The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018930	Serratia marcescens strain UMH12 chromosome, complete genome	5196805	1448191	1468487	5196805	coat,protease	Moraxella_phage(100.0%)	17	NA	NA
WP_049209391.1|1448191_1449610_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|1449756_1449966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|1450747_1451140_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_025302577.1|1451144_1451744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025302578.1|1451799_1452039_-	YebV family protein	NA	NA	NA	NA	NA
WP_025302579.1|1452174_1453107_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302581.1|1455614_1456379_-	molecular chaperone	NA	NA	NA	NA	NA
WP_016928007.1|1456403_1456958_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302583.1|1456957_1457461_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016928005.1|1457463_1458003_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060447256.1|1458279_1459716_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_025302585.1|1459818_1462449_-	PqiB family protein	NA	NA	NA	NA	NA
WP_025302586.1|1462417_1463665_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_025302587.1|1463920_1464418_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|1464514_1465225_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_016927999.1|1465244_1467293_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	1.2e-85
WP_016927998.1|1467602_1468487_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP018930	Serratia marcescens strain UMH12 chromosome, complete genome	5196805	2031438	2093313	5196805	coat,tail,holin,protease,terminase	Escherichia_phage(26.67%)	73	NA	NA
WP_043143623.1|2031438_2032251_+|protease	serine protease	protease	NA	NA	NA	NA
WP_025302977.1|2032349_2036237_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	27.0	7.6e-54
WP_015377994.1|2036506_2037112_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_025302978.1|2037230_2037554_-	YdbL family protein	NA	NA	NA	NA	NA
WP_025302979.1|2037562_2037760_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_089180380.1|2037756_2040369_-	YdbH family protein	NA	NA	NA	NA	NA
WP_127145960.1|2040693_2041521_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025302982.1|2041657_2041948_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_025302983.1|2042090_2043083_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	43.6	4.2e-65
WP_049205463.1|2043133_2043562_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_015377999.1|2043583_2043838_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_025302985.1|2044337_2044670_-	multidrug efflux SMR transporter SsmE	NA	NA	NA	NA	NA
WP_025302986.1|2044908_2048442_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_060447733.1|2048529_2048844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060432114.1|2049364_2049763_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	51.2	1.6e-23
WP_089180381.1|2049916_2051041_-	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	49.6	8.1e-57
WP_158523421.1|2051043_2051220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180382.1|2051220_2052174_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	45.6	4.6e-69
WP_089180383.1|2052222_2053212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180525.1|2053213_2056417_-	host specificity protein J	NA	F1C571	Cronobacter_phage	67.1	0.0e+00
WP_089180384.1|2056471_2057098_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	53.3	2.6e-49
WP_145957001.1|2057140_2057500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180385.1|2057508_2058219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180386.1|2058280_2058994_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	71.1	7.8e-98
WP_089180387.1|2058996_2059752_-|tail	phage minor tail protein L	tail	F1C574	Cronobacter_phage	68.1	4.1e-97
WP_089180388.1|2059760_2060102_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	55.7	9.7e-30
WP_089180389.1|2060143_2063119_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	46.9	1.5e-211
WP_089180390.1|2063158_2063413_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	68.8	8.8e-20
WP_089180391.1|2063460_2063814_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	55.3	2.5e-28
WP_089180392.1|2063859_2064516_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	66.2	1.3e-70
WP_158523422.1|2064559_2064973_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	43.5	2.3e-25
WP_089180394.1|2064969_2065554_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	57.8	3.3e-54
WP_089180395.1|2065555_2065906_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	65.8	2.1e-32
WP_089180396.1|2065908_2066391_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	58.8	5.9e-49
WP_048795441.1|2066839_2067979_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.2	1.4e-157
WP_089180397.1|2068074_2068827_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	75.6	5.2e-100
WP_089180398.1|2068931_2070044_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.5	4.3e-119
WP_089180399.1|2070049_2071438_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	74.4	1.7e-197
WP_089180400.1|2071443_2072748_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.5	4.4e-147
WP_089180526.1|2072728_2073745_-|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	37.2	5.3e-31
WP_089180401.1|2073917_2074211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180402.1|2074308_2074533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180403.1|2074630_2074912_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	83.9	3.6e-38
WP_089180404.1|2075035_2075233_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	72.1	6.4e-18
WP_089180406.1|2075385_2075772_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_089180407.1|2075768_2076392_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	62.6	4.2e-71
WP_049273114.1|2076395_2076731_-|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	45.2	1.7e-18
WP_047730604.1|2076797_2077520_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	68.1	3.3e-88
WP_089180527.1|2077689_2078379_-	antitermination protein	NA	NA	NA	NA	NA
WP_049194162.1|2078378_2078660_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	86.8	9.1e-42
WP_089180408.1|2078664_2079261_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	82.7	3.7e-93
WP_089180409.1|2079303_2079576_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.2	1.4e-18
WP_089180410.1|2079585_2079819_-	DinI-like family protein	NA	H6WRY5	Salmonella_phage	55.8	3.1e-19
WP_089180528.1|2080184_2080751_-	hypothetical protein	NA	A0A2I7R795	Vibrio_phage	42.3	5.7e-11
WP_089180411.1|2080750_2081146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180412.1|2081183_2081720_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	53.4	3.5e-42
WP_158523423.1|2081628_2082741_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	43.2	1.2e-25
WP_089180413.1|2082804_2082999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180529.1|2083025_2083919_-	site-specific DNA-methyltransferase	NA	M4R1Z8	Salicola_phage	57.7	3.1e-96
WP_089180414.1|2083981_2084224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180415.1|2084242_2084809_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	42.0	2.6e-19
WP_089180530.1|2084811_2085039_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.2	3.8e-14
WP_089180416.1|2085147_2085531_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	64.3	6.6e-19
WP_117188020.1|2085966_2086101_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_158523424.1|2086177_2086336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158523425.1|2086319_2086484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048796132.1|2086620_2086854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072270454.1|2086850_2087081_+	hypothetical protein	NA	Q24LE4	Clostridium_phage	43.9	1.4e-08
WP_145957002.1|2087241_2090454_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	41.1	8.0e-142
WP_089180417.1|2090465_2091584_+	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	46.6	3.2e-61
WP_085337747.1|2091577_2091763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180418.1|2091826_2092039_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	59.2	3.6e-19
WP_089180419.1|2092038_2093313_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	59.7	4.6e-149
>prophage 3
NZ_CP018930	Serratia marcescens strain UMH12 chromosome, complete genome	5196805	2266482	2308686	5196805	coat,tail,holin,terminase,integrase,head	Cronobacter_phage(32.61%)	64	2265994:2266017	2308720:2308743
2265994:2266017	attL	GCCCAGTCCGGCTTGTTAAGGATA	NA	NA	NA	NA
WP_089180428.1|2266482_2268381_-	SGNH/GDSL hydrolase family protein	NA	W0TW81	Staphylococcus_phage	42.0	1.3e-38
WP_089180429.1|2268381_2270874_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	55.4	2.0e-257
WP_089180532.1|2270821_2271226_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	64.7	3.3e-45
WP_089180430.1|2271245_2271716_-	DUF1833 domain-containing protein	NA	R9TPR6	Aeromonas_phage	58.8	8.3e-48
WP_089180431.1|2271716_2272184_-	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.5	1.2e-51
WP_089180432.1|2272293_2272464_+	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_158523426.1|2272466_2272634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180433.1|2272655_2276045_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	49.0	4.0e-184
WP_089180434.1|2276107_2276512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180435.1|2276606_2276885_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_089180436.1|2277038_2277929_+	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	59.1	9.1e-88
WP_089180437.1|2278078_2278810_-	transcriptional regulator	NA	A0A0P0ZD96	Stx2-converting_phage	65.6	6.2e-42
WP_089180533.1|2278889_2279543_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	52.1	7.2e-58
WP_110653875.1|2279589_2279757_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060436142.1|2279887_2280334_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_089180438.1|2280375_2281050_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	56.7	6.7e-67
WP_089180439.1|2281101_2281860_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	76.4	4.1e-81
WP_089180440.1|2281884_2282268_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	64.6	1.2e-44
WP_089180441.1|2282264_2282633_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	7.9e-46
WP_089180442.1|2282634_2282982_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	59.5	1.7e-29
WP_089180443.1|2283076_2283454_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	78.5	7.9e-49
WP_089180444.1|2283456_2283858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089180445.1|2283867_2284944_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	75.1	1.0e-154
WP_089180446.1|2284954_2285392_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.1	1.3e-42
WP_089180447.1|2285395_2286781_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.4	1.2e-155
WP_089180534.1|2286811_2287699_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.3	2.0e-106
WP_089180448.1|2287766_2289194_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	64.7	4.0e-170
WP_089180449.1|2289204_2290695_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	80.9	1.3e-240
WP_089180450.1|2290698_2291142_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	71.6	1.3e-47
WP_089180451.1|2291173_2291824_-	hypothetical protein	NA	I6S676	Salmonella_phage	74.8	2.1e-89
WP_049188543.1|2291855_2292104_-	DUF2560 family protein	NA	NA	NA	NA	NA
WP_089180452.1|2292181_2292466_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	66.0	2.4e-26
WP_089180453.1|2292462_2292990_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	51.9	1.8e-30
WP_089180454.1|2292986_2293598_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	60.3	1.2e-67
WP_049202679.1|2293594_2293903_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	40.9	4.8e-12
WP_049202652.1|2293916_2294294_-	membrane protein	NA	F1C592	Cronobacter_phage	50.8	7.9e-25
WP_089180455.1|2294577_2295408_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	53.3	4.9e-75
WP_089180456.1|2295404_2295761_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	70.3	1.1e-44
WP_089180457.1|2295757_2296732_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	37.9	2.7e-61
WP_089180458.1|2296728_2297751_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	78.4	7.1e-44
WP_089180459.1|2297747_2297930_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046688406.1|2298270_2298564_-	hypothetical protein	NA	I6PCV6	Cronobacter_phage	43.8	2.1e-09
WP_089180535.1|2298581_2298830_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	48.7	7.3e-11
WP_121976243.1|2299099_2299669_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	55.0	6.8e-44
WP_064505240.1|2300141_2300300_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	52.3	1.3e-05
WP_089180460.1|2300317_2300566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180461.1|2300987_2301200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154582428.1|2301193_2301337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180462.1|2301340_2302126_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.0	4.2e-60
WP_089180463.1|2302559_2302814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180464.1|2302810_2303488_+	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	48.9	5.6e-53
WP_089180465.1|2303484_2304240_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	79.3	7.9e-125
WP_089180466.1|2304242_2304527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047025459.1|2304523_2304709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180467.1|2304698_2305208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180468.1|2305209_2305539_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	79.0	2.1e-45
WP_089180469.1|2305535_2305838_+	hypothetical protein	NA	A0A193GYX5	Enterobacter_phage	68.2	6.2e-12
WP_004940162.1|2305895_2306156_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	57.9	1.0e-18
WP_089180470.1|2306165_2306420_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.9	3.2e-22
WP_089180471.1|2306490_2306712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180472.1|2306704_2306914_+	hypothetical protein	NA	E5AGD4	Erwinia_phage	51.5	2.1e-11
WP_042784857.1|2306910_2307102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089180473.1|2307120_2307369_+	excisionase family protein	NA	S4TND0	Salmonella_phage	58.3	2.3e-17
WP_089180474.1|2307402_2308686_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	57.6	6.0e-141
2308720:2308743	attR	GCCCAGTCCGGCTTGTTAAGGATA	NA	NA	NA	NA
>prophage 4
NZ_CP018930	Serratia marcescens strain UMH12 chromosome, complete genome	5196805	3203901	3210995	5196805		Salmonella_phage(33.33%)	10	NA	NA
WP_049209511.1|3203901_3204255_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	46.2	3.6e-19
WP_060434427.1|3204455_3204686_+	hypothetical protein	NA	J9Q735	Salmonella_phage	49.3	4.2e-13
WP_049296088.1|3204699_3205245_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	5.9e-45
WP_025159568.1|3205252_3205954_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3206226_3206742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3206775_3207024_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_016926727.1|3207071_3208361_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	3.5e-64
WP_004941642.1|3208437_3209064_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3209319_3210357_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_021504400.1|3210356_3210995_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	4.2e-26
>prophage 5
NZ_CP018930	Serratia marcescens strain UMH12 chromosome, complete genome	5196805	4171564	4180491	5196805		environmental_Halophage(16.67%)	7	NA	NA
WP_060448456.1|4171564_4173643_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_025304519.1|4173683_4174901_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.3	1.5e-27
WP_025304520.1|4175032_4175608_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	4.0e-68
WP_060448457.1|4175680_4177204_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_025304522.1|4177355_4178081_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_043138870.1|4178080_4179766_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	1.2e-224
WP_025304524.1|4179921_4180491_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.0	1.7e-07
