The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	1304712	1339125	5192910	integrase,head,capsid,terminase,plate,portal,tail	Enterobacteria_phage(38.71%)	40	1304268:1304287	1339955:1339974
1304268:1304287	attL	GGCGAAAGCCTCCCTTTTTT	NA	NA	NA	NA
WP_089191512.1|1304712_1305867_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	97.1	8.5e-211
WP_089191513.1|1306017_1307199_+|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	70.1	6.5e-158
WP_060436783.1|1307199_1307715_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.8e-56
WP_089191514.1|1307773_1308073_+|tail	phage tail protein	tail	B9A7B2	Serratia_phage	92.9	7.4e-42
WP_072055827.1|1308081_1308246_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	62.2	3.7e-11
WP_089191515.1|1308235_1311205_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	99.5	4.4e-296
WP_048233367.1|1311219_1311711_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	4.8e-54
WP_089191516.1|1311818_1312901_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	51.8	2.2e-35
WP_145957760.1|1312935_1313682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191518.1|1313686_1315837_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	39.7	3.6e-106
WP_089191519.1|1315838_1316441_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	51.5	2.1e-43
WP_089191520.1|1316433_1317333_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	62.9	1.3e-94
WP_048233373.1|1317319_1317688_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	53.9	1.7e-27
WP_089191521.1|1317684_1318269_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	3.7e-61
WP_089191522.1|1318268_1318907_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	49.3	9.6e-47
WP_089191523.1|1318903_1319365_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.3	2.7e-35
WP_089191524.1|1319506_1319890_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_089191525.1|1319886_1320441_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.1	3.2e-30
WP_049200211.1|1320437_1320719_-	hypothetical protein	NA	B9A7B8	Serratia_phage	100.0	8.2e-35
WP_033640714.1|1320709_1320910_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	6.1e-16
WP_089191526.1|1320909_1321407_-|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	98.2	2.8e-86
WP_089191527.1|1321510_1322380_-|terminase	terminase	terminase	B9A7B6	Serratia_phage	97.8	2.2e-118
WP_089191528.1|1322424_1323471_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.8	1.4e-108
WP_089191529.1|1323510_1324344_-|capsid	phage capsid protein	capsid	B9A7B4	Serratia_phage	85.2	8.8e-125
WP_089191530.1|1324503_1326225_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	64.6	1.3e-223
WP_033640705.1|1326226_1327282_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	3.1e-143
WP_072271151.1|1327703_1329929_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_048233398.1|1329947_1331075_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.3	3.3e-18
WP_145957761.1|1331210_1333583_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	51.1	6.0e-187
WP_089191532.1|1333579_1334446_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	47.4	3.1e-64
WP_072062304.1|1334442_1334667_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	55.6	6.4e-14
WP_089191533.1|1334815_1335016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191534.1|1335334_1335814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191535.1|1335806_1336148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048233408.1|1336256_1336520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048233410.1|1336516_1336729_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	66.7	1.7e-16
WP_048233866.1|1336740_1337010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191536.1|1337097_1337397_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	52.6	2.9e-22
WP_089191537.1|1337514_1338132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191538.1|1338141_1339125_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	50.3	1.4e-89
1339955:1339974	attR	GGCGAAAGCCTCCCTTTTTT	NA	NA	NA	NA
>prophage 2
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	1509774	1536813	5192910	coat,protease	Moraxella_phage(50.0%)	25	NA	NA
WP_046686934.1|1509774_1511193_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_033642834.1|1511339_1511549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033638276.1|1512328_1512721_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_089191602.1|1512725_1513325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033652110.1|1513380_1513620_-	YebV family protein	NA	NA	NA	NA	NA
WP_089192594.1|1513754_1514687_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089192595.1|1514706_1517049_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_089191603.1|1517200_1517968_-	molecular chaperone	NA	NA	NA	NA	NA
WP_033642838.1|1517988_1518531_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_089191604.1|1518524_1519028_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_046686938.1|1519030_1519567_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_033642841.1|1519840_1520377_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_089191605.1|1520642_1522079_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033644262.1|1522181_1524812_-	PqiB family protein	NA	NA	NA	NA	NA
WP_047026336.1|1524780_1526028_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033642843.1|1526283_1526781_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|1526877_1527588_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|1527607_1529656_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_033642846.1|1529722_1530568_-	DMT family transporter	NA	NA	NA	NA	NA
WP_089191606.1|1530564_1531872_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_072627726.1|1531864_1532662_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_047026224.1|1532649_1533435_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	8.8e-10
WP_033652483.1|1533431_1534472_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_042784331.1|1534474_1535566_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652481.1|1535934_1536813_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	1550554	1623148	5192910	tRNA,integrase,holin,head,transposase,terminase,protease,tail	Salmonella_phage(30.77%)	88	1547222:1547240	1596879:1596897
1547222:1547240	attL	GCGGGGCATAAAAAAACCG	NA	NA	NA	NA
WP_089191615.1|1550554_1551835_-|protease	protease	protease	NA	NA	NA	NA
WP_025302601.1|1552020_1552581_+	membrane protein	NA	NA	NA	NA	NA
WP_033642864.1|1552616_1553486_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_089191616.1|1553726_1554581_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_016927980.1|1554580_1555441_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_089191617.1|1555440_1556331_-	manganese/iron ABC transporter ATP-binding protein	NA	A0A1V0SKJ1	Klosneuvirus	28.1	2.5e-08
WP_033642867.1|1556327_1557272_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033642868.1|1557403_1557703_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_004931439.1|1557812_1558478_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	46.3	1.0e-06
WP_033652465.1|1558782_1559508_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_004931432.1|1559510_1561292_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_033642870.1|1561304_1562642_+	cytochrome c	NA	NA	NA	NA	NA
WP_089191618.1|1562897_1564181_+	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_047026214.1|1564331_1565465_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033652461.1|1565501_1566191_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_089191619.1|1566298_1566526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033642876.1|1566749_1567799_+	YrzE family protein	NA	NA	NA	NA	NA
WP_047026212.1|1568038_1568662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191620.1|1569011_1570214_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	58.8	7.1e-136
WP_089191621.1|1570177_1570426_-	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.0	1.6e-13
WP_089191623.1|1570608_1571256_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	74.9	7.8e-89
WP_089191624.1|1571252_1571441_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060451515.1|1571666_1571885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154641072.1|1571927_1572071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191627.1|1572608_1572824_-	molecular chaperone DnaJ	NA	R9TNC2	Aeromonas_phage	78.6	4.2e-23
WP_060706286.1|1572837_1573092_-	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	45.7	3.6e-13
WP_089191628.1|1573093_1573735_-	hypothetical protein	NA	R9W086	Serratia_phage	38.0	9.1e-21
WP_060435816.1|1573734_1573974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191629.1|1573970_1574282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191630.1|1574244_1574889_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	46.8	1.8e-45
WP_089191631.1|1574885_1575419_-	hypothetical protein	NA	J9Q748	Salmonella_phage	64.6	6.7e-62
WP_089191632.1|1575957_1576743_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.0	7.9e-59
WP_089191633.1|1576941_1577703_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.7	5.0e-34
WP_089191634.1|1577699_1579199_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_089191635.1|1579298_1579511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060425670.1|1580025_1580277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071883875.1|1580896_1581490_-	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	59.2	1.2e-14
WP_060706484.1|1581600_1581813_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	73.9	5.4e-23
WP_060706485.1|1581838_1582129_+	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	39.4	2.8e-06
WP_060706486.1|1582242_1582566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192596.1|1582760_1583405_+	phage regulatory protein/antirepressor Ant	NA	A0A2I7RHG4	Vibrio_phage	48.8	4.3e-47
WP_065426409.1|1583407_1583584_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	51.0	1.4e-08
WP_158524424.1|1584662_1585637_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	41.2	1.4e-68
WP_089191638.1|1585633_1585828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191639.1|1585824_1586253_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	73.3	1.4e-46
WP_158524425.1|1586372_1586609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033637976.1|1586915_1587233_+|holin	holin	holin	F1C5D1	Cronobacter_phage	82.8	8.7e-41
WP_089191640.1|1587219_1587660_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	68.3	1.3e-47
WP_089191641.1|1587656_1588037_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_158524426.1|1588351_1589233_+|protease	serine protease	protease	S5FV10	Shigella_phage	56.6	6.8e-59
WP_089191644.1|1589815_1590238_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	69.8	1.3e-44
WP_089191645.1|1590230_1591478_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	95.6	9.8e-213
WP_089191646.1|1591499_1592828_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	76.6	1.2e-200
WP_089191647.1|1592811_1593738_+|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	62.5	4.9e-108
WP_089191648.1|1593741_1595007_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	77.7	1.2e-189
WP_049188535.1|1595019_1595466_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.5	1.7e-63
WP_089191649.1|1595483_1596560_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	88.0	2.0e-185
WP_089191650.1|1596569_1596863_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	78.4	8.3e-38
WP_089191651.1|1596929_1597328_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	84.0	7.2e-61
1596879:1596897	attR	CGGTTTTTTTATGCCCCGC	NA	NA	NA	NA
WP_089191653.1|1597499_1597847_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	59.1	4.3e-33
WP_089191654.1|1597849_1598248_+	HK97 gp10 family phage protein	NA	A0A1W6DXX3	Salmonella_phage	58.3	8.1e-36
WP_089191655.1|1598244_1598628_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	50.4	7.5e-31
WP_041033806.1|1598688_1599438_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	55.2	2.3e-63
WP_060429459.1|1599645_1600155_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	69.0	1.5e-63
WP_089191656.1|1600193_1600874_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.5	5.9e-63
WP_089191657.1|1601075_1601279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957765.1|1601282_1602119_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	43.8	2.0e-52
WP_158524427.1|1602204_1602408_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_060660822.1|1602515_1602716_+	lipoprotein	NA	NA	NA	NA	NA
WP_089191660.1|1602827_1603214_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	56.7	1.4e-32
WP_089191661.1|1603583_1606049_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	40.7	2.2e-75
WP_089191662.1|1606063_1606294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089191663.1|1606336_1606804_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	63.5	9.4e-52
WP_089191664.1|1606804_1607275_+	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	57.5	4.6e-46
WP_089192597.1|1607294_1607699_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	64.7	8.7e-46
WP_089191665.1|1607646_1610139_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	55.3	6.2e-259
WP_089191666.1|1610139_1612446_+	hypothetical protein	NA	A0A1B1W279	Salmonella_phage	60.9	8.1e-11
WP_060451534.1|1612446_1613352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033637997.1|1613497_1613920_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_089191667.1|1613919_1615188_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.3	4.4e-176
WP_089191668.1|1615184_1615892_-	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	57.3	3.3e-72
WP_025159696.1|1616159_1618088_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_048233542.1|1618091_1618643_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|1618741_1618939_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|1618982_1619339_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_147880682.1|1619405_1619501_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931416.1|1619762_1620746_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_033642878.1|1620760_1623148_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	24.0	3.1e-05
>prophage 4
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	2072829	2113756	5192910	lysis,tRNA,integrase,head,terminase	Edwardsiella_phage(20.0%)	49	2064382:2064396	2116585:2116599
2064382:2064396	attL	GCGGCGATCGACGCC	NA	NA	NA	NA
WP_089191829.1|2072829_2073282_-	hypothetical protein	NA	A0A0M4RTP2	Salmonella_phage	51.2	2.9e-13
WP_145957769.1|2073281_2074961_-	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	53.2	5.8e-27
WP_089191830.1|2074962_2075550_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.7	2.7e-35
WP_089191831.1|2075551_2076799_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.2	1.0e-100
WP_038875867.1|2076795_2077152_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.0	9.1e-23
WP_089191832.1|2077160_2077838_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	39.4	6.2e-36
WP_089191833.1|2077839_2078685_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.2	1.9e-34
WP_047730622.1|2078681_2078984_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.5	1.3e-25
WP_060432110.1|2078983_2079790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191834.1|2079786_2081673_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	51.2	1.3e-51
WP_049194151.1|2081887_2082292_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.5	4.1e-19
WP_038875737.1|2082291_2082729_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	38.1	2.3e-20
WP_089191835.1|2082728_2084213_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.2	1.3e-91
WP_089191836.1|2084193_2084745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038875746.1|2084729_2085095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191837.1|2085091_2085571_-	hypothetical protein	NA	I6ZXX4	Escherichia_phage	30.5	6.6e-08
WP_038875751.1|2085571_2086042_-	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	37.0	4.8e-11
WP_089191838.1|2086045_2086390_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	40.5	2.6e-14
WP_038875757.1|2086393_2087422_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.7	1.2e-83
WP_038875760.1|2087421_2087904_-	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	51.5	3.0e-29
WP_089191839.1|2087905_2089231_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	40.9	1.0e-71
WP_089192607.1|2089234_2089918_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	2.4e-56
WP_089191840.1|2089958_2091497_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.5	1.5e-98
WP_089191841.1|2091496_2092909_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.9	1.4e-186
WP_089191842.1|2092838_2093864_-|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	49.5	1.0e-50
WP_089191843.1|2094286_2094673_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_089191844.1|2094669_2095200_-	lysozyme	NA	H9C184	Pectobacterium_phage	84.0	1.8e-83
WP_089191845.1|2095199_2095463_-|lysis	lysis protein	lysis	Q7Y3V4	Yersinia_phage	51.7	1.6e-19
WP_089191846.1|2095948_2096161_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	79.1	5.4e-23
WP_089191847.1|2096669_2097506_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	48.9	1.2e-62
WP_089191848.1|2097502_2097787_-	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	77.7	4.0e-37
WP_089191849.1|2097786_2098380_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	83.6	1.4e-92
WP_089191850.1|2098422_2098662_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	64.7	8.3e-20
WP_089191851.1|2100037_2100688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191852.1|2100832_2101213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191853.1|2101228_2101969_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	73.0	7.3e-99
WP_089191854.1|2101983_2102823_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	48.5	7.1e-58
WP_089192608.1|2102822_2103716_-	site-specific DNA-methyltransferase	NA	M4R1Z8	Salicola_phage	57.3	3.1e-96
WP_089191855.1|2103778_2104021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047730594.1|2104036_2104498_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	44.0	1.1e-17
WP_038875813.1|2104508_2104754_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	80.3	3.6e-26
WP_089191856.1|2104857_2105244_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	58.9	3.0e-35
WP_141969484.1|2105889_2106183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957770.1|2106700_2109928_+	hypothetical protein	NA	H6WRX1	Salmonella_phage	38.2	5.0e-144
WP_089191858.1|2109939_2111058_+	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	46.9	7.0e-61
WP_089191859.1|2111051_2111237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730590.1|2111300_2111513_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	59.2	4.8e-19
WP_089191860.1|2111512_2112769_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	61.0	1.2e-149
WP_089191861.1|2112817_2113756_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	92.6	3.9e-137
2116585:2116599	attR	GCGGCGATCGACGCC	NA	NA	NA	NA
>prophage 5
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	2888869	2909806	5192910	tail,holin	Klebsiella_phage(27.78%)	23	NA	NA
WP_089192039.1|2888869_2890891_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	47.3	8.9e-30
WP_089192040.1|2890887_2892045_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	57.8	1.1e-43
WP_089192041.1|2892095_2895683_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	66.0	0.0e+00
WP_042785075.1|2895736_2896342_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.4	2.2e-53
WP_127554718.1|2896375_2896708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192042.1|2896745_2897450_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	75.7	6.3e-108
WP_089192623.1|2897459_2898209_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.5	3.8e-95
WP_004935824.1|2898221_2898560_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
WP_089192043.1|2898559_2901184_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	28.5	3.0e-14
WP_004935830.1|2901083_2901305_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_025160180.1|2901322_2901688_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	6.5e-24
WP_033652513.1|2901814_2902270_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.5e-57
WP_089192044.1|2902310_2902703_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.0	6.1e-20
WP_089192045.1|2902699_2903089_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	41.3	1.4e-24
WP_042785079.1|2903146_2903587_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	3.4e-43
WP_033652509.1|2903573_2903894_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	1.1e-40
WP_042785760.1|2904795_2905158_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	6.0e-38
WP_089192046.1|2905400_2906078_+	S26 family signal peptidase	NA	K7PK07	Enterobacteria_phage	29.6	3.2e-08
WP_004935874.1|2906496_2906826_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_089192047.1|2906953_2907421_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_033651920.1|2907529_2908108_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089192048.1|2908101_2908518_-	glyoxalase	NA	NA	NA	NA	NA
WP_089192049.1|2908675_2909806_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.4e-104
>prophage 6
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	3184527	3191621	5192910		Salmonella_phage(33.33%)	10	NA	NA
WP_033644018.1|3184527_3184881_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	47.0	1.6e-19
WP_033644019.1|3185081_3185312_+	hypothetical protein	NA	J9Q735	Salmonella_phage	50.7	4.2e-13
WP_047025631.1|3185325_3185865_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	56.6	4.0e-46
WP_025159568.1|3185878_3186580_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_016926729.1|3186852_3187368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016926728.1|3187401_3187650_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_033651534.1|3187697_3188987_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.2	6.0e-64
WP_004941642.1|3189063_3189690_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025303843.1|3189945_3190983_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.9	3.8e-69
WP_033651535.1|3190982_3191621_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	39.2	3.2e-26
>prophage 7
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	3262962	3307090	5192910	integrase,holin,transposase,terminase,tail	Enterobacter_phage(21.05%)	50	3282411:3282427	3306061:3306077
WP_089192137.1|3262962_3263196_-|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_089192138.1|3263227_3265828_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	35.8	4.8e-52
WP_050438967.1|3266014_3266263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957774.1|3266385_3266685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192139.1|3266691_3270081_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	5.2e-184
WP_089192140.1|3270080_3271601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191633.1|3271732_3272494_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.7	5.0e-34
WP_089191634.1|3272490_3273990_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_145957775.1|3274076_3275252_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.3	2.2e-81
WP_089192142.1|3275261_3275831_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	46.7	2.8e-29
WP_089192143.1|3275823_3276297_-	hypothetical protein	NA	Q858G2	Salmonella_phage	66.0	1.1e-52
WP_089192144.1|3276296_3278798_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.5	3.6e-307
WP_033648873.1|3278797_3279406_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
WP_089192145.1|3279405_3279729_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	54.9	3.5e-21
WP_089192627.1|3279768_3280056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192146.1|3280076_3280523_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	57.4	6.1e-32
WP_060450525.1|3280576_3281560_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	74.0	1.1e-139
WP_089192147.1|3281566_3282277_-	peptidase	NA	G9L6C4	Escherichia_phage	59.4	2.0e-45
3282411:3282427	attL	AGAAGCGGATGCCGCCG	NA	NA	NA	NA
WP_089192628.1|3282519_3282816_-	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	9.3e-29
WP_075685980.1|3282815_3284501_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.3	8.1e-186
WP_089192148.1|3285044_3285233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089192629.1|3285243_3285681_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	55.0	4.7e-37
WP_089192149.1|3285706_3287194_-|terminase	terminase	terminase	W6MW26	Pseudomonas_phage	71.8	4.7e-214
WP_089192150.1|3287186_3287669_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	37.9	3.7e-19
WP_089192151.1|3287775_3288033_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	51.8	1.6e-16
WP_089192152.1|3288105_3288492_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	35.1	7.9e-12
WP_089192153.1|3289174_3289483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192154.1|3289485_3290070_-	hypothetical protein	NA	R9W086	Serratia_phage	37.4	7.7e-19
WP_145957776.1|3290391_3290580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089192155.1|3290572_3290986_-	hypothetical protein	NA	A0A2R3UAL4	Myoviridae_environmental_samples	55.0	1.3e-28
WP_033648893.1|3291679_3291892_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	50.8	4.0e-10
WP_089192156.1|3291894_3292365_-	hypothetical protein	NA	A0A193GYM2	Enterobacter_phage	75.5	2.8e-59
WP_049234889.1|3292574_3293018_-	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	38.1	2.6e-19
WP_033632341.1|3293948_3294155_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.0	2.5e-09
WP_033648895.1|3294297_3294516_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	1.5e-15
WP_033632339.1|3294664_3295261_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	51.8	7.3e-49
WP_072270178.1|3295535_3295688_+	DUF2985 domain-containing protein	NA	T1SA20	Salmonella_phage	50.0	1.6e-05
WP_089192157.1|3295684_3296731_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.5	5.1e-37
WP_089192158.1|3296738_3297044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089192159.1|3297043_3297865_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	78.3	4.6e-126
WP_089192160.1|3297861_3298467_+	recombinase RecT	NA	E5AGD9	Erwinia_phage	68.7	3.1e-71
WP_089191634.1|3298497_3299997_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_089191633.1|3299993_3300755_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.7	5.0e-34
WP_145957777.1|3300802_3301162_+	hypothetical protein	NA	A0A193GYL3	Enterobacter_phage	60.9	3.5e-30
WP_089192162.1|3301202_3301454_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	48.8	7.1e-14
WP_089192163.1|3301571_3302234_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	66.0	3.3e-82
WP_089192164.1|3302230_3302515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050438971.1|3302518_3303721_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	69.5	1.3e-156
WP_021504498.1|3303945_3305523_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004941460.1|3305626_3307090_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	2.0e-87
3306061:3306077	attR	AGAAGCGGATGCCGCCG	NA	NA	NA	NA
>prophage 8
NZ_CP018926	Serratia marcescens strain UMH6 chromosome, complete genome	5192910	4173383	4182310	5192910		environmental_Halophage(16.67%)	7	NA	NA
WP_089192321.1|4173383_4175462_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_089192322.1|4175502_4176720_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.9	4.7e-26
WP_033645386.1|4176851_4177427_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_033645261.1|4177499_4179023_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_025304522.1|4179174_4179900_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_033651731.1|4179899_4181585_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	1.5e-224
WP_033636286.1|4181740_4182310_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
