345.1|31325_32903_+	DUF4226 domain-containing protein	NA	V5UPX1	Mycobacterium_phage	42.7	2.0e-08
WP_133058051.1|32930_33236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323881.1|33309_33615_+	ESX-1 secretion-associated protein	NA	NA	NA	NA	NA
WP_047323880.1|33630_35337_+	PE family protein	NA	NA	NA	NA	NA
WP_047323879.1|35333_35675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047323878.1|36003_36288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052955344.1|36298_36736_-	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_158086686.1|36925_37549_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047323876.1|37545_38607_+	hypothetical protein	NA	A0A1P8D5M4	Corynebacterium_phage	32.1	1.3e-16
WP_047323907.1|38870_39923_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047324319.1|39947_41165_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_136246450.1|41389_42091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047324298.1|42105_42795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167384289.1|42800_42944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142274731.1|43029_43302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139315450.1|43971_46302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047324166.1|46821_47238_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_047324157.1|47243_47507_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_074021485.1|47754_48588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085081455.1|49190_49808_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_139315451.1|50016_50922_+	NlpC/P60 family protein	NA	A0A1W6DXV0	Rhodococcus_phage	39.1	8.9e-14
WP_082147687.1|50982_52524_+	type VII secretion protein EccB	NA	V5UN45	Mycobacterium_phage	34.5	1.3e-60
WP_047324159.1|52520_56732_+	type VII secretion protein EccCa	NA	V5UPA0	Mycobacterium_phage	27.3	1.0e-112
52775:52790	attR	CGGTGGACGCGGTGGC	NA	NA	NA	NA
WP_047324169.1|56828_57125_+	PE family protein	NA	NA	NA	NA	NA
WP_047324160.1|57149_58310_+	PPE family protein	NA	V5UPR1	Mycobacterium_phage	31.2	4.3e-05
WP_047324161.1|58451_58748_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_047324162.1|58791_59076_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_047324163.1|59157_60081_+	ESX secretion-associated protein EspG	NA	NA	NA	NA	NA
WP_047324164.1|60207_61716_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_082147688.1|61712_63230_+	type VII secretion integral membrane protein EccD	NA	NA	NA	NA	NA
WP_089150877.1|63400_64966_+|protease	type VII secretion-associated serine protease mycosin	protease	V5UPA7	Mycobacterium_phage	34.1	5.0e-65
