The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019338	Pseudomonas aeruginosa strain L10 chromosome, complete genome	6661962	651611	732022	6661962	plate,holin,tail,tRNA	Pseudomonas_phage(37.5%)	85	NA	NA
WP_003137360.1|651611_652637_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	6.3e-109
WP_003085061.1|652715_653285_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|653368_653722_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003137363.1|653712_654255_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003117955.1|654227_655460_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
WP_003137366.1|655503_656010_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|656104_657658_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|657654_658926_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|659026_660949_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|661227_661560_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|661603_662455_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|662454_662835_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|662871_663678_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003137368.1|663793_664780_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|664776_666069_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003137369.1|666049_668824_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003137370.1|668950_669967_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|669963_670638_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|670639_671398_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003137371.1|671398_672460_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003137372.1|672611_675005_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|675050_675683_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003137373.1|675811_676846_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|677079_678189_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|678244_679291_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003137376.1|679405_680653_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|680758_681589_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|681712_682387_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|682386_683205_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|683277_684756_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003137378.1|684942_685257_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003137380.1|685356_686127_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.0e-71
WP_003085132.1|686584_686785_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|686832_687192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|687555_688005_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|688026_688542_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|688538_689096_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|689248_689575_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|689571_690459_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|690451_690985_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003137387.1|690986_693062_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	50.3	3.9e-198
WP_003137388.1|693058_693517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|693559_694720_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|694732_695236_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|695250_695595_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003137390.1|695764_698002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118916.1|698011_698884_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	1.1e-74
WP_003101635.1|698858_699065_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003137392.1|699122_700112_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.8e-106
WP_003129215.1|700144_700774_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003121852.1|700770_701133_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003137395.1|701129_701387_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
WP_003113190.1|701702_702197_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003113189.1|702208_702556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|702585_702840_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003137400.1|702886_704722_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
WP_003113186.1|704714_705056_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|705063_705759_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003137403.1|705761_706532_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003118924.1|706586_707189_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_003137405.1|707247_710907_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	56.3	0.0e+00
WP_016254311.1|711211_711922_+	hypothetical protein	NA	A0A2K9VHT7	Pseudomonas_phage	26.1	1.8e-06
WP_003137407.1|711936_712989_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	50.9	2.9e-64
WP_003113177.1|712988_713291_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_003118930.1|713287_713518_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003117978.1|713936_714542_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|714543_715593_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003137410.1|715589_716426_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.8e-70
WP_003085214.1|716487_717132_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|717403_717826_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003085223.1|718145_718940_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085224.1|718994_719642_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085225.1|719741_720080_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003121853.1|720158_721640_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
WP_003085237.1|721679_722480_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011666538.1|722540_723623_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003137419.1|723744_724713_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085245.1|724729_725152_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003137420.1|725442_726477_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003137421.1|726476_727196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|727196_727619_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|727696_728047_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003137422.1|728100_729192_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003129241.1|729194_730538_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003113167.1|730822_732022_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP019338	Pseudomonas aeruginosa strain L10 chromosome, complete genome	6661962	1496831	1505859	6661962		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1496831_1497467_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003138035.1|1497512_1498406_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1498510_1499515_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1499940_1500264_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003122151.1|1500330_1502898_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092265.1|1503023_1504031_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1504178_1504685_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1504818_1505859_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP019338	Pseudomonas aeruginosa strain L10 chromosome, complete genome	6661962	2683481	2690375	6661962	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003097631.1|2683481_2684762_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003138949.1|2684763_2686161_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003138951.1|2686165_2687140_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|2687227_2688211_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|2688207_2688543_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2688539_2688845_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2688844_2689204_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2689200_2689596_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2689706_2690375_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
NZ_CP019338	Pseudomonas aeruginosa strain L10 chromosome, complete genome	6661962	4857813	4982228	6661962	terminase,holin,integrase,tail,portal,lysis,transposase	Pseudomonas_phage(68.25%)	126	4918103:4918124	4986940:4986961
WP_003140852.1|4857813_4860006_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_003122996.1|4860022_4860646_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_003085828.1|4860733_4861954_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003085826.1|4861957_4862917_-	DegV family protein	NA	NA	NA	NA	NA
WP_003085824.1|4863107_4864220_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003140857.1|4864260_4864851_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140859.1|4865001_4865484_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003085816.1|4865689_4866175_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003109430.1|4866143_4866482_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_003085814.1|4866481_4867666_+	acetate kinase	NA	NA	NA	NA	NA
WP_003085813.1|4867728_4869843_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003085811.1|4869969_4870884_+	acyltransferase	NA	NA	NA	NA	NA
WP_003085808.1|4870953_4871667_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003140862.1|4871772_4872414_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003114220.1|4872515_4873535_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140865.1|4873659_4874493_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003085798.1|4874627_4875569_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
WP_003140867.1|4875677_4876361_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140868.1|4876448_4877327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023099039.1|4877842_4878085_-	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	87.5	3.9e-33
WP_023099040.1|4878081_4878384_-	hypothetical protein	NA	A0A0A0YUD8	Pseudomonas_phage	85.0	1.7e-41
WP_023099041.1|4878954_4879236_-	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	96.8	9.7e-44
WP_023099042.1|4879236_4879797_-	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	96.2	5.2e-97
WP_003159082.1|4879801_4879993_-	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_023099043.1|4879985_4880573_-	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	94.9	1.2e-101
WP_023099044.1|4880604_4882095_-	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	35.8	1.1e-77
WP_023099045.1|4882464_4883208_-	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	57.1	2.7e-24
WP_023099046.1|4883210_4884914_-	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	71.4	2.0e-237
WP_023099047.1|4884913_4885435_-	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	97.7	2.4e-96
WP_058177878.1|4885474_4887958_-	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	97.5	0.0e+00
WP_023099049.1|4888060_4888363_-|tail	phage tail assembly protein	tail	A0A1W6JT80	Pseudomonas_phage	97.0	5.9e-47
WP_023099050.1|4888435_4889188_-	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	98.0	1.1e-134
WP_023099051.1|4889189_4889384_-	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	89.1	1.7e-23
WP_031632590.1|4889387_4889858_-	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	91.0	1.4e-79
WP_031632591.1|4889854_4890133_-	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	52.1	1.7e-16
WP_023099054.1|4890179_4890542_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023117087.1|4890613_4892569_-	hypothetical protein	NA	A0A2I7S8L6	Vibrio_phage	32.1	1.5e-87
WP_023099056.1|4892576_4894103_-|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	36.2	2.0e-74
WP_023099057.1|4894104_4894308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031632594.1|4894307_4896170_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	56.0	1.2e-209
WP_003128031.1|4896234_4896762_-	DNA packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	48.1	4.1e-19
WP_023099059.1|4896893_4897637_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	97.6	6.0e-133
WP_031632596.1|4897633_4898104_-|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	1.1e-68
WP_042951279.1|4898100_4898343_-	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	53.2	6.4e-20
WP_003119045.1|4898339_4898957_-	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	95.1	1.1e-108
WP_003119044.1|4898953_4899289_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_023099114.1|4899742_4900132_-	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	8.3e-70
WP_015648203.1|4900128_4900407_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	100.0	2.3e-45
WP_003119041.1|4900403_4902215_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	70.1	1.8e-260
WP_023099115.1|4902208_4903321_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	53.0	1.1e-26
WP_019486507.1|4903317_4903743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003119039.1|4903739_4904057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019486509.1|4904191_4904548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023093235.1|4904544_4905306_-	hypothetical protein	NA	A0A1W6JTB2	Pseudomonas_phage	33.7	6.3e-21
WP_023099117.1|4905302_4905638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023099118.1|4905630_4905960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033869214.1|4905956_4906253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023099120.1|4906245_4906491_-	hypothetical protein	NA	A0A0A0YQ33	Pseudomonas_phage	60.3	1.1e-11
WP_023099083.1|4906487_4906799_-	hypothetical protein	NA	A0A0A0YUF6	Pseudomonas_phage	91.3	1.7e-44
WP_023099122.1|4907101_4907494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023093230.1|4908025_4908745_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	57.5	1.1e-38
WP_023093229.1|4908835_4909930_+	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	41.2	1.6e-65
WP_023099123.1|4910152_4910536_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	94.1	3.1e-53
WP_021205288.1|4910538_4910772_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
WP_003085694.1|4910871_4911126_+	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_023099124.1|4911122_4911959_+	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.3	3.2e-127
WP_023099127.1|4912878_4913109_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	94.7	4.5e-31
WP_023099128.1|4913111_4913912_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	85.5	6.9e-95
WP_023099129.1|4913908_4914436_+	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	1.2e-50
WP_021205282.1|4914548_4914740_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	98.4	2.0e-29
WP_023099130.1|4914736_4915456_+	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	92.1	1.0e-121
WP_023121756.1|4915448_4915778_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	100.0	2.8e-58
WP_023099131.1|4915920_4917108_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	100.0	6.4e-230
WP_071535537.1|4917088_4917538_-	hypothetical protein	NA	A0A1W6JT96	Pseudomonas_phage	99.2	6.7e-63
WP_124186856.1|4917534_4917948_-	hypothetical protein	NA	A0A1W6JT99	Pseudomonas_phage	100.0	9.8e-69
4918103:4918124	attL	TCAAATCCCCCCGGCTCCACCA	NA	NA	NA	NA
WP_024947374.1|4918308_4919565_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.0	1.2e-109
WP_024947375.1|4919917_4920247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947376.1|4920318_4921287_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.5	8.5e-63
WP_024947377.1|4921366_4922371_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	38.6	7.2e-49
WP_024947378.1|4922461_4923412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947379.1|4923383_4923881_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_024947380.1|4923890_4924070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071535536.1|4924168_4924330_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_053870531.1|4925393_4926881_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	98.6	1.1e-266
WP_024947943.1|4926892_4927744_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	94.7	4.6e-145
WP_024947944.1|4927835_4928369_+	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	96.2	1.4e-67
WP_009684098.1|4928402_4929938_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	45.9	1.6e-116
WP_058177877.1|4929999_4930335_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_009684096.1|4930331_4930664_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_071535535.1|4931261_4932011_-	hydratase	NA	NA	NA	NA	NA
WP_024947381.1|4932007_4933444_-	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_019751962.1|4933598_4934360_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_017736606.1|4934352_4935183_-	allantoinase PuuE	NA	NA	NA	NA	NA
WP_017736607.1|4935272_4936229_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024947382.1|4936225_4937884_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.7	2.3e-07
WP_019818817.1|4937880_4938726_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017736610.1|4938722_4939763_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019751968.1|4939830_4941426_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019751969.1|4941885_4942632_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_089502884.1|4943680_4944830_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	65.9	6.0e-100
WP_014003920.1|4946340_4947321_+|transposase	IS5-like element ISPa41 family transposase	transposase	Q38213	Escherichia_phage	59.2	1.4e-102
WP_060709258.1|4947586_4947910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947260.1|4948021_4948990_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.6	7.2e-62
WP_024947259.1|4949065_4950070_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	45.4	3.7e-45
WP_024947258.1|4950147_4951062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947257.1|4951111_4951609_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_060709260.1|4951891_4952194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078463944.1|4952733_4956648_+	helix-turn-helix domain-containing protein	NA	A0A2K9V2V8	Faecalibacterium_phage	51.7	1.7e-05
WP_125940096.1|4956630_4958133_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_024947255.1|4958207_4960091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024947252.1|4961098_4961299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024947251.1|4961345_4962398_-	crystallin J1	NA	NA	NA	NA	NA
WP_024947250.1|4962407_4962665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024947249.1|4962784_4963660_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_078463942.1|4963855_4964125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024947247.1|4964297_4967708_-	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_024947246.1|4967773_4969255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033968774.1|4969474_4970122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078463988.1|4970361_4970961_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_023442851.1|4971519_4971699_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	54.2	5.6e-13
WP_124084220.1|4971777_4972638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125940083.1|4973299_4973980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024947442.1|4975704_4978950_+	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_024947443.1|4978949_4980653_+	enterotoxin	NA	NA	NA	NA	NA
WP_016254112.1|4981309_4981600_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_073651074.1|4981649_4982228_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	50.8	2.6e-43
4986940:4986961	attR	TCAAATCCCCCCGGCTCCACCA	NA	NA	NA	NA
