The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	990024	1042121	4914770	protease,transposase,tail,integrase,tRNA	Escherichia_phage(25.0%)	51	989841:989857	999187:999203
989841:989857	attL	TTAGTTCATGCCGTATT	NA	NA	NA	NA
WP_000829625.1|990024_991260_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.2	5.5e-123
WP_001439227.1|991554_991734_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000754198.1|991742_992024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024218759.1|992115_993696_+	virulence-associated E family protein	NA	A0A088FVF8	Escherichia_phage	66.0	1.3e-150
WP_024218758.1|993705_993930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024218757.1|993944_994262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101855.1|994696_995581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000270230.1|995583_995898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000892848.1|996148_996598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180156.1|996607_996814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897538.1|996835_999109_+|tail	phage tail tape measure protein	tail	D5LGY4	Escherichia_phage	65.3	6.2e-274
WP_000462905.1|999186_999483_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
999187:999203	attR	TTAGTTCATGCCGTATT	NA	NA	NA	NA
WP_001219652.1|999508_1000474_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_001145827.1|1000802_1001684_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001175728.1|1001695_1003147_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_000381170.1|1003136_1003379_-	YhdT family protein	NA	NA	NA	NA	NA
WP_000884622.1|1003487_1004837_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000354622.1|1004847_1005318_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001148478.1|1006295_1007270_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001241436.1|1007421_1009362_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|1009666_1010710_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_000802516.1|1010775_1011879_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000179409.1|1011878_1012367_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000203096.1|1012375_1012969_+	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000123197.1|1012958_1014428_+	ribonuclease G	NA	NA	NA	NA	NA
WP_001253561.1|1014495_1018296_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000055909.1|1018725_1020171_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_000440317.1|1020304_1021234_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000051841.1|1021416_1021620_+	AaeX family protein	NA	NA	NA	NA	NA
WP_000854033.1|1021627_1022560_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000510962.1|1022565_1024533_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_001029013.1|1024624_1024897_+	barnase inhibitor	NA	NA	NA	NA	NA
WP_000695690.1|1024952_1025216_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001257846.1|1025580_1026051_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_001297453.1|1026485_1027424_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000497723.1|1027486_1028554_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1028643_1030011_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_001295270.1|1030164_1030563_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001192307.1|1030756_1031884_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_000847559.1|1032102_1032531_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|1032546_1032939_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000257293.1|1033333_1033972_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000366129.1|1033977_1034475_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000467002.1|1034517_1035885_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000523844.1|1036264_1037056_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000224714.1|1037177_1038071_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108459.1|1038179_1039670_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|1039717_1040407_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209017.1|1040403_1041279_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979880.1|1041275_1041740_+	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000639208.1|1041815_1042121_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	1347665	1383547	4914770	protease,transposase	Stx2-converting_phage(63.64%)	23	NA	NA
WP_063073952.1|1347665_1348994_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000624722.1|1350522_1350873_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1350869_1351295_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_077793116.1|1351497_1351869_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_089180331.1|1351964_1356272_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.9	8.5e-131
WP_154813316.1|1357651_1358053_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557618.1|1357985_1358243_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_074151803.1|1358335_1358599_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089180173.1|1359177_1360407_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_089180174.1|1360390_1363738_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_089180175.1|1363891_1365463_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	8.4e-169
WP_089180176.1|1365482_1365830_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	7.0e-44
WP_089180177.1|1365829_1366477_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.2	7.7e-20
WP_061892120.1|1369134_1369482_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_089180332.1|1369478_1369859_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	90.5	1.1e-58
WP_077875792.1|1370298_1371954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519413.1|1372218_1372449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180178.1|1372919_1373435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180333.1|1373721_1378503_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.4	1.1e-152
WP_073519415.1|1378781_1379141_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	85.6	2.6e-49
WP_089180179.1|1380271_1380910_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073519417.1|1381246_1381480_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_089180180.1|1382385_1383547_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
>prophage 3
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	1430673	1488546	4914770	protease,transposase	Pectobacterium_phage(11.11%)	59	NA	NA
WP_000312488.1|1430673_1431933_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1431935_1432940_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1433021_1433219_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1433322_1434621_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|1434825_1435251_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076325.1|1435289_1437731_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	1.1e-66
WP_001293282.1|1437910_1438642_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|1438768_1439170_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|1439188_1439887_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012556.1|1439937_1440597_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547764.1|1440614_1441013_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101654.1|1441022_1441661_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943992.1|1441663_1442827_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	4.9e-81
WP_001339483.1|1442910_1444536_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1444652_1444928_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|1445076_1445406_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|1445587_1446337_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|1446333_1447089_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|1447196_1448261_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|1448615_1450013_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|1450028_1450334_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|1450343_1450808_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1450821_1451472_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|1451481_1452336_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|1452335_1453022_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|1453118_1453670_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|1453744_1454020_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1454346_1454742_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|1454748_1455063_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1455067_1455295_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|1455336_1455786_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|1455856_1456651_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|1457273_1457705_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|1457712_1458921_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|1459055_1459694_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|1459912_1460533_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228343.1|1460841_1462254_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|1462298_1462961_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|1463068_1464034_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|1464142_1465003_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|1465091_1465472_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089180182.1|1465600_1467544_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|1467733_1468474_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|1468463_1469021_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|1469345_1469552_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|1469613_1470957_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|1471279_1471918_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|1472123_1473857_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060936.1|1473853_1477633_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_089180183.1|1477635_1477977_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055072.1|1478356_1478887_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265912.1|1479196_1480153_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210559.1|1480292_1481795_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001351397.1|1481808_1482831_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|1482817_1483813_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1483845_1484844_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219795.1|1485019_1486393_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|1486548_1487100_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_000852988.1|1487193_1488546_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 4
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	1828506	1901644	4914770	transposase,protease,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_001346129.1|1828506_1829859_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|1829888_1832321_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|1832442_1832928_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|1832931_1833957_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1834061_1834517_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|1834520_1835309_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|1835308_1836457_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|1836453_1837050_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|1837086_1840569_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|1840581_1841541_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|1841639_1843781_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|1843837_1844227_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|1844291_1845590_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|1845638_1845899_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|1845885_1846086_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|1846251_1846797_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|1846793_1847216_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|1847229_1847940_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260712.1|1848971_1850690_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1850801_1851509_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1851505_1851910_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|1852027_1852843_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1852882_1853536_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|1853528_1854560_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|1854747_1855320_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997037.1|1861069_1861873_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_000648576.1|1861869_1862784_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1863024_1863825_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211727.1|1863902_1864673_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157719141.1|1864720_1865956_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.3e-09
WP_001052720.1|1866161_1866917_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|1866950_1867673_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1867669_1868137_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1868201_1868933_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|1869468_1870254_+	aminopeptidase	NA	NA	NA	NA	NA
WP_047621342.1|1870390_1870870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|1870879_1871794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|1871837_1872320_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087754.1|1872343_1873696_-	membrane protein	NA	NA	NA	NA	NA
WP_122986620.1|1873706_1877141_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|1877249_1878662_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|1878666_1879410_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614399.1|1879406_1882172_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343302.1|1882180_1882942_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|1882946_1884278_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1884280_1884805_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|1884801_1886082_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|1886106_1887189_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393854.1|1887152_1889003_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|1889006_1889420_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|1889426_1890902_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1890952_1891177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022852.1|1891211_1891712_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1892410_1892929_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103304.1|1893138_1895280_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_000508713.1|1895355_1899849_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_000786991.1|1899850_1900108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047621055.1|1900507_1901644_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	3052900	3111776	4914770	lysis,tail,integrase,tRNA,terminase	Escherichia_phage(43.14%)	66	3047284:3047300	3088358:3088374
3047284:3047300	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_089180337.1|3052900_3054133_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|3054387_3055371_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|3055645_3055819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123738.1|3055848_3057222_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|3057350_3058286_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040858.1|3058337_3059573_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|3059574_3059790_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_021565074.1|3059868_3060078_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
WP_001317028.1|3060070_3060265_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_089180219.1|3060321_3061131_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	1.2e-105
WP_047667559.1|3061123_3063724_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	8.8e-248
WP_089180220.1|3063825_3064101_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	1.5e-41
WP_001352098.1|3064175_3064346_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|3064345_3064567_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|3065008_3065497_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001610067.1|3065493_3065649_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_000233809.1|3065659_3065794_-	phage protein	NA	NA	NA	NA	NA
WP_000948459.1|3066102_3066579_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|3066702_3066999_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|3067021_3067444_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899746.1|3067456_3068314_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788972.1|3068320_3069067_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_076796008.1|3069866_3070289_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	4.8e-63
WP_000228824.1|3070472_3071600_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|3071592_3072702_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_076796010.1|3072698_3073676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021554378.1|3074304_3074460_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	89.6	1.3e-13
WP_000940319.1|3074923_3075523_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|3075522_3075813_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|3075809_3076352_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_061359043.1|3077395_3077824_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|3077995_3078370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|3078620_3078836_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|3078835_3079333_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228696.1|3079549_3079735_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001703139.1|3079931_3081389_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_016245936.1|3081526_3082321_+	phage protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_001204033.1|3082313_3083246_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_000126788.1|3083223_3083433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089446.1|3083436_3084531_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000625347.1|3084511_3085813_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763709.1|3085815_3087222_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_089180221.1|3087205_3088318_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.3	6.0e-113
WP_000770042.1|3088422_3089187_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
3088358:3088374	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|3089285_3090425_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|3090647_3091043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|3091042_3091426_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|3091426_3091807_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|3091803_3092196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029488565.1|3092222_3093185_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	2.6e-56
WP_012565075.1|3093335_3093695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|3093802_3094003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001703076.1|3094168_3097402_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	1.3e-104
WP_000024051.1|3097394_3097733_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152422.1|3097732_3098431_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
WP_001379783.1|3098436_3099180_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
WP_000090944.1|3099116_3099725_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	7.6e-102
WP_089180222.1|3099785_3103199_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.2	0.0e+00
WP_001230375.1|3103268_3103868_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_072686566.1|3103932_3107295_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|3107294_3107870_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|3107967_3108558_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|3108874_3109108_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_157719144.1|3109176_3109290_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	4.2e-06
WP_001082294.1|3110067_3110502_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|3110642_3111776_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 6
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	3709774	3753656	4914770	portal,capsid,terminase,holin,tail,integrase,head,plate	Escherichia_phage(20.0%)	60	3709350:3709409	3753726:3753802
3709350:3709409	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_047620999.1|3709774_3710785_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_047621001.1|3710790_3711834_-	phage late control protein	NA	R9TNM7	Vibrio_phage	29.3	7.5e-33
WP_047621003.1|3711837_3712050_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|3712066_3712309_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_047621042.1|3712287_3712677_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	40.3	5.3e-16
WP_047621005.1|3712712_3714353_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
WP_000444666.1|3714461_3714743_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039264464.1|3714755_3715268_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_047621009.1|3715285_3716779_-|tail	tail sheath protein	tail	K4HZC3	Acidithiobacillus_phage	37.0	5.0e-70
WP_001559300.1|3716784_3717018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264466.1|3717969_3718596_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.5	3.1e-26
WP_039264467.1|3718598_3719519_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
WP_047621011.1|3719515_3719857_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.8e-20
WP_039264469.1|3719859_3720762_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_039264470.1|3720742_3721279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264472.1|3721275_3721956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264473.1|3721987_3722368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264474.1|3722364_3722772_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_039264475.1|3722802_3723837_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.4	9.2e-108
WP_000206291.1|3723898_3724228_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|3724227_3725538_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_047621016.1|3725537_3727109_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.3	1.6e-188
WP_012565126.1|3727105_3727339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|3727335_3729201_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|3729187_3729754_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|3730126_3730372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264476.1|3730688_3730982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071791986.1|3730978_3731257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131874.1|3731597_3732077_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
WP_039264477.1|3732063_3732348_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.0e-08
WP_001294589.1|3732347_3732731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264478.1|3732843_3733515_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.4	7.8e-15
WP_000717782.1|3733514_3733808_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_039264479.1|3733804_3734401_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	1.4e-71
WP_001025459.1|3734478_3734658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047621045.1|3734809_3735451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001559328.1|3735569_3735848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|3736415_3736904_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_039264480.1|3736913_3737519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048963140.1|3737628_3738033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560857.1|3738353_3739019_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021560858.1|3739223_3739421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028985353.1|3740047_3740971_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_047621022.1|3741148_3741943_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	73.1	7.0e-47
WP_000466604.1|3742215_3742437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002789.1|3742624_3742849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192614.1|3743078_3743480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067617.1|3743518_3744910_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	46.5	1.9e-103
WP_000088681.1|3744906_3745971_-	hypothetical protein	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_000943913.1|3745973_3746198_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_047621025.1|3746237_3746714_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	8.5e-24
WP_000846364.1|3746773_3746971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184914.1|3747045_3747453_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	68.1	9.1e-43
WP_000423305.1|3747632_3747857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000388259.1|3748887_3749208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047621027.1|3749238_3751455_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.2	6.2e-101
WP_047621030.1|3751451_3752021_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.7	3.0e-36
WP_000916333.1|3752020_3752203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001559348.1|3752412_3752628_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	67.6	1.0e-21
WP_028985344.1|3752627_3753656_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.4	5.6e-97
3753726:3753802	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 7
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	3921604	3931046	4914770		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|3921604_3922741_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_089180251.1|3922737_3924738_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3924862_3925324_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3925364_3925835_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3925881_3926601_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3926597_3928283_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3928504_3929236_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3929295_3929403_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3929383_3930115_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_032326746.1|3930119_3931046_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
>prophage 8
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	4118387	4206721	4914770	portal,protease,holin,transposase,lysis,coat,tail,integrase,tRNA,terminase	Enterobacteria_phage(46.15%)	103	4162200:4162218	4213581:4213599
WP_000156113.1|4118387_4119290_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|4119486_4120260_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|4120267_4120984_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|4120980_4121667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000737621.1|4121756_4122539_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748261.1|4122759_4123542_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|4123807_4124377_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|4124471_4125989_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|4126025_4126514_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000157015.1|4126772_4127435_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584575.1|4127424_4128693_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|4128762_4129677_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364331.1|4129832_4130492_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283581.1|4130574_4131387_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4131386_4132400_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|4132465_4133602_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615821.1|4133700_4134696_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|4134692_4135871_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|4136163_4137384_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683808.1|4137542_4139549_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4139669_4139948_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|4139981_4140530_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|4140529_4141339_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|4141338_4142163_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4142166_4143252_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|4143286_4144219_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4144384_4144936_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_089180257.1|4145057_4145915_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|4145916_4146441_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|4146437_4146908_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000678664.1|4146904_4147411_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|4147427_4148180_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_039022507.1|4148199_4150842_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|4150923_4151487_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4152161_4152647_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425062.1|4152849_4154994_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|4154993_4156304_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|4156483_4156768_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4157139_4158480_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937836.1|4158846_4159905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4160086_4160842_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4161135_4162068_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4162200:4162218	attL	ATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_089180258.1|4162379_4163537_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.4e-221
WP_089180259.1|4163691_4165647_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	31.1	1.8e-67
WP_089180260.1|4165695_4167852_-|tail	phage tail protein	tail	Q9AYY6	Salmonella_phage	67.4	2.0e-59
WP_089180261.1|4167987_4168248_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	1.4e-36
WP_089180262.1|4168337_4170335_-	DNA transfer protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_089180263.1|4170334_4171723_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	64.7	4.5e-150
WP_089180264.1|4171732_4172425_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	98.3	1.2e-108
WP_089180265.1|4172427_4172883_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	2.0e-86
WP_052906986.1|4172882_4173731_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.9	7.3e-103
WP_052906985.1|4173730_4175149_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	6.0e-275
WP_023486190.1|4175149_4175650_-	DNA stabilization, phage-associated	NA	G8EYJ2	Enterobacteria_phage	97.6	4.6e-89
WP_062870091.1|4175627_4175882_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	94.3	2.4e-25
WP_089180266.1|4175925_4177221_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
WP_029403254.1|4177294_4177810_+	HNH endonuclease	NA	A0A291AXK2	Shigella_phage	39.5	4.1e-24
WP_044066501.1|4177810_4178722_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	8.3e-161
WP_089180267.1|4178735_4180901_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.8	0.0e+00
WP_032153675.1|4180901_4182401_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.8	1.1e-306
WP_000729920.1|4182378_4182867_-	hypothetical protein	NA	G8EYI7	Enterobacteria_phage	100.0	1.4e-90
WP_089180268.1|4182946_4183189_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_001535929.1|4183292_4183649_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	3.6e-43
WP_032178584.1|4183836_4184367_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	94.9	7.6e-90
WP_089180269.1|4184572_4184725_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	96.0	8.1e-21
WP_089180270.1|4184712_4185150_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	96.6	2.5e-70
WP_089180271.1|4185146_4185623_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	2.9e-88
WP_000783734.1|4185606_4185930_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235459.1|4186363_4186987_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_089180272.1|4186983_4187649_-	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.2	1.6e-129
WP_000144614.1|4187626_4187833_-	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_032217731.1|4187829_4188441_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	98.5	1.8e-98
WP_089180273.1|4188433_4188643_-	protein ninF	NA	G9L691	Escherichia_phage	95.6	1.0e-29
WP_000924601.1|4188602_4189004_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_000113772.1|4189006_4189183_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_023157010.1|4189319_4189910_-	MT-A70 protein	NA	A0A193GYV6	Enterobacter_phage	76.0	2.8e-85
WP_032217729.1|4189906_4190347_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	98.6	1.5e-78
WP_032217726.1|4190560_4190887_-	hypothetical protein	NA	I6RSP8	Salmonella_phage	98.1	3.6e-58
WP_157719151.1|4190962_4192399_-	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.4	1.5e-273
WP_089180275.1|4192388_4193279_-	DNA replication protein	NA	K7PH45	Enterobacterial_phage	98.3	4.2e-157
WP_000424164.1|4193461_4193740_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_000620665.1|4193848_4194043_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|4194149_4194866_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_089180276.1|4194885_4195254_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	96.7	8.5e-56
WP_089180277.1|4195621_4195921_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	90.9	4.5e-31
WP_042098811.1|4195929_4196253_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	97.2	7.2e-59
WP_000333101.1|4196424_4196625_+	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	100.0	2.8e-29
WP_089180278.1|4196759_4197728_+	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	97.2	8.5e-55
WP_000638547.1|4197752_4197884_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|4197868_4198021_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031370.1|4198277_4198883_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_089180279.1|4198882_4199266_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	9.4e-66
WP_089180280.1|4199289_4199586_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	98.0	3.3e-50
WP_001214456.1|4199596_4199761_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_089180281.1|4199781_4200189_+	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	86.2	1.1e-59
WP_089180282.1|4200897_4201089_+	hypothetical protein	NA	G9L660	Escherichia_phage	96.8	4.7e-26
WP_089180283.1|4201091_4201478_+	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	84.3	1.2e-41
WP_089180285.1|4201752_4201983_+	hypothetical protein	NA	A0A193GYL4	Enterobacter_phage	97.3	9.1e-32
WP_000545733.1|4202084_4202252_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001163428.1|4202310_4202511_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001402373.1|4202759_4203935_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	2.4e-144
WP_000287253.1|4203914_4204865_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|4204886_4205768_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000783295.1|4206448_4206721_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
4213581:4213599	attR	ATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 9
NZ_CP022393	Escherichia coli strain E62 chromosome, complete genome	4914770	4428043	4472880	4914770	holin,tail,integrase,tRNA,head,terminase	Salmonella_phage(52.17%)	56	NA	NA
WP_001295367.1|4428043_4428580_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|4428604_4429240_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|4429448_4430297_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089180291.1|4430934_4431582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087908.1|4431876_4432422_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_089180292.1|4432432_4433005_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	83.0	3.1e-89
WP_089180293.1|4433013_4433916_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.6	1.7e-97
WP_089180294.1|4433912_4435010_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	6.7e-64
WP_089180295.1|4435009_4435690_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	80.1	2.6e-106
WP_089180296.1|4435686_4436886_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.4	6.4e-185
WP_001270637.1|4436885_4437239_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	6.9e-55
WP_089180297.1|4437238_4437991_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	65.9	4.5e-88
WP_000466689.1|4438050_4438290_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	47.5	5.6e-08
WP_001214054.1|4438343_4438685_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.7	1.4e-33
WP_089180298.1|4438688_4439750_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.3	1.3e-157
WP_000155113.1|4439752_4440055_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	4.1e-48
WP_089180299.1|4440054_4440642_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_089180300.1|4440641_4442630_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.6	2.5e-271
WP_032314228.1|4442807_4443260_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	73.3	2.7e-56
WP_000109249.1|4443263_4443704_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_069906252.1|4443714_4444860_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	3.6e-161
WP_000503647.1|4444863_4445427_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_001142480.1|4445401_4445791_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_047655278.1|4445777_4446332_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	3.7e-79
WP_024192968.1|4446328_4446736_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	1.5e-69
WP_001533349.1|4446701_4447070_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	88.5	2.3e-53
WP_069906249.1|4447110_4448052_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.8e-155
WP_024246479.1|4448063_4448570_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	2.9e-70
WP_042093526.1|4448573_4449794_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.8	3.6e-204
WP_089180301.1|4449808_4450543_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	2.5e-99
WP_000113489.1|4450433_4451900_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_089180302.1|4451899_4453522_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	95.2	0.0e+00
WP_016233452.1|4453524_4454097_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_016233453.1|4454158_4454683_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	1.5e-42
WP_089180303.1|4454666_4455143_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	93.7	3.3e-84
WP_000781777.1|4455146_4455488_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	7.3e-54
WP_001174014.1|4455933_4456275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180304.1|4456306_4456729_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	4.0e-41
WP_089180305.1|4457009_4459202_-	replication protein	NA	B6SCY1	Bacteriophage	72.1	1.9e-174
WP_000170998.1|4459205_4459418_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_000049986.1|4459538_4460162_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_089180306.1|4460942_4461851_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.2e-07
WP_089180307.1|4461853_4463155_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	8.8e-132
WP_000769011.1|4463170_4463719_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001298623.1|4463770_4464409_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000490741.1|4464476_4464746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180308.1|4464802_4466866_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.7	2.5e-274
WP_000216034.1|4466871_4467075_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000008824.1|4467080_4467302_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089180309.1|4467291_4467774_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.3	9.7e-68
WP_000312949.1|4467773_4468067_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	69.4	7.8e-28
WP_085961393.1|4468036_4469068_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000212683.1|4469064_4469385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180310.1|4469419_4470814_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.5	8.1e-216
WP_001138335.1|4471007_4472405_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|4472619_4472880_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
