The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	329036	337272	3832354		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|329036_330089_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|330245_331169_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_058907684.1|331286_332399_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|332479_333382_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|333485_333803_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000867.1|333932_334928_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_049842162.1|334924_335872_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|335898_337272_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 2
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	417188	548156	3832354	tail,transposase,head,capsid,portal,terminase,integrase	Acidithiobacillus_phage(48.21%)	122	483912:483971	527610:527747
WP_087451330.1|417188_417653_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	66.9	3.8e-53
WP_089190373.1|417783_420072_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	62.8	1.0e-284
WP_089190374.1|420068_420329_-	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	1.4e-17
WP_089190375.1|420325_421063_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	8.3e-111
WP_028861144.1|421062_421539_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.0	8.7e-53
WP_089190376.1|421546_422188_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	71.8	4.3e-79
WP_089190377.1|422184_423045_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	71.8	5.9e-108
WP_028852742.1|423041_423524_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.7	5.2e-45
WP_089190378.1|423534_423798_-	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_089190379.1|424026_424488_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	61.4	8.4e-45
WP_089190380.1|424537_426775_+	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.3	4.7e-290
WP_023470373.1|427531_428515_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	27.7	5.1e-15
WP_151903960.1|428524_429709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|429664_430630_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_089190381.1|430572_432186_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_080672999.1|432337_432556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190382.1|432555_433005_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	70.9	7.4e-54
WP_089190383.1|433001_434390_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.5	1.7e-218
WP_089190384.1|434386_434761_+	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	62.2	1.5e-39
WP_089190385.1|434757_435231_+	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	52.9	4.6e-38
WP_081350369.1|435385_436261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161495323.1|436826_437759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139180426.1|438312_438804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071014711.1|438800_439553_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_058908416.1|440402_440816_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_139274304.1|440967_441795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908414.1|441938_443060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908413.1|443103_443499_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_089190825.1|443495_444794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080606430.1|446196_446568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723824.1|447839_448775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028861530.1|448924_450061_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_016723821.1|450071_450581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190386.1|450577_452788_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	39.8	9.5e-102
WP_071615437.1|452872_453610_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_071615436.1|453606_454485_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_016724187.1|455232_455790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908407.1|455967_456738_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_058908425.1|456664_457441_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_063612208.1|457461_458115_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_160329290.1|458221_458497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724183.1|459185_459566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908405.1|459820_460963_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071615435.1|460997_461336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020831502.1|461944_463273_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_089190387.1|463269_463590_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_058908403.1|463637_463934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190388.1|464001_464463_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.6	3.0e-66
WP_020832987.1|464459_464936_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	85.9	1.4e-71
WP_003270772.1|464932_465223_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.6	3.1e-13
WP_089190389.1|465290_465515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190826.1|465524_466061_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	51.4	6.1e-47
WP_058908398.1|467372_467771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190390.1|467767_468250_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_089190391.1|468253_469420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190392.1|473021_473417_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	9.2e-32
WP_089190393.1|473422_477526_-|tail	phage tail tape measure protein	tail	V9QL83	Rhizobium_phage	36.2	3.9e-24
WP_071895622.1|477590_478718_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.6	9.1e-101
WP_016723619.1|479268_480234_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_089190394.1|482662_483307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938671.1|483281_483503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190395.1|483499_483895_-	hypothetical protein	NA	NA	NA	NA	NA
483912:483971	attL	GCACGATTATGTGGAGTGGACGGTTATGCATAGTTGGGTTCCTTTCACGTTGAGATTGCA	NA	NA	NA	NA
WP_028854752.1|484049_485069_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	31.9	4.2e-12
WP_161495324.1|485065_485344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161495325.1|485355_485970_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081365215.1|485963_487211_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K7N4	Mycobacterium_phage	27.6	2.2e-15
WP_089190397.1|487355_488141_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.2	5.3e-47
WP_016727774.1|488266_488713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190398.1|488718_488973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003443.1|489062_490394_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_016721870.1|490563_491550_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_081366778.1|492589_493030_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_071508016.1|493062_494445_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	58.9	1.3e-133
WP_064049488.1|494441_494939_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	4.5e-20
WP_071654077.1|495518_496952_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071508017.1|496975_498742_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071653941.1|498820_499639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081365362.1|510765_511713_+	HrgA protein	NA	NA	NA	NA	NA
WP_071624179.1|512165_512504_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_155772883.1|512574_512946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072633620.1|512965_513910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507983.1|514966_515206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049800424.1|515922_516639_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_071624182.1|517313_517529_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_071615547.1|517925_518141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049800423.1|519123_519999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019717749.1|520273_520525_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_016727753.1|520521_520935_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_020425162.1|521006_522029_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	58.0	1.2e-104
WP_089190399.1|522651_522939_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_089190400.1|522981_523626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190401.1|523600_523822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190402.1|523818_524208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081365215.1|524368_525616_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142K7N4	Mycobacterium_phage	27.6	2.2e-15
WP_081365216.1|525612_526515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1A0S4	Gordonia_phage	30.1	1.5e-05
WP_028854752.1|526511_527531_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	31.9	4.2e-12
WP_089190403.1|527669_528455_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.8	4.0e-47
527610:527747	attR	TGCAATCTCAACGTGAAAGGAACCCAACTATGCATAACCGTCCACTCCACATAATCGTGCTTATGCCGTCAACGGCATAAGCACGATGCGGCCGAACTGGCCGAGCACCGCGTCGAACGGCTTGGTCGGATCCGCCAG	NA	NA	NA	NA
WP_089190404.1|528577_529024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190405.1|529029_529332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190406.1|529334_530339_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.9	3.3e-110
WP_058908383.1|530345_530723_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.8	1.8e-24
WP_089190407.1|530732_531992_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.7	7.1e-62
WP_089190408.1|532001_533540_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.9	9.1e-152
WP_016725356.1|533539_533761_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_089190409.1|533761_534154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190410.1|534164_534674_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	45.0	3.7e-25
WP_089190411.1|534717_536700_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_089190412.1|536699_537236_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	80.9	2.2e-73
WP_089190413.1|537333_537594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190414.1|537700_538216_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	68.7	1.7e-22
WP_016726852.1|538337_538526_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_089190415.1|538680_539049_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	45.3	8.6e-16
WP_089190416.1|539214_539580_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	57.1	2.7e-30
WP_089190417.1|539622_540843_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.2	8.4e-193
WP_089190418.1|540839_542243_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	61.7	1.7e-165
WP_058908894.1|542639_543047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727896.1|543036_543246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064047862.1|543480_545778_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_021156153.1|545761_546151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331367.1|546156_546561_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	50.4	6.3e-28
WP_021156152.1|546633_547266_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	8.0e-62
WP_021156151.1|547283_548156_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.7	2.4e-101
>prophage 3
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	931602	991865	3832354	transposase,tRNA	Leptospira_phage(25.0%)	54	NA	NA
WP_058907490.1|931602_933426_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.0	9.2e-10
WP_011000426.1|933516_934248_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	29.4	1.9e-14
WP_011000425.1|934276_934615_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_071089624.1|934846_936286_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_011000423.1|936546_937176_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011000422.1|937198_938776_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	C7U092	Ostreococcus_tauri_virus	29.2	2.0e-37
WP_058907482.1|938772_939426_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_020831223.1|939551_940601_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_011000419.1|940717_941449_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011000418.1|941500_941917_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_011000417.1|941942_943787_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	29.6	2.4e-10
WP_016724044.1|943875_944319_-	HIT family protein	NA	NA	NA	NA	NA
WP_016724045.1|944315_948353_-	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011000414.1|948555_949137_-	DedA family protein	NA	NA	NA	NA	NA
WP_058907480.1|950578_951058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000411.1|951069_951993_-	potassium channel protein	NA	NA	NA	NA	NA
WP_016724049.1|952134_953658_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_058907479.1|953686_954520_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	38.9	1.5e-39
WP_058907489.1|954746_956087_+	acetate kinase	NA	NA	NA	NA	NA
WP_058907478.1|956103_956679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000406.1|956704_957409_-	peptidase C39	NA	NA	NA	NA	NA
WP_011000405.1|957430_957859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907477.1|957992_959267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907476.1|959950_961666_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	5.6e-25
WP_011000402.1|961894_962404_+	gluconokinase	NA	NA	NA	NA	NA
WP_058907488.1|962439_963243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000400.1|963312_964266_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_058907475.1|964482_964917_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_020831200.1|964918_965332_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_011000397.1|965564_966338_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_162496213.1|966395_967079_-	3-oxoacyl-ACP reductase FabG	NA	A0A0N9R355	Chrysochromulina_ericina_virus	28.8	3.2e-08
WP_071615133.1|967212_967497_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011000394.1|968047_968704_+	membrane protein	NA	NA	NA	NA	NA
WP_058907474.1|968771_970463_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_071089645.1|970459_971431_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_011000391.1|971434_972070_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_089190461.1|972073_974557_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011000389.1|974553_975417_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_028852578.1|975500_976718_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_089190462.1|976714_977536_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_016724277.1|977532_978042_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_011000385.1|978071_978329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020831186.1|978672_979005_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089190463.1|980681_982268_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_161495329.1|982300_982453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089190464.1|982543_983660_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	8.9e-48
WP_089190465.1|983706_983892_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	49.0	3.6e-07
WP_089190832.1|983888_984365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089190833.1|985392_986673_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_151903964.1|986786_987884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190466.1|988037_988241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161495330.1|988570_989614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190420.1|990024_990834_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.2	8.6e-77
WP_151903962.1|990833_991865_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	47.9	3.3e-81
>prophage 4
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	1691975	1756788	3832354	transposase,protease	Acidithiobacillus_phage(36.36%)	53	NA	NA
WP_016723619.1|1691975_1692941_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_089190541.1|1694304_1695249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151903979.1|1695449_1695989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190543.1|1695985_1696378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190544.1|1696374_1697220_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_089190545.1|1697860_1699588_+	N-6 DNA methylase	NA	Q8V6N5	Halorubrum_phage	25.1	2.1e-19
WP_089190546.1|1699587_1700328_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_089190547.1|1700365_1700839_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	51.7	1.9e-36
WP_089190548.1|1700835_1701210_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	64.6	1.2e-41
WP_089190549.1|1701206_1702595_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.1	7.8e-219
WP_011003058.1|1702591_1703041_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	2.3e-55
WP_071615542.1|1703040_1703232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064478163.1|1703796_1705131_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_064478162.1|1705241_1706135_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064478161.1|1706399_1707518_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_019719001.1|1707698_1708886_+	MFS transporter	NA	NA	NA	NA	NA
WP_064478159.1|1709010_1709640_+	LysE family translocator	NA	NA	NA	NA	NA
WP_071654053.1|1709753_1710578_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071615590.1|1710603_1710939_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_016725374.1|1710969_1711587_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016725375.1|1711623_1712067_-	cyanase	NA	NA	NA	NA	NA
WP_071615587.1|1713862_1715227_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_089190550.1|1716140_1716944_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|1718039_1719005_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_043876768.1|1719660_1720461_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_028861115.1|1720639_1721218_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_089190551.1|1721214_1722117_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_089190552.1|1722129_1723293_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_028861113.1|1723289_1725392_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011003050.1|1728756_1729452_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_043876677.1|1729517_1731449_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_058908710.1|1731776_1732907_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_058908709.1|1732947_1734225_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003046.1|1734510_1735347_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831502.1|1735838_1737167_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003045.1|1737220_1737424_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_019718985.1|1737751_1737958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507821.1|1738545_1739724_+	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_011003043.1|1740159_1740996_+	cytochrome c	NA	NA	NA	NA	NA
WP_147495255.1|1741225_1741432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071623933.1|1741877_1743368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071623932.1|1743364_1744207_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071507824.1|1744424_1746548_-	tryptophan 2-monooxygenase oxidoreductase	NA	NA	NA	NA	NA
WP_011003039.1|1747287_1747719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003038.1|1748762_1749104_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_089190842.1|1749415_1749694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003036.1|1749693_1750842_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003035.1|1750969_1751362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832955.1|1751692_1752598_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003033.1|1752651_1754031_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.8e-13
WP_089190553.1|1754346_1754946_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_016724421.1|1755202_1755757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190843.1|1755828_1756788_+|protease	serine protease	protease	A0A0F6R5W6	Sinorhizobium_phage	30.0	1.3e-07
>prophage 5
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	1820216	1857237	3832354	holin,tail,head,capsid,portal,terminase,integrase,plate	Ralstonia_virus(56.25%)	53	1819839:1819884	1857276:1857321
1819839:1819884	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_161495337.1|1820216_1821194_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	100.0	4.1e-190
WP_089190556.1|1821190_1821553_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_020832917.1|1822102_1822513_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	99.2	2.0e-66
WP_021155085.1|1822514_1823018_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	98.8	1.0e-91
WP_151903981.1|1823027_1823960_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	99.0	8.8e-166
WP_089190557.1|1823869_1824685_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	98.1	5.1e-154
WP_089190558.1|1824669_1825776_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	97.8	5.1e-213
WP_089190559.1|1825772_1827554_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	97.5	0.0e+00
WP_016721963.1|1827697_1828537_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	95.0	5.9e-145
WP_011001874.1|1828590_1829607_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_089190560.1|1829603_1830326_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	99.6	1.1e-126
WP_089190844.1|1830422_1830902_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	99.4	5.1e-85
WP_011001871.1|1830901_1831108_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_089190561.1|1831123_1831528_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	88.1	3.1e-27
WP_089190562.1|1831524_1831839_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	98.1	3.8e-49
WP_015985094.1|1831835_1832642_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	100.0	4.9e-149
WP_089190563.1|1832638_1833139_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	95.2	5.7e-79
WP_089190564.1|1833135_1833570_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	97.2	7.9e-77
WP_089190565.1|1833566_1834013_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	90.5	4.4e-67
WP_089190566.1|1834086_1834704_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	92.7	5.2e-106
WP_089190567.1|1834700_1835048_+|plate	baseplate assembly protein	plate	A0A077K8R5	Ralstonia_phage	97.3	2.7e-56
WP_089190568.1|1835050_1835959_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.4	1.7e-158
WP_023470164.1|1835951_1836569_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	1.5e-100
WP_089190569.1|1836575_1838240_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	96.4	6.3e-308
WP_089190570.1|1838250_1839003_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	92.0	2.3e-124
WP_089190571.1|1838999_1839464_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	94.2	1.9e-81
WP_089190572.1|1839557_1840733_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	95.9	5.6e-218
WP_089190573.1|1840764_1841274_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	85.8	1.6e-81
WP_089190574.1|1841349_1841676_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	1.8e-49
WP_049832823.1|1841672_1841774_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	90.9	4.7e-09
WP_089190575.1|1841770_1844434_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	95.9	0.0e+00
WP_028861067.1|1844436_1844859_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.1	2.5e-72
WP_089190576.1|1844855_1845983_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.5	3.2e-202
WP_071615623.1|1846295_1846505_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_089190577.1|1846455_1847238_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	66.9	5.9e-91
WP_089190578.1|1847153_1847900_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	93.5	1.8e-121
WP_016727351.1|1848058_1848481_-	helix-turn-helix domain-containing protein	NA	A4PE57	Ralstonia_virus	100.0	6.7e-73
WP_071615658.1|1848556_1848757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727352.1|1848776_1848968_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_015985115.1|1848996_1849191_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	100.0	1.8e-25
WP_015985116.1|1849187_1849436_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	100.0	1.0e-41
WP_015985117.1|1849550_1850105_+	Bro-N domain-containing protein	NA	A4PE61	Ralstonia_virus	100.0	1.2e-98
WP_089190579.1|1850114_1850348_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	98.7	5.8e-34
WP_089190580.1|1850505_1850712_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	91.0	4.8e-24
WP_016721678.1|1850711_1850948_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.7	3.5e-39
WP_015985122.1|1850940_1851153_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	100.0	6.4e-32
WP_016725459.1|1851172_1851481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190581.1|1851482_1851704_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	98.6	8.4e-35
WP_016725461.1|1851700_1851973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725462.1|1851969_1852260_+	hypothetical protein	NA	A4PE68	Ralstonia_virus	95.8	1.4e-50
WP_089190582.1|1852259_1855064_+	hypothetical protein	NA	A4PE69	Ralstonia_virus	99.8	0.0e+00
WP_021155124.1|1855050_1855224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190583.1|1856154_1857237_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	99.7	2.0e-209
1857276:1857321	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 6
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	2248589	2300841	3832354	coat,transposase,tRNA	uncultured_Mediterranean_phage(42.86%)	42	NA	NA
WP_011002630.1|2248589_2249702_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_028853617.1|2249790_2251389_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_071012186.1|2251414_2252023_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_089190632.1|2252257_2253631_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.1	2.9e-109
WP_020832660.1|2253877_2254462_+	cytochrome b	NA	NA	NA	NA	NA
WP_016723720.1|2254562_2255129_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_028853616.1|2255186_2255783_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_020831502.1|2255830_2257159_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_028853615.1|2257299_2258268_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.7	8.8e-44
WP_089190633.1|2258345_2260226_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_020832658.1|2260347_2260683_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	4.0e-12
WP_016723717.1|2260788_2261940_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	9.4e-77
WP_089190634.1|2261933_2263022_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_089190635.1|2263098_2265291_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016723714.1|2265309_2265513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002617.1|2265524_2265965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190637.1|2266506_2267637_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_089190849.1|2267779_2268721_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908278.1|2268911_2270135_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_058908277.1|2270179_2271466_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_020832649.1|2271825_2272287_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908276.1|2272497_2273694_-	amidohydrolase	NA	NA	NA	NA	NA
WP_049832842.1|2274174_2275374_-	UDP-glucuronosyltransferase	NA	NA	NA	NA	NA
WP_016723619.1|2275749_2276715_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_111354815.1|2276844_2277015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908804.1|2277160_2277496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081049995.1|2278539_2286015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190638.1|2286699_2287934_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.8	4.8e-103
WP_019718280.1|2287997_2288315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020832646.1|2288796_2289009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028853600.1|2289107_2289362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723700.1|2290130_2290295_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	57.1	3.2e-07
WP_011002610.1|2290740_2291067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|2291160_2291445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|2292783_2293101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|2293251_2293548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615274.1|2294520_2294781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002605.1|2296126_2296630_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907884.1|2296679_2297183_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089190639.1|2297301_2298021_+	molecular chaperone	NA	NA	NA	NA	NA
WP_058907885.1|2298070_2300335_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011002601.1|2300331_2300841_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	2359362	2367410	3832354		Hokovirus(16.67%)	7	NA	NA
WP_021155204.1|2359362_2361324_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_151347317.1|2361490_2362600_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.0	1.3e-19
WP_028860933.1|2362635_2364516_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	4.6e-57
WP_058907902.1|2364471_2365158_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	8.8e-14
WP_011002541.1|2365165_2365873_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011002540.1|2365884_2366709_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.9e-34
WP_011002539.1|2366765_2367410_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
>prophage 8
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	2623366	2684584	3832354	capsid,transposase,integrase,tRNA	Ralstonia_phage(63.16%)	56	2626705:2626721	2691502:2691518
WP_089190703.1|2623366_2624647_-|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	27.0	9.0e-12
WP_016722739.1|2625935_2627252_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.6	6.1e-96
2626705:2626721	attL	TCGCGGGCGATGCGCTG	NA	NA	NA	NA
WP_019718421.1|2627474_2628065_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	99.0	2.1e-101
WP_019718422.1|2628091_2628805_+	hypothetical protein	NA	A0JC17	Ralstonia_phage	94.5	3.1e-123
WP_089190704.1|2628812_2629748_-	Rep protein	NA	A0A097ZIH2	Ralstonia_phage	99.0	3.3e-173
WP_019718425.1|2631053_2632370_-	zonular occludens toxin	NA	A0JC15	Ralstonia_phage	92.3	1.3e-231
WP_019718426.1|2632374_2632704_-	DUF2523 domain-containing protein	NA	A0A097ZIJ0	Ralstonia_phage	99.1	2.3e-52
WP_089190705.1|2632716_2634252_-	hypothetical protein	NA	B5UAS0	Ralstonia_phage	97.5	1.2e-215
WP_015983977.1|2634327_2634552_-	hypothetical protein	NA	A0JC12	Ralstonia_phage	100.0	9.1e-29
WP_020425224.1|2634554_2634803_-	hypothetical protein	NA	A0A097ZIG5	Ralstonia_phage	100.0	1.7e-39
WP_019718429.1|2634805_2635015_-	hypothetical protein	NA	A0A097ZIG2	Ralstonia_phage	100.0	9.4e-28
WP_019718430.1|2635014_2635224_-	hypothetical protein	NA	A0JC09	Ralstonia_phage	81.2	7.7e-22
WP_158000563.1|2635223_2635613_-	hypothetical protein	NA	Q6UAZ7	Ralstonia_phage	41.5	1.8e-11
WP_151903991.1|2635756_2636008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015983970.1|2636079_2636406_-	hypothetical protein	NA	A0JC05	Ralstonia_phage	100.0	1.7e-52
WP_071507078.1|2637037_2638237_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	45.8	2.2e-92
WP_019718435.1|2638528_2638765_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071507079.1|2638764_2639880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507080.1|2639872_2641366_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_081365397.1|2641670_2642297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190706.1|2646486_2646774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|2646779_2647585_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_089190707.1|2647681_2648665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102306.1|2648854_2649580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161495339.1|2649744_2650791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507918.1|2651318_2651696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507917.1|2651762_2652020_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071507916.1|2652023_2652326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507915.1|2652707_2653694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507914.1|2653690_2654605_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_071507913.1|2654619_2655618_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.2	1.7e-53
WP_071507912.1|2655697_2656666_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.0	1.9e-54
WP_071653984.1|2656766_2657117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102305.1|2657360_2658053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507911.1|2658322_2659564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507910.1|2659560_2660043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507909.1|2660039_2661989_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_071507908.1|2662015_2662591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507907.1|2662607_2663423_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	35.2	1.1e-34
WP_147495144.1|2663406_2663625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081365392.1|2663715_2665041_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_071653982.1|2665531_2668306_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_089190709.1|2669410_2670163_+	DUF1910 domain-containing protein	NA	NA	NA	NA	NA
WP_086005422.1|2670053_2671204_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.7e-94
WP_020832438.1|2671264_2671762_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089190710.1|2671926_2673354_+	MFS transporter	NA	NA	NA	NA	NA
WP_064477944.1|2673489_2675055_+	MFS transporter	NA	NA	NA	NA	NA
WP_071507948.1|2675277_2675652_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_011002246.1|2675751_2676579_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_064477942.1|2676598_2677015_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002244.1|2677348_2678308_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011002243.1|2678415_2678871_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071615607.1|2678994_2679543_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_011002241.1|2679574_2680774_+	MFS transporter	NA	NA	NA	NA	NA
WP_016722750.1|2681076_2681451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|2683778_2684584_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2691502:2691518	attR	TCGCGGGCGATGCGCTG	NA	NA	NA	NA
>prophage 9
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	3034543	3113234	3832354	plate,holin,tail,transposase,head,capsid,portal,terminase,integrase,tRNA	Ralstonia_phage(71.74%)	82	3069550:3069569	3113374:3113393
WP_011001921.1|3034543_3035368_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016722989.1|3035364_3036069_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016722990.1|3036164_3037358_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011001918.1|3037362_3038175_+	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	37.4	1.3e-32
WP_011001917.1|3038189_3038987_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011001916.1|3039024_3039897_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011001915.1|3039978_3041277_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011001914.1|3041363_3042185_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011001913.1|3042257_3042755_+	CvpA family protein	NA	NA	NA	NA	NA
WP_011001912.1|3042849_3044385_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.0e-86
WP_020832236.1|3044511_3045333_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001910.1|3045356_3046322_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.6e-24
WP_003264057.1|3046477_3046678_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019718616.1|3047100_3047592_+	phasin family protein	NA	NA	NA	NA	NA
WP_011001907.1|3047868_3048108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001906.1|3048251_3048572_+	membrane protein	NA	NA	NA	NA	NA
WP_071623786.1|3048781_3049579_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011001904.1|3049606_3050020_+	heme-binding protein	NA	NA	NA	NA	NA
WP_028860715.1|3050213_3050492_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_071623785.1|3050687_3051101_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011001901.1|3051110_3051842_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011001900.1|3051878_3052544_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016725286.1|3053054_3055370_+	ATP-binding protein	NA	A0A0K1Y7P8	Apis_mellifera_filamentous_virus	30.7	5.2e-10
WP_058907199.1|3055497_3055854_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016725285.1|3055837_3056797_+	activator of HSP90 ATPase	NA	NA	NA	NA	NA
WP_011001895.1|3056842_3057184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001894.1|3057646_3058933_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_089190745.1|3059053_3059896_-	glutamate racemase	NA	NA	NA	NA	NA
WP_011001892.1|3059916_3061440_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011001891.1|3061619_3062159_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_089190746.1|3062242_3063253_-	DMT family transporter	NA	NA	NA	NA	NA
WP_028860712.1|3063417_3065400_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	1.7e-78
WP_089190747.1|3065421_3067488_+	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
WP_011001886.1|3068989_3069142_+	hypothetical protein	NA	NA	NA	NA	NA
3069550:3069569	attL	AATCCTGGCGGAGAGAGGGG	NA	NA	NA	NA
WP_089190852.1|3070406_3071837_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_089190748.1|3072469_3075124_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	96.1	0.0e+00
WP_089190749.1|3075133_3075991_+	hypothetical protein	NA	A0A077K9W3	Ralstonia_phage	83.7	4.8e-134
WP_089190750.1|3076049_3078239_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	90.9	0.0e+00
WP_089190751.1|3078305_3079370_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	94.2	2.8e-200
WP_089190752.1|3079366_3081148_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	95.4	0.0e+00
WP_089190753.1|3081289_3082135_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	81.9	1.8e-125
WP_089190754.1|3082189_3083233_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	87.7	1.8e-164
WP_089190755.1|3083229_3083952_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	87.9	1.7e-108
WP_089190756.1|3084000_3084528_+|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	88.6	6.8e-83
WP_089190757.1|3084527_3084734_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	97.1	3.4e-30
WP_028853278.1|3084749_3085154_+	membrane protein	NA	A0A077K9X1	Ralstonia_phage	97.8	1.2e-26
WP_089190758.1|3085150_3085465_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	95.1	9.5e-48
WP_089190759.1|3085461_3086268_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	93.7	4.6e-139
WP_089190760.1|3086264_3086765_+	hypothetical protein	NA	A4PE37	Ralstonia_virus	95.2	9.7e-79
WP_089190761.1|3086761_3087196_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	88.2	2.7e-69
WP_089190762.1|3087192_3087639_+	phage virion morphogenesis protein	NA	A4PE39	Ralstonia_virus	84.9	2.1e-61
WP_151903994.1|3087813_3088296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161495341.1|3088662_3089298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146606966.1|3089294_3090308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190765.1|3090704_3091322_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	96.1	1.4e-111
WP_089190766.1|3091318_3091666_+|plate	baseplate assembly protein	plate	A4PE42	Ralstonia_virus	94.8	2.1e-56
WP_089190767.1|3091668_3092577_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	98.3	1.2e-159
WP_089190768.1|3092569_3093187_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	95.7	5.5e-100
WP_089190769.1|3093193_3094534_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	75.8	1.0e-231
WP_089190770.1|3094546_3095299_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	93.6	5.5e-126
WP_089190771.1|3095295_3095760_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	89.0	1.1e-76
WP_089190772.1|3095853_3097029_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	95.9	3.0e-219
WP_011001854.1|3097060_3097570_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_003267618.1|3097967_3098069_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_089190773.1|3098065_3100729_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	97.2	0.0e+00
WP_089190774.1|3100731_3101154_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	98.6	3.9e-73
WP_089190775.1|3101150_3102278_+	phage late control D family protein	NA	A0A077KES1	Ralstonia_phage	95.4	2.0e-196
WP_146606965.1|3102719_3103190_+	hypothetical protein	NA	A0A077K9T2	Ralstonia_phage	98.7	6.1e-83
WP_089190776.1|3103245_3104337_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_089190550.1|3104635_3105440_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_089190777.1|3105889_3106360_-	helix-turn-helix domain-containing protein	NA	A0A077K9Z1	Ralstonia_phage	98.1	8.2e-80
WP_143102279.1|3106432_3106633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653971.1|3106658_3106850_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.8	2.6e-08
WP_071507523.1|3106878_3107073_+	hypothetical protein	NA	A0A077KET0	Ralstonia_phage	100.0	2.2e-26
WP_089190778.1|3107069_3107318_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	98.8	4.4e-40
WP_089190779.1|3107998_3108238_+	hypothetical protein	NA	A0A077K8S8	Ralstonia_phage	98.7	3.3e-37
WP_089190780.1|3108398_3108611_+	hypothetical protein	NA	A0A077KET1	Ralstonia_phage	95.8	7.6e-25
WP_089190781.1|3108610_3108853_+	hypothetical protein	NA	A0A077K830	Ralstonia_phage	96.2	4.7e-39
WP_089190782.1|3108845_3109052_+	hypothetical protein	NA	A0A077K9T6	Ralstonia_phage	98.5	1.2e-30
WP_089190783.1|3109106_3111812_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	99.4	0.0e+00
WP_016721680.1|3111808_3112024_+	AlpA family phage regulatory protein	NA	A0A077K9Z8	Ralstonia_phage	100.0	2.4e-34
WP_089190784.1|3111998_3113234_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	99.3	1.4e-235
3113374:3113393	attR	AATCCTGGCGGAGAGAGGGG	NA	NA	NA	NA
>prophage 10
NZ_CP016914	Ralstonia solanacearum strain CQPS-1 chromosome, complete genome	3832354	3531772	3538567	3832354		Ralstonia_phage(100.0%)	11	NA	NA
WP_010889950.1|3531772_3532204_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	100.0	7.1e-78
WP_010889951.1|3532245_3532872_-	hypothetical protein	NA	A0JC29	Ralstonia_phage	100.0	6.2e-107
WP_064820707.1|3532949_3534044_-	zonular occludens toxin	NA	A0JC28	Ralstonia_phage	99.5	1.7e-205
WP_089190810.1|3534040_3534316_-	DUF2523 domain-containing protein	NA	A0JC27	Ralstonia_phage	100.0	1.6e-35
WP_058908732.1|3534312_3535593_-	hypothetical protein	NA	A0A0K2QQ05	Ralstonia_phage	99.1	1.8e-217
WP_010889942.1|3535672_3536008_-	hypothetical protein	NA	A0JC24	Ralstonia_phage	100.0	1.6e-56
WP_058908733.1|3536007_3536268_-	hypothetical protein	NA	A0JC23	Ralstonia_phage	98.8	2.6e-35
WP_010889944.1|3536274_3536586_-	hypothetical protein	NA	A0JC22	Ralstonia_phage	100.0	8.2e-52
WP_089190811.1|3536590_3537718_-	replication initiation protein	NA	A0A0K2QQ01	Ralstonia_phage	99.5	8.3e-219
WP_089190812.1|3537771_3538041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190813.1|3538174_3538567_+	helix-turn-helix transcriptional regulator	NA	S6B268	Ralstonia_phage	100.0	4.8e-65
>prophage 1
NZ_CP016915	Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence	2061090	6258	38986	2061090	head,capsid,portal,transposase,terminase,tail	Acidithiobacillus_phage(32.0%)	36	NA	NA
WP_089190393.1|6258_10362_-|tail	phage tail tape measure protein	tail	V9QL83	Rhizobium_phage	36.2	3.9e-24
WP_071895622.1|10427_11555_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.6	9.1e-101
WP_016723619.1|13525_14491_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_058908874.1|14993_15284_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	46.5	5.0e-11
WP_089190854.1|15326_15971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190855.1|15945_16167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190856.1|16163_16553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190857.1|16561_17335_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.2	2.6e-46
WP_089190858.1|17435_17882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190859.1|17887_18190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190860.1|18192_19197_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	66.3	3.6e-109
WP_089190861.1|19203_19581_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	1.4e-24
WP_089190862.1|19590_20850_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	44.9	2.9e-63
WP_089190863.1|20859_22407_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	9.5e-149
WP_028852764.1|22406_22628_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	4.5e-12
WP_089190864.1|22628_23021_-	hypothetical protein	NA	A4ZRC7	Synechococcus_virus	52.3	9.5e-05
WP_089190865.1|23031_23541_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	45.0	4.8e-25
WP_089191138.1|23584_25564_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.2	0.0e+00
WP_089190866.1|25566_26103_-	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.0	5.0e-73
WP_089190867.1|26188_26410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191139.1|26462_26801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190868.1|26906_27419_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	69.9	1.0e-22
WP_089190869.1|27672_27861_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	64.2	1.0e-12
WP_089190870.1|28085_28451_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.0	1.0e-32
WP_043876561.1|28553_28799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089190871.1|28758_29994_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.0	2.5e-192
WP_071893036.1|29990_31391_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	1.3e-165
WP_016723619.1|31808_32774_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_089190872.1|32965_33373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000793.1|33362_33575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190873.1|33806_36104_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.9	1.6e-293
WP_089190874.1|36087_36486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089190875.1|36491_36896_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	50.7	1.7e-28
WP_019717722.1|36968_37601_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	67.5	3.6e-62
WP_089190876.1|37619_38492_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.1	1.4e-101
WP_089190877.1|38488_38986_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	40.0	5.0e-19
>prophage 2
NZ_CP016915	Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence	2061090	1727638	1785273	2061090	tRNA,plate,transposase	uncultured_Caudovirales_phage(40.0%)	38	NA	NA
WP_058907497.1|1727638_1729591_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	1.5e-42
WP_071507247.1|1729577_1731119_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_071507246.1|1731341_1733351_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_028854274.1|1733492_1734047_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1734258_1734975_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723220.1|1736740_1737022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907494.1|1737139_1738096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158594559.1|1738294_1739212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191091.1|1739304_1740969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653889.1|1740984_1744005_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.0	3.4e-17
WP_011004065.1|1744142_1744889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908694.1|1745174_1746023_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1746062_1746332_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_058908695.1|1746342_1747830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191092.1|1747872_1751802_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_089191093.1|1751798_1752785_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_089191094.1|1752787_1753621_+	OmpA family protein	NA	NA	NA	NA	NA
WP_089191095.1|1753718_1754687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071615514.1|1754759_1755839_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011004056.1|1755972_1757316_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_016723234.1|1757312_1758071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019719442.1|1758075_1758459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908884.1|1762402_1763041_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003443.1|1763374_1764706_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653888.1|1764787_1765612_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058908010.1|1765643_1766717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653887.1|1766729_1769507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191096.1|1769484_1770618_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_071623901.1|1770635_1773392_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.5	3.5e-37
WP_028861634.1|1773412_1776130_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_058908679.1|1776162_1777254_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058908678.1|1777217_1779068_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011004044.1|1779130_1779604_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011004043.1|1779664_1780168_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_058908677.1|1780255_1781746_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011004040.1|1782286_1782934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191097.1|1783208_1783883_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011004038.1|1783926_1785273_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
