The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	254964	262915	5365433		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|254964_255249_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|255287_256922_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_168411617.1|257325_258867_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_000833096.1|259253_260579_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929891.1|260724_261426_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_089170300.1|261409_262915_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.5e-31
>prophage 2
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	306806	315182	5365433		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|306806_308114_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|308202_308922_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|308914_309169_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666784.1|309165_309849_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_089170309.1|309832_312052_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.1e-163
WP_000879026.1|312036_313452_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262442.1|313557_314598_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088577.1|314594_315182_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.6e-27
>prophage 3
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	1857001	1865820	5365433		Bacillus_phage(71.43%)	8	NA	NA
WP_089170826.1|1857001_1858288_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.6	3.8e-10
WP_023521720.1|1858387_1859152_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_089170827.1|1859392_1861153_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.6	6.3e-274
WP_000612415.1|1861238_1861916_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_157676066.1|1861912_1862986_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	96.4	1.4e-183
WP_000818985.1|1863275_1863995_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_089172102.1|1864142_1864814_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	90.5	1.3e-62
WP_001258527.1|1864947_1865820_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 4
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	2506271	2578151	5365433	capsid,bacteriocin,head,tail,terminase,integrase,holin,protease,portal	Bacillus_phage(63.04%)	85	2517480:2517499	2583563:2583582
WP_048564718.1|2506271_2506601_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002041181.1|2507084_2507570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171088.1|2507881_2508583_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_089171089.1|2508621_2509731_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.4	8.3e-147
WP_089171090.1|2510276_2511428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000720921.1|2511465_2511612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033695148.1|2511698_2511896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171091.1|2511933_2512287_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	86.2	3.7e-48
WP_000854271.1|2512487_2512679_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	8.3e-23
WP_089171092.1|2512734_2513001_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	92.9	4.1e-36
WP_000390287.1|2513000_2513165_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	70.4	7.2e-15
WP_089171093.1|2513223_2514279_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	42.0	1.5e-57
WP_089171094.1|2514282_2514561_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	3.5e-14
WP_089171095.1|2514553_2514913_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	51.7	2.4e-31
WP_089171096.1|2514931_2515099_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	66.0	2.3e-13
WP_089171097.1|2515129_2515381_+	helix-turn-helix domain containing protein	NA	A0A0K2CNP4	Brevibacillus_phage	40.6	1.9e-06
WP_089171098.1|2515400_2515856_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.1	1.3e-21
WP_089171099.1|2516468_2517002_+	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	51.7	4.2e-48
WP_089172118.1|2517028_2517349_+	hypothetical protein	NA	NA	NA	NA	NA
2517480:2517499	attL	TTAACAAAATCGTTATTTGA	NA	NA	NA	NA
WP_089171100.1|2517555_2518023_-	epimerase	NA	NA	NA	NA	NA
WP_089171101.1|2518149_2518368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171102.1|2518530_2518758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171103.1|2518726_2518888_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	71.7	2.8e-19
WP_089171104.1|2519434_2520208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025709552.1|2521128_2521398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089172119.1|2521446_2521545_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_089171105.1|2521565_2521754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171106.1|2521852_2522023_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	73.2	5.1e-08
WP_063547394.1|2522049_2522532_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	81.9	7.9e-70
WP_053564381.1|2522531_2523074_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	89.4	3.1e-86
WP_053564380.1|2523287_2524238_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_016081850.1|2525047_2526217_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.6	6.1e-23
WP_000930971.1|2526559_2526778_+	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	3.1e-21
WP_000366404.1|2527149_2527425_+	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	73.6	1.5e-33
WP_000333210.1|2527881_2528049_+	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	67.3	8.1e-14
WP_087967795.1|2528041_2528263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171107.1|2528276_2528690_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	54.1	6.2e-31
WP_089171108.1|2528670_2529012_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.8	1.4e-52
WP_000124842.1|2529164_2529500_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_000615659.1|2529496_2531155_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.2	2.3e-257
WP_089172120.1|2531220_2532327_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.6	9.0e-186
WP_089171109.1|2532310_2533093_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	61.4	4.2e-60
WP_089171110.1|2533096_2534251_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.4	4.7e-201
WP_029442425.1|2534256_2534550_+	hypothetical protein	NA	D2XR19	Bacillus_phage	91.8	3.5e-44
WP_089171111.1|2534551_2534905_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	1.7e-58
WP_050843028.1|2534906_2535251_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	93.8	3.1e-52
WP_071730276.1|2535247_2535577_+	hypothetical protein	NA	D2XR22	Bacillus_phage	95.4	1.2e-53
WP_089171112.1|2535577_2536174_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	99.0	2.6e-110
WP_016124652.1|2536178_2536541_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	85.0	1.3e-53
WP_071730280.1|2536771_2538235_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.6	2.3e-189
WP_089171113.1|2538452_2540606_+|tail	phage tail tape measure protein	tail	A0A2H4JC82	uncultured_Caudovirales_phage	83.6	1.9e-102
WP_089171114.1|2540647_2542105_+|tail	phage tail family protein	tail	A0A1B1P7W7	Bacillus_phage	54.8	5.8e-156
WP_089171115.1|2542101_2546442_+|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	43.1	7.7e-297
WP_000429937.1|2546457_2546787_+	hypothetical protein	NA	A0A2H4JGF7	uncultured_Caudovirales_phage	51.7	8.4e-23
WP_000390479.1|2546916_2547141_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
WP_089171116.1|2547216_2547642_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	8.3e-71
WP_089171117.1|2547641_2548451_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.7	5.3e-151
WP_089171118.1|2548648_2549155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089171119.1|2549608_2550340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089171121.1|2551156_2552047_+	bclA protein	NA	NA	NA	NA	NA
WP_157676091.1|2552337_2554020_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_048535392.1|2554226_2554991_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_089171123.1|2555135_2555552_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_086395992.1|2555672_2555876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171124.1|2556205_2556418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089171125.1|2556627_2557632_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282680.1|2557777_2558182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171126.1|2558341_2559577_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106403.1|2559844_2561128_+	MFS transporter	NA	NA	NA	NA	NA
WP_089171127.1|2561117_2561750_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	42.4	3.5e-25
WP_000046095.1|2561819_2561975_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2562077_2562575_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168009.1|2562715_2563930_+	cytochrome P450	NA	NA	NA	NA	NA
WP_089171128.1|2564041_2564620_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_089171129.1|2564795_2565647_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_157676092.1|2566069_2567857_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_089171130.1|2568091_2570218_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_089171131.1|2570657_2571845_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.1	8.9e-06
WP_089171132.1|2571935_2572616_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_089171133.1|2573024_2573573_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_089171134.1|2573583_2575284_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.5	1.8e-15
WP_089171135.1|2575276_2576077_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2576213_2576321_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_016081432.1|2576413_2577682_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_089171136.1|2577818_2578151_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	43.7	2.2e-15
2583563:2583582	attR	TTAACAAAATCGTTATTTGA	NA	NA	NA	NA
>prophage 5
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	2585263	2590487	5365433		Bacillus_phage(50.0%)	9	NA	NA
WP_001139345.1|2585263_2585479_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_114556335.1|2585715_2585847_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	76.7	1.1e-10
WP_000097509.1|2586211_2587012_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_089171140.1|2587031_2587244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089172124.1|2587308_2587509_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	86.4	9.7e-14
WP_089171141.1|2587646_2588528_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_089171142.1|2588655_2589171_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.4	4.6e-15
WP_016081420.1|2589269_2589800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089171143.1|2589812_2590487_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	6.2e-28
>prophage 6
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	3634125	3644297	5365433	bacteriocin	Bacillus_phage(50.0%)	13	NA	NA
WP_000413738.1|3634125_3634746_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_089171624.1|3634837_3635641_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031386.1|3635641_3636184_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3636176_3636500_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392443.1|3636864_3637095_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_063548393.1|3637156_3638059_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	48.4	4.0e-75
WP_089171625.1|3638347_3639169_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.1	6.4e-27
WP_089171626.1|3639310_3640282_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	39.9	1.4e-33
WP_000464425.1|3640520_3640907_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_089171627.1|3641025_3641913_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	68.2	5.3e-96
WP_001189064.1|3642061_3642256_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_089171628.1|3643222_3643435_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000708856.1|3643637_3644297_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 7
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	4432005	4439689	5365433		Staphylococcus_phage(16.67%)	10	NA	NA
WP_088024405.1|4432005_4432929_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_061660443.1|4433054_4433990_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	3.1e-22
WP_075719095.1|4433991_4434684_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	27.9	2.3e-06
WP_001293578.1|4434852_4435026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4435026_4435221_+	YwbE family protein	NA	NA	NA	NA	NA
WP_053563583.1|4435259_4436459_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	3.6e-71
WP_000587818.1|4436752_4437076_+	heme oxygenase	NA	NA	NA	NA	NA
WP_071731437.1|4437148_4437913_-	class B sortase	NA	NA	NA	NA	NA
WP_069356275.1|4437945_4438716_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	7.6e-14
WP_001036841.1|4438705_4439689_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	4.2e-17
>prophage 8
NZ_CP017060	Bacillus cereus strain FORC_047 chromosome, complete genome	5365433	4832551	4874358	5365433	coat,protease	Prochlorococcus_phage(16.67%)	52	NA	NA
WP_065229511.1|4832551_4833229_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_157676151.1|4833327_4834122_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|4834174_4834483_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|4834678_4834915_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|4835110_4835326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088025375.1|4835387_4836389_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665102.1|4836509_4837001_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.5	4.6e-41
WP_088025373.1|4837024_4837504_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_089171927.1|4837666_4838770_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_089171928.1|4838714_4840061_+	phosphoribosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_089171929.1|4840066_4841179_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_157676153.1|4841175_4841991_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_089171930.1|4842546_4843128_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276470.1|4843256_4844021_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_089171931.1|4844128_4844761_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274010.1|4844841_4845282_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|4845429_4846401_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392611.1|4846417_4846684_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_089171932.1|4847057_4847555_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_089171933.1|4847600_4847918_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_089171934.1|4848033_4848612_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_089171935.1|4848646_4849381_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016079840.1|4849481_4850297_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_089171936.1|4850322_4850754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088022016.1|4850887_4851442_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272751.1|4851516_4851996_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166367.1|4852016_4852913_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944681.1|4853102_4854086_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_089171937.1|4854159_4854891_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_089171938.1|4854945_4855248_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_078401288.1|4855313_4856705_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001118824.1|4857254_4858652_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|4858700_4859132_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020767.1|4859121_4860342_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
WP_089171939.1|4860341_4861634_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929163.1|4861649_4862435_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.1	7.0e-07
WP_000722399.1|4862673_4863480_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000735081.1|4863553_4864366_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|4864389_4865055_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000601791.1|4865047_4866073_-	methionine ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_001242140.1|4866484_4866829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002025020.1|4866981_4867290_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640870.1|4867293_4867638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026896.1|4868150_4868534_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218968.1|4868575_4868941_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000826910.1|4869435_4869963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713772.1|4870107_4870755_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666168.1|4870820_4871834_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_157676198.1|4871856_4873014_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001002981.1|4873053_4873302_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001180555.1|4873315_4873501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089171941.1|4873644_4874358_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP018741	Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence	257708	24331	89606	257708	transposase,integrase	Bacillus_phage(40.0%)	57	18160:18175	42740:42755
18160:18175	attL	CTACTTTTCATAAGAA	NA	NA	NA	NA
WP_089172181.1|24331_25492_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_089172182.1|25720_25969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065706020.1|26688_27618_-	glutaminase A	NA	NA	NA	NA	NA
WP_153218640.1|27787_29245_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_089172183.1|29512_30838_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_089172184.1|31879_33385_+	spore germination protein	NA	NA	NA	NA	NA
WP_089172185.1|33374_34478_+	endospore germination permease	NA	NA	NA	NA	NA
WP_089172186.1|34474_35602_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_065705655.1|35841_37272_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081306186.1|37396_37759_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065705692.1|37770_38673_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_154698409.1|40023_40197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086422586.1|42564_43329_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
42740:42755	attR	CTACTTTTCATAAGAA	NA	NA	NA	NA
WP_089172187.1|43348_43969_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_050845109.1|44808_45084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016083336.1|45432_46617_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_089172188.1|47028_47685_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	33.3	9.9e-15
WP_089172189.1|49539_50661_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.0	1.8e-173
WP_089172190.1|50929_52108_-	MFS transporter	NA	NA	NA	NA	NA
WP_089172191.1|52171_52819_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_016083330.1|52880_53561_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089172192.1|54232_55987_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_089172193.1|56004_56835_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_157676200.1|56824_57358_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	27.8	5.8e-05
WP_089172195.1|58412_59156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089172196.1|59188_61159_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000398180.1|61133_61922_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.4	8.2e-32
WP_089172197.1|62046_63033_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_089172198.1|63032_63737_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_089172199.1|64544_66677_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_000022547.1|67366_67795_+	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
WP_089172200.1|68226_69873_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089172201.1|69975_71229_+	MFS transporter	NA	NA	NA	NA	NA
WP_089172202.1|71321_72476_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_078214455.1|72694_73267_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_078214456.1|73454_73838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089172204.1|74828_75260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002169911.1|75256_75463_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	44.6	2.2e-05
WP_089172205.1|76105_76411_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089172206.1|76407_76863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050845500.1|76899_77097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089172207.1|77576_77927_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_089172208.1|78043_79474_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_050822787.1|79688_79994_+	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_089172209.1|80137_80332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089172210.1|80697_81120_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001995951.1|81245_81815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089172211.1|82123_83038_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_089172212.1|83592_84432_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_089172213.1|84533_84869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086401219.1|84904_85093_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_089172214.1|85120_85456_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089172215.1|86169_86433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002204218.1|86459_86648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172805528.1|86763_86916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016083347.1|87285_87729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089172216.1|88175_89606_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018741	Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence	257708	149090	179702	257708	transposase	Bacillus_phage(33.33%)	24	NA	NA
WP_000762752.1|149090_149489_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_089172245.1|151463_151859_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000167466.1|152172_153078_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_089172246.1|153223_154198_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_089172247.1|154612_154843_-	transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	43.2	2.1e-12
WP_000762752.1|155630_156029_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_089172245.1|158003_158399_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_000167466.1|158712_159618_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_089172246.1|159763_160738_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_089172247.1|161152_161383_-	transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	43.2	2.1e-12
WP_000762752.1|162170_162569_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_172805530.1|163958_165389_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	9.1e-21
WP_089172249.1|165435_166101_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.9e-35
WP_172805529.1|166264_166441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089172250.1|167039_168248_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.5	1.8e-25
WP_065705980.1|168724_170152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_086422647.1|170163_170850_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	1.4e-24
WP_016083288.1|171003_171276_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	61.1	7.0e-23
WP_089172306.1|172191_173805_+	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	53.7	2.8e-42
WP_089172252.1|174567_175518_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.4	8.3e-55
WP_089172253.1|177120_177453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089172254.1|177498_177885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033700006.1|177902_178097_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089172255.1|178271_179702_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
