The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	484402	492088	5334660		uncultured_Caudovirales_phage(16.67%)	9	NA	NA
WP_001036848.1|484402_485386_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
WP_000403761.1|485375_486146_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_048533848.1|486178_486943_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|487015_487339_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255973.1|487634_488834_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_001014310.1|488872_489067_-	YwbE family protein	NA	NA	NA	NA	NA
WP_000018029.1|489409_490102_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_061138927.1|490103_491039_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	2.0e-21
WP_000221066.1|491164_492088_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 2
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	1277024	1287595	5334660	bacteriocin	uncultured_Caudovirales_phage(45.45%)	14	NA	NA
WP_033683142.1|1277024_1277684_-	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
WP_000283431.1|1277888_1278101_+	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_048567458.1|1278303_1279062_+	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.8	5.4e-97
WP_001189064.1|1279073_1279268_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_048567460.1|1279420_1280308_+	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	66.6	7.4e-98
WP_000464424.1|1280716_1281103_+	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	2.2e-46
WP_030027273.1|1281341_1282310_+	lysozyme family protein	NA	A0A1W6JSC2	Bacillus_phage	45.5	1.5e-30
WP_030027267.1|1282557_1283379_+	M23 family metallopeptidase	NA	A0A2H4J669	uncultured_Caudovirales_phage	33.9	7.8e-09
WP_030027266.1|1283447_1284443_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KCJ1	Bacillus_phage	47.5	1.5e-78
WP_030027264.1|1284616_1284847_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	80.3	1.1e-26
WP_001102627.1|1285219_1285543_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000031383.1|1285535_1286078_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000976240.1|1286078_1286882_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000413738.1|1286974_1287595_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
>prophage 3
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	2293510	2362116	5334660	tail,capsid,holin,integrase,head,terminase,bacteriocin,portal,protease	Bacillus_phage(82.5%)	71	2299779:2299795	2362389:2362405
WP_078405499.1|2293510_2293843_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	45.6	2.4e-17
WP_001987738.1|2293979_2295239_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.2e-24
WP_000120182.1|2295340_2295448_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000556362.1|2295584_2296385_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001182506.1|2296377_2298078_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.5	1.8e-15
WP_001038208.1|2298088_2298637_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000864394.1|2299046_2299727_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
2299779:2299795	attL	TATTTATCCCGCTATTT	NA	NA	NA	NA
WP_000932142.1|2299821_2301009_-	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.6	2.4e-06
WP_000765191.1|2301268_2301799_-	signal peptidase I	NA	NA	NA	NA	NA
WP_061139229.1|2301875_2304002_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_001088567.1|2304236_2306024_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_000766385.1|2306475_2307327_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000954437.1|2307502_2308081_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_061139230.1|2308189_2309404_-	cytochrome P450	NA	NA	NA	NA	NA
WP_000289122.1|2309544_2310042_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000046095.1|2310144_2310300_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_001069249.1|2310370_2311003_-	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000106395.1|2310992_2312276_-	MFS transporter	NA	NA	NA	NA	NA
WP_000062129.1|2312543_2313779_-	cytochrome P450	NA	NA	NA	NA	NA
WP_000282680.1|2313939_2314344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565683.1|2314489_2315494_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000416828.1|2315702_2315915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000878372.1|2316243_2316447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000732183.1|2317123_2317891_-	DUF3959 family protein	NA	NA	NA	NA	NA
WP_061139231.1|2318098_2319781_-	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_061139233.1|2321134_2321836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139234.1|2322115_2323051_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	95.5	8.2e-180
WP_061139235.1|2323050_2323476_-|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	3.1e-70
WP_061139236.1|2323515_2327547_-	hypothetical protein	NA	W8CYT7	Bacillus_phage	92.1	0.0e+00
WP_089455241.1|2327543_2329025_-|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	96.8	2.9e-288
WP_089455242.1|2329039_2332891_-|tail	phage tail tape measure protein	tail	A0A2H4J380	uncultured_Caudovirales_phage	92.1	0.0e+00
WP_000344056.1|2332906_2333083_-	hypothetical protein	NA	Q3HL07	Bacillus_phage	67.2	1.4e-13
WP_000779162.1|2333112_2333430_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	87.6	3.1e-46
WP_000896776.1|2333479_2334085_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.1	2.6e-94
WP_089455243.1|2334085_2334445_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	93.3	5.2e-58
WP_060851857.1|2334441_2334876_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	96.5	9.6e-75
WP_065212684.1|2334868_2335192_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	94.4	7.0e-54
WP_000244589.1|2335178_2335466_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	98.9	2.6e-44
WP_000357562.1|2335486_2336659_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	93.3	7.3e-202
WP_001259165.1|2336696_2337407_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	3.7e-124
WP_061139237.1|2337393_2338647_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	95.4	3.3e-232
WP_061139238.1|2338835_2340530_-|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	98.2	0.0e+00
WP_061139515.1|2340531_2341026_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	97.6	2.4e-85
WP_061139239.1|2341164_2341542_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	95.2	3.2e-66
WP_061139240.1|2341531_2341786_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	90.5	1.1e-38
WP_061139241.1|2341922_2342135_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.3e-29
WP_061139242.1|2342121_2342475_-	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	62.8	3.1e-23
WP_061139243.1|2343275_2344226_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_061139244.1|2344440_2344983_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	88.3	5.8e-85
WP_061139245.1|2344982_2345465_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	4.2e-71
WP_061139246.1|2345761_2345950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071740168.1|2345970_2346093_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_061139247.1|2346139_2346367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139248.1|2346366_2346648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044585247.1|2348640_2348928_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_061139249.1|2351267_2351777_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.3	3.3e-26
WP_000109494.1|2351796_2352048_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	51.3	2.6e-16
WP_000717828.1|2352074_2352242_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	2.3e-13
WP_001125968.1|2352260_2352620_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	51.7	9.2e-31
WP_000799096.1|2352612_2352891_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	61.0	8.7e-13
WP_000337979.1|2352907_2353102_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	89.1	9.7e-27
WP_061139250.1|2353117_2353993_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.5	1.9e-61
WP_061139251.1|2353931_2354678_-	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	79.9	1.4e-78
WP_000522024.1|2355052_2355319_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	1.6e-35
WP_061139252.1|2355534_2355831_-	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	1.1e-08
WP_000425256.1|2356014_2356365_+	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	7.4e-17
WP_071740166.1|2356625_2356811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139254.1|2358661_2359771_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.8	4.9e-147
WP_061139255.1|2359839_2360511_-	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_002063155.1|2360820_2361306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001071364.1|2361795_2362116_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
2362389:2362405	attR	AAATAGCGGGATAAATA	NA	NA	NA	NA
>prophage 4
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	2780984	2835277	5334660	tail,capsid,holin,head,portal,bacteriocin,tRNA	Brevibacillus_phage(22.22%)	52	NA	NA
WP_030025509.1|2780984_2782283_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	38.5	3.1e-76
WP_001167918.1|2782824_2783304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000482274.1|2783411_2784923_-	peptidase M36	NA	NA	NA	NA	NA
WP_000045223.1|2785253_2785838_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061139357.1|2785839_2786925_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_000416540.1|2786976_2790078_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	31.9	4.4e-153
WP_061139358.1|2790464_2794667_-|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_002061249.1|2795044_2795479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000498601.1|2795647_2795866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621475.1|2795895_2796225_-	DUF2085 domain-containing protein	NA	NA	NA	NA	NA
WP_000384929.1|2796337_2798026_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.7	8.9e-76
WP_061139359.1|2798326_2799103_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000063706.1|2799152_2799587_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000634887.1|2799670_2800054_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_000692580.1|2800057_2801185_-	PBS lyase	NA	NA	NA	NA	NA
WP_000383793.1|2801476_2801800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000982015.1|2802282_2802618_-	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	61.4	6.3e-34
WP_000975131.1|2802779_2803034_-	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_001260655.1|2803138_2803870_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_061139360.1|2803945_2805841_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	8.8e-56
WP_000165966.1|2805837_2806485_-	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	2.5e-10
WP_000499720.1|2806594_2807377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000756629.1|2807799_2808015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139361.1|2808011_2809148_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	41.3	3.3e-74
WP_061139362.1|2809466_2810120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061139363.1|2810471_2811530_-	SH3 domain-containing protein	NA	A0A1B1P7Q1	Bacillus_phage	74.9	1.0e-149
WP_000439588.1|2811609_2812107_-|holin	holin	holin	NA	NA	NA	NA
WP_061139364.1|2812415_2813336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139365.1|2813349_2813733_-	hypothetical protein	NA	G3MAB0	Bacillus_virus	35.7	1.7e-14
WP_061139518.1|2813742_2815218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139366.1|2815229_2817452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139367.1|2817475_2819203_-	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	39.2	1.2e-112
WP_017673857.1|2819216_2820554_-	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	33.8	1.2e-67
WP_017673856.1|2820567_2820945_-	hypothetical protein	NA	A0A0K2CPN7	Brevibacillus_phage	42.5	1.5e-23
WP_061139368.1|2820957_2821332_-	hypothetical protein	NA	A0A0K2CPN7	Brevibacillus_phage	46.2	1.3e-24
WP_017673854.1|2821376_2821760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139369.1|2821770_2823315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139370.1|2823311_2823995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139371.1|2823991_2825998_-	hypothetical protein	NA	A0A1B0T698	Bacillus_phage	44.1	2.1e-15
WP_000879061.1|2826216_2827155_-|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	67.3	2.3e-73
WP_061139372.1|2827189_2827609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139373.1|2827572_2828091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139374.1|2828150_2828753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063397.1|2828765_2829188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139375.1|2829191_2829602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139376.1|2829608_2829980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139377.1|2829976_2830513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869887.1|2830512_2830677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139378.1|2830847_2831834_-|capsid	major capsid protein	capsid	H7BVA6	unidentified_phage	43.6	2.5e-70
WP_061139379.1|2831850_2833053_-	hypothetical protein	NA	A0A1B1IMM2	Lactococcus_phage	34.4	1.4e-38
WP_061139380.1|2833166_2833685_-|head	phage head morphogenesis protein	head	Q1WDG7	Streptomyces_phage	34.4	8.4e-09
WP_061139381.1|2833798_2835277_-|portal	phage portal protein	portal	NA	NA	NA	NA
>prophage 5
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	2847228	2853644	5334660		Bacillus_phage(50.0%)	11	NA	NA
WP_001199851.1|2847228_2847798_+	cupin domain-containing protein	NA	Q2Q459	Bacillus_phage	90.5	5.3e-89
WP_061139391.1|2848662_2849049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139392.1|2849571_2849763_-	DUF3954 domain-containing protein	NA	NA	NA	NA	NA
WP_001125986.1|2849834_2850197_-	hypothetical protein	NA	D2XR47	Bacillus_phage	75.0	8.4e-48
WP_061139393.1|2850207_2851191_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	44.6	3.1e-52
WP_061139394.1|2851308_2851593_-	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	6.0e-25
WP_061139395.1|2851774_2851996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139396.1|2852026_2852542_-	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	24.0	4.4e-10
WP_061139397.1|2852609_2852909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061139398.1|2852935_2853157_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061139399.1|2853299_2853644_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	36.6	5.4e-12
>prophage 6
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	3037546	3045699	5334660		Bacillus_phage(66.67%)	7	NA	NA
WP_001258503.1|3037546_3038419_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	5.6e-66
WP_000818985.1|3038706_3039426_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001231615.1|3039714_3040788_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.5	5.1e-186
WP_000612414.1|3040784_3041462_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_000453865.1|3041547_3043308_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	4.1e-273
WP_001194306.1|3043548_3044313_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755513.1|3044412_3045699_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 7
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	4200364	4208371	5334660		Bacillus_phage(66.67%)	8	NA	NA
WP_000487871.1|4200364_4201816_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	53.8	4.9e-139
WP_000831286.1|4202262_4202607_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000277062.1|4202619_4203150_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.7	5.5e-16
WP_000738867.1|4203283_4204531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565484.1|4204706_4205384_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	8.3e-33
WP_044584134.1|4205395_4206787_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	1.5e-36
WP_000085764.1|4206799_4207321_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_113710808.1|4207396_4208371_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.9	2.7e-16
>prophage 8
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	4557896	4566272	5334660		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088596.1|4557896_4558484_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.5e-27
WP_001262439.1|4558480_4559521_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879032.1|4559626_4561042_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	4.3e-55
WP_000055564.1|4561026_4563246_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000666787.1|4563229_4563913_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|4563909_4564164_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170545.1|4564156_4564876_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|4564964_4566272_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 9
NZ_CP022345	Bacillus thuringiensis strain c25 chromosome, complete genome	5334660	4611896	4619845	5334660		Bacillus_phage(33.33%)	6	NA	NA
WP_000719212.1|4611896_4613402_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.7	1.1e-32
WP_000929884.1|4613385_4614087_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	3.3e-40
WP_000833096.1|4614231_4615557_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000743913.1|4615942_4617481_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_001029993.1|4617887_4619522_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000917311.1|4619560_4619845_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
>prophage 1
NZ_CP022346	Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence	326530	158806	251127	326530	transposase,protease,integrase	Tupanvirus(25.0%)	60	220853:220875	257106:257128
WP_061139796.1|158806_159493_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	55.7	3.8e-65
WP_061139795.1|159536_159911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139794.1|160678_160957_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061139793.1|161072_161432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082770010.1|162897_163158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061139791.1|163695_165126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139790.1|166442_167480_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	31.1	1.2e-33
WP_082769996.1|169600_169813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_061139788.1|171426_172455_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_061139787.1|173740_173959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139786.1|173945_174377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139785.1|174962_176015_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_061139784.1|176069_177260_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_061139783.1|177345_178194_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_061139782.1|178886_180398_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_157462744.1|181399_181489_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_061139781.1|181862_183293_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_082769994.1|184148_184970_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_061139779.1|185038_185185_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_089455265.1|185197_186712_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	9.9e-50
WP_061139673.1|186708_187875_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	NA	NA	NA	NA
WP_089455266.1|187943_188183_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_089455267.1|188179_189358_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_061139990.1|192660_193431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157462756.1|195131_195278_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_157695074.1|195357_195573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061139988.1|197811_198198_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061139987.1|200432_200684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139986.1|200863_201679_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	41.6	1.1e-07
WP_061139985.1|201724_201907_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_061139984.1|202471_203542_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_061139983.1|204596_206339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139982.1|206915_208439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061139981.1|209296_210418_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	28.8	1.7e-14
WP_061139980.1|210499_211798_-	VanW family protein	NA	NA	NA	NA	NA
WP_061139979.1|212014_212863_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061139978.1|213344_214790_+	spore germination protein	NA	NA	NA	NA	NA
WP_061139977.1|214786_215866_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_061139976.1|215872_216973_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_061139975.1|217009_217459_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_061139974.1|219381_220053_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_061139973.1|220276_221710_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
220853:220875	attL	GATTTATGTATCCGAGATTTAGG	NA	NA	NA	NA
WP_082770009.1|223367_223874_-	DinB family protein	NA	NA	NA	NA	NA
WP_061139972.1|223917_227019_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_061139970.1|229340_231248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139969.1|232783_233464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139968.1|233497_235426_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_061139967.1|235400_236171_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	5.6e-33
WP_061139966.1|236301_237285_-	sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	27.4	3.3e-06
WP_061139965.1|237284_237992_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061139964.1|238177_239161_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_061139963.1|239209_239638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061139962.1|240042_240639_-	DedA family protein	NA	NA	NA	NA	NA
WP_061139961.1|241054_241756_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061139960.1|241873_243475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082770013.1|243563_244316_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_061139957.1|246286_247765_+	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_061139956.1|248966_249479_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061139955.1|249500_249851_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_061139954.1|250083_251127_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.7	4.5e-09
257106:257128	attR	GATTTATGTATCCGAGATTTAGG	NA	NA	NA	NA
