The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	249647	258335	5155137	integrase	Enterobacteria_phage(66.67%)	9	241813:241828	256704:256719
241813:241828	attL	TGGCGCTGAGCGCCAC	NA	NA	NA	NA
WP_015376738.1|249647_250751_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	2.6e-60
WP_089184257.1|250754_252014_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.6	2.8e-98
WP_089184258.1|252441_253623_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	4.0e-139
WP_048326808.1|254376_254640_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	56.2	8.5e-18
WP_089184259.1|254636_254852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052210568.1|254838_255384_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.7	5.5e-27
WP_089184260.1|255380_255644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184261.1|255640_255976_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_089184262.1|255986_258335_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	59.1	7.6e-259
256704:256719	attR	GTGGCGCTCAGCGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	1195087	1233258	5155137	integrase,terminase,holin,tail	uncultured_Caudovirales_phage(26.47%)	46	1192382:1192395	1205308:1205321
1192382:1192395	attL	TGCGGAATCGCTTT	NA	NA	NA	NA
WP_060433340.1|1195087_1196101_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.9	5.6e-126
WP_060424873.1|1196101_1196326_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	42.0	6.2e-09
WP_060431573.1|1196760_1197261_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	69.9	1.0e-56
WP_089184444.1|1197257_1199402_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.7	5.2e-105
WP_060450646.1|1199741_1200056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060424680.1|1200553_1200940_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	62.7	8.1e-17
WP_060424678.1|1201020_1201227_+	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	36.4	8.5e-05
WP_041034485.1|1201287_1201740_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.8	4.4e-30
WP_089184445.1|1201763_1201982_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	59.4	2.3e-16
WP_079451410.1|1201984_1202704_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	70.0	1.4e-30
WP_089184446.1|1202700_1204074_+	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	48.6	7.9e-115
WP_089184447.1|1204118_1204541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184448.1|1204544_1204790_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	48.6	8.5e-12
WP_145957347.1|1204779_1205103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184449.1|1205089_1205635_+	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	69.3	3.0e-65
1205308:1205321	attR	AAAGCGATTCCGCA	NA	NA	NA	NA
WP_089184450.1|1205836_1206076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184451.1|1206079_1206592_+	hypothetical protein	NA	R9W086	Serratia_phage	40.3	4.7e-20
WP_145957348.1|1206773_1207451_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_089184453.1|1207616_1207808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060431583.1|1207877_1208474_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	66.7	3.5e-75
WP_089184454.1|1208482_1208788_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	57.3	8.9e-27
WP_041034508.1|1208942_1209239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184455.1|1209267_1209720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060426441.1|1209730_1209949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184456.1|1209952_1211575_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	57.9	2.1e-175
WP_047568214.1|1211574_1211808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184457.1|1211794_1212619_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	39.6	1.2e-41
WP_089184458.1|1212634_1213039_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	66.4	4.3e-37
WP_060448311.1|1213251_1214163_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.6	3.7e-44
WP_089184459.1|1214217_1214787_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.8	2.8e-50
WP_089184460.1|1214789_1216781_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.0	1.9e-181
WP_079451930.1|1216783_1217233_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	44.3	6.8e-23
WP_079451933.1|1217235_1217763_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	45.7	8.5e-09
WP_060438348.1|1217762_1220288_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.6	1.1e-175
WP_060426416.1|1220284_1222063_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	45.1	2.5e-129
WP_060426413.1|1222067_1224542_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	74.9	0.0e+00
WP_154618216.1|1224554_1224701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883881.1|1224743_1225058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184461.1|1225128_1225470_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	46.4	2.6e-19
WP_060426407.1|1225466_1227077_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.2	9.6e-229
WP_089184462.1|1227090_1229667_+	hypothetical protein	NA	K4NYZ2	Pseudomonas_phage	33.3	1.3e-12
WP_060418665.1|1229698_1229932_+|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_089184463.1|1229915_1230431_+	lysozyme	NA	I6PBN2	Cronobacter_phage	63.3	3.1e-48
WP_089184464.1|1230415_1230790_+	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	45.5	5.3e-13
WP_089184465.1|1230786_1231044_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	57.0	3.9e-15
WP_145957349.1|1232148_1233258_+	acyltransferase family protein	NA	Q6QI96	Burkholderia_phage	23.5	1.1e-05
>prophage 3
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	1471481	1491775	5155137	coat,protease	Moraxella_phage(100.0%)	18	NA	NA
WP_033640557.1|1471481_1472900_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033640556.1|1473047_1473257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|1474037_1474430_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_089184518.1|1474434_1475034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931517.1|1475088_1475328_-	YebV family protein	NA	NA	NA	NA	NA
WP_033640550.1|1475463_1476396_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089185327.1|1476416_1478759_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033640548.1|1478904_1479669_-	molecular chaperone	NA	NA	NA	NA	NA
WP_089184519.1|1479693_1480248_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033640544.1|1480247_1480751_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016928005.1|1480753_1481293_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089184520.1|1481567_1483004_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_015377667.1|1483106_1485737_-	PqiB family protein	NA	NA	NA	NA	NA
WP_028128162.1|1485705_1486953_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033640540.1|1487208_1487706_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_016928000.1|1487802_1488513_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033640537.1|1488532_1490581_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	2.0e-85
WP_016927998.1|1490890_1491775_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	2729508	2751291	5155137	tail,holin	Klebsiella_phage(29.41%)	23	NA	NA
WP_089184830.1|2729508_2731530_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	46.7	2.0e-29
WP_089184831.1|2731526_2732687_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	55.3	5.2e-43
WP_060444519.1|2736329_2736956_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.2	6.3e-51
WP_145957361.1|2736985_2737345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957362.1|2738315_2738675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089184833.1|2738714_2739419_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	75.0	1.5e-106
WP_089185340.1|2739428_2740178_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.5	1.1e-94
WP_048796968.1|2740190_2740529_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.9	4.9e-34
WP_089184834.1|2740528_2742820_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.2e-16
WP_004935830.1|2742812_2743034_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_016926947.1|2743051_2743417_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	44.2	1.9e-23
WP_089184835.1|2743533_2743989_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	74.3	2.1e-56
WP_060444516.1|2744030_2744423_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	47.6	5.5e-21
WP_048796965.1|2744419_2744809_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.9	3.7e-25
WP_016926943.1|2744864_2745305_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	63.4	2.0e-43
WP_028127738.1|2745301_2745613_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_089184836.1|2746299_2746662_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_089184837.1|2746903_2747581_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	44.6	1.6e-07
WP_004935874.1|2747983_2748313_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_089184838.1|2748440_2748908_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060444513.1|2749014_2749593_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060444512.1|2749586_2750003_-	glyoxalase	NA	NA	NA	NA	NA
WP_089184839.1|2750154_2751291_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.6	1.2e-103
>prophage 5
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	3123976	3173760	5155137	terminase,tail,integrase,holin,transposase	Salmonella_phage(29.79%)	61	3141568:3141584	3181099:3181115
WP_089184586.1|3123976_3125097_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	6.0e-52
WP_089184909.1|3125426_3126092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184910.1|3126066_3128406_+	recombinase RecF	NA	NA	NA	NA	NA
WP_089184911.1|3128622_3129048_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	42.5	9.0e-09
WP_089184912.1|3129160_3130015_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	1.1e-79
WP_023447553.1|3130011_3130296_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_089184913.1|3130775_3131036_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	53.5	1.9e-14
WP_089184914.1|3131032_3131407_-	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	47.5	3.7e-14
WP_089184915.1|3131391_3131907_-	lysozyme	NA	I6PBN2	Cronobacter_phage	63.3	4.8e-49
WP_060706595.1|3131890_3132124_-|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_089184916.1|3132155_3134756_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	36.3	3.0e-54
WP_050438967.1|3134942_3135191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184917.1|3135550_3136282_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	38.8	2.7e-37
WP_089184918.1|3136491_3136671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184919.1|3136680_3137151_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_089184920.1|3137242_3137653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184921.1|3137639_3137831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089184922.1|3137830_3140596_-	hypothetical protein	NA	Q858F8	Salmonella_phage	77.3	0.0e+00
WP_089184923.1|3140595_3142452_-	hypothetical protein	NA	Q858F9	Salmonella_phage	57.0	4.0e-178
3141568:3141584	attL	GTTTGCTGCAGGTGGAA	NA	NA	NA	NA
WP_089185344.1|3142451_3144959_-	hypothetical protein	NA	Q858G0	Salmonella_phage	51.4	4.7e-230
WP_089184924.1|3144968_3145538_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	47.3	1.6e-29
WP_089184925.1|3145530_3146004_-	hypothetical protein	NA	Q858G2	Salmonella_phage	66.0	8.6e-53
WP_089184926.1|3146003_3148505_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.3	6.1e-307
WP_060418223.1|3148504_3149113_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
WP_060418224.1|3149112_3149436_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	2.7e-21
WP_108675236.1|3149475_3149760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060418226.1|3149770_3150217_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	59.9	1.1e-33
WP_060448550.1|3150270_3151257_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	71.6	1.1e-139
WP_089184927.1|3151262_3151943_-	peptidase	NA	G9L6C4	Escherichia_phage	69.3	2.0e-50
WP_089184928.1|3151953_3152217_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	65.7	1.2e-11
WP_060430634.1|3152182_3152479_-	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	7.1e-29
WP_089184929.1|3152478_3154164_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.5	1.4e-185
WP_089184930.1|3154913_3155294_+	hypothetical protein	NA	Q716B1	Shigella_phage	69.6	1.6e-41
WP_089184931.1|3155290_3155668_+	hypothetical protein	NA	J9QM70	Pectobacterium_phage	69.8	2.1e-46
WP_089184932.1|3155708_3157181_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	81.9	5.5e-247
WP_089184933.1|3157177_3157735_-|terminase	terminase small subunit	terminase	Q858H4	Salmonella_phage	66.3	2.2e-63
WP_033648885.1|3157840_3158098_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	53.0	7.1e-17
WP_089184934.1|3158170_3158557_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	34.0	1.0e-11
WP_089184935.1|3158549_3159137_-	DUF551 domain-containing protein	NA	Q8HAA7	Salmonella_phage	50.5	4.4e-14
WP_089184936.1|3159133_3159367_-	hypothetical protein	NA	B1GS76	Salmonella_phage	44.6	6.0e-07
WP_158523363.1|3160148_3160313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089184938.1|3160305_3160839_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	55.1	5.0e-41
WP_089184939.1|3160835_3161339_-	hypothetical protein	NA	R9W085	Serratia_phage	63.9	9.6e-10
WP_033648893.1|3161349_3161562_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	50.8	4.0e-10
WP_049234965.1|3161564_3161864_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	7.1e-37
WP_158523364.1|3162127_3162688_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	37.8	9.3e-22
WP_033632341.1|3163549_3163756_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.0	2.5e-09
WP_033648895.1|3163899_3164118_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
WP_089184940.1|3164266_3164863_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.3	9.5e-49
WP_154231759.1|3165156_3165312_+	hypothetical protein	NA	A0A286MN37	Klebsiella_phage	48.0	9.8e-06
WP_121513954.1|3165388_3165532_+	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	46.5	2.0e-05
WP_089184941.1|3165534_3165840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184942.1|3165839_3166661_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	79.0	8.3e-128
WP_089184943.1|3166657_3167614_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	1.7e-92
WP_033648902.1|3167654_3167906_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	48.8	9.3e-14
WP_033648903.1|3168023_3168254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089184944.1|3168250_3168904_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.0	4.2e-82
WP_033648906.1|3168900_3169185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050438971.1|3169188_3170391_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	69.5	1.3e-156
WP_015378768.1|3170615_3172193_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004941460.1|3172296_3173760_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	2.0e-87
3181099:3181115	attR	TTCCACCTGCAGCAAAC	NA	NA	NA	NA
>prophage 6
NZ_CP018927	Serratia marcescens strain UMH8 chromosome, complete genome	5155137	3756379	3797388	5155137	lysis,terminase,portal,head,tail,integrase,plate,tRNA,capsid	Erwinia_phage(43.59%)	51	3763009:3763057	3797481:3797529
WP_028127590.1|3756379_3757393_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
WP_001144069.1|3757718_3757934_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015379098.1|3758070_3759819_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.7e-74
WP_004937194.1|3759976_3761818_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_080286907.1|3761873_3762326_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_033639354.1|3762342_3762831_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3763009:3763057	attL	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
WP_033644586.1|3763254_3763485_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	9.4e-21
WP_089185039.1|3763571_3764729_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	63.6	6.4e-126
WP_060387526.1|3764725_3765211_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	65.7	1.5e-47
WP_089185040.1|3765210_3768060_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	50.1	6.9e-105
WP_023456045.1|3768052_3768175_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_060437254.1|3768207_3768489_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.8e-26
WP_023447563.1|3768542_3769052_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.2	1.7e-70
WP_089185041.1|3769067_3770237_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.4	4.0e-184
WP_158523367.1|3770898_3771183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117287285.1|3771350_3771818_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	45.8	3.2e-31
WP_089185043.1|3771897_3774519_-	hypothetical protein	NA	Q858V4	Yersinia_virus	52.0	5.0e-57
WP_015379109.1|3774525_3775059_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	76.6	4.3e-77
WP_089185044.1|3775051_3775960_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.2	1.6e-108
WP_048321956.1|3775964_3776315_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	65.5	2.4e-36
WP_089185045.1|3776311_3776941_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.1	8.2e-75
WP_089185046.1|3777013_3777460_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	59.1	2.1e-40
WP_089185047.1|3777446_3777923_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	64.1	1.5e-49
WP_089185048.1|3778018_3778447_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	36.6	1.6e-13
WP_089185049.1|3778443_3778956_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.9	8.7e-59
WP_015379117.1|3778939_3779149_-	hypothetical protein	NA	B6SD15	Bacteriophage	48.2	9.2e-07
WP_043148052.1|3779151_3779355_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	68.7	7.0e-20
WP_033639340.1|3779354_3779843_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	54.3	1.1e-39
WP_033649039.1|3779936_3780596_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	5.2e-80
WP_089185050.1|3780598_3781777_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.9	3.4e-159
WP_060431382.1|3781819_3782635_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	52.8	1.0e-69
WP_089185051.1|3782777_3784550_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.9	2.2e-290
WP_089185052.1|3784549_3785584_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.4	3.8e-162
WP_089185053.1|3785614_3786925_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_063988754.1|3787090_3787432_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_071605322.1|3787431_3787686_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	5.9e-16
WP_089185054.1|3788101_3789307_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_145957367.1|3789433_3789631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185056.1|3789678_3789903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089185057.1|3789941_3792152_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.4	1.5e-240
WP_089185058.1|3792148_3793156_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	45.4	9.8e-62
WP_089185059.1|3793145_3793427_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	51.2	4.5e-17
WP_060426813.1|3793549_3793774_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	56.9	3.7e-14
WP_060437236.1|3793773_3794085_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_023447523.1|3794084_3794327_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	50.0	7.4e-08
WP_043148063.1|3794390_3794693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049279101.1|3794704_3794884_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_049279096.1|3794894_3795404_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	53.6	7.1e-45
WP_048321972.1|3795434_3795656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048321973.1|3795765_3796350_+	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.2	6.3e-29
WP_049279097.1|3796353_3797388_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	62.6	1.5e-121
3797481:3797529	attR	CTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATT	NA	NA	NA	NA
