The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	306062	375988	4796292	head,tail,capsid,plate,integrase,transposase,tRNA,portal,terminase,lysis	Salmonella_phage(79.17%)	71	316387:316431	346934:346978
WP_086016394.1|306062_307152_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.7	6.7e-141
WP_093976750.1|307132_308244_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.0	8.4e-06
WP_129369178.1|308653_308854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242846.1|308866_309331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023242845.1|309403_310246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024156456.1|310257_311958_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_017442269.1|312035_313157_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_023242843.1|313231_314644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242842.1|314991_316221_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	89.2	1.0e-214
316387:316431	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_093976751.1|316548_317574_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	96.8	2.1e-197
WP_093976752.1|317575_318208_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	91.0	1.3e-104
WP_016150823.1|318327_318576_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	69.1	1.7e-23
WP_093976753.1|318608_319118_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	91.7	2.1e-81
WP_093976789.1|319125_319326_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	2.7e-32
WP_000963480.1|319289_319631_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_093976754.1|319697_319931_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	85.7	1.6e-28
WP_093976755.1|319930_320158_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	85.3	6.8e-32
WP_158649080.1|320154_320577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093976757.1|320573_320870_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	45.2	9.6e-10
WP_093976758.1|320866_321721_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	84.9	1.6e-134
WP_093976759.1|321717_324129_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.6	0.0e+00
WP_001154444.1|324286_324475_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_080113007.1|324486_324720_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	4.9e-33
WP_080113006.1|324795_325053_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	59.0	2.7e-16
WP_080113005.1|325463_326510_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.7	2.8e-176
WP_080113004.1|326506_327232_-|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	33.0	3.2e-22
WP_080113003.1|327231_328998_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.1	0.0e+00
WP_063886535.1|329140_329974_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	96.4	9.3e-127
WP_000742418.1|329990_331070_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	90.8	2.2e-181
WP_063886533.1|331073_331724_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	97.7	7.8e-113
WP_063886531.1|331817_332282_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	7.1e-84
WP_000868184.1|332281_332485_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|332488_332704_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001528581.1|332684_333194_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	8.3e-94
WP_001528673.1|333198_333576_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	96.0	2.4e-58
WP_001528739.1|333575_334001_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	2.7e-66
WP_013098790.1|334096_334528_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	8.1e-74
WP_063886529.1|334520_334967_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	4.2e-65
WP_063886527.1|335035_335614_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	89.6	1.6e-96
WP_063886526.1|335610_335970_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	90.8	2.7e-54
WP_063886524.1|335956_336865_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	95.0	3.5e-151
WP_063886522.1|336857_337463_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	94.5	4.0e-111
WP_093976760.1|337459_338731_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.5	5.2e-129
WP_063886518.1|338730_339327_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	3.3e-49
WP_063886516.1|339460_340633_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	94.9	4.1e-213
WP_063886514.1|340642_341158_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.1	1.9e-90
WP_060773291.1|341211_341514_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	2.3e-43
WP_000763315.1|341528_341648_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_063886512.1|341640_344433_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	73.2	1.0e-294
WP_063886510.1|344429_344915_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	96.2	2.0e-65
WP_093976761.1|344911_346012_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	90.2	1.3e-184
WP_093976790.1|346079_346298_+	levansucrase regulator	NA	E5G6Q4	Salmonella_phage	76.4	7.5e-28
WP_093976762.1|346324_346807_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	31.9	1.9e-15
WP_072101449.1|347367_348531_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
346934:346978	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_017442216.1|348538_350719_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_017442217.1|350715_352125_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017442218.1|352189_363664_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|364283_364766_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|364915_365392_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_017442219.1|365381_365672_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|365837_366176_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880958.1|366324_367986_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|368071_368950_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|369073_369664_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001682111.1|369745_370303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|370422_371709_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|371728_372520_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|372685_374047_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|374360_374609_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|374627_375176_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|375220_375988_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	638041	679326	4796292	coat,integrase,portal,lysis,holin,protease	Salmonella_phage(49.02%)	54	658471:658487	679608:679624
WP_000716011.1|638041_638980_+|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
WP_017441412.1|639241_639445_-	excisionase	NA	C6ZR24	Salmonella_phage	95.5	4.7e-32
WP_024137319.1|639541_640177_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	88.2	6.3e-107
WP_017441413.1|640421_640688_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	96.6	1.1e-44
WP_017441415.1|641659_641917_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	5.9e-40
WP_042948408.1|641918_642560_-	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	62.8	1.2e-57
WP_042948410.1|642556_642967_-	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	94.1	4.4e-69
WP_023242789.1|642963_643134_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	96.4	1.1e-23
WP_023217205.1|643144_643438_-	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	99.0	7.2e-50
WP_001253476.1|643484_643769_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_052942523.1|643768_644476_-	recombinase	NA	K7PKU3	Enterobacteria_phage	88.5	1.6e-119
WP_001308813.1|644730_645006_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_023242793.1|645095_645566_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	3.1e-87
WP_000392424.1|645644_646094_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
WP_072043886.1|646424_646730_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	91.8	2.9e-25
WP_000233125.1|647305_647674_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	99.2	1.3e-56
WP_000428318.1|647691_648408_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_043856230.1|648514_648709_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	98.4	6.7e-28
WP_015966855.1|648817_649096_+	ABC transporter	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
WP_016246166.1|649278_650169_+	hypothetical protein	NA	Q716D3	Shigella_phage	99.3	3.8e-158
WP_043856231.1|650158_651595_+	AAA family ATPase	NA	A0A220NRL4	Escherichia_phage	99.4	1.5e-273
WP_000736903.1|651872_652313_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|652309_652837_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_080182530.1|652833_653010_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	1.4e-27
WP_000924597.1|653012_653414_+	hypothetical protein	NA	G9L690	Escherichia_phage	85.0	2.7e-63
WP_080182531.1|653406_653583_+	protein ninF	NA	G9L691	Escherichia_phage	93.0	1.8e-24
WP_001108028.1|653575_654187_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.0	5.1e-98
WP_001028837.1|654183_654855_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.5	2.0e-127
WP_000512805.1|654845_655364_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.8	2.2e-94
WP_000783734.1|655872_656196_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|656179_656656_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_064034457.1|656652_657120_+|lysis	lysis protein	lysis	I6RSQ8	Salmonella_phage	86.5	2.4e-63
WP_023994441.1|657329_657851_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_023217190.1|658324_658567_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.8	1.9e-35
658471:658487	attL	CCAGTCAGGCGGCGCTA	NA	NA	NA	NA
WP_017441430.1|658569_658974_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	99.3	1.5e-66
WP_000729924.1|658977_659466_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|659443_660943_+	DNA packaging protein	NA	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_017441432.1|660942_663120_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
WP_017441433.1|663133_664045_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_020899473.1|664044_665337_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_000538675.1|665377_665938_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_010835893.1|665921_666422_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_023198766.1|666381_667800_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023198767.1|667803_668505_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	93.1	4.0e-70
WP_017441438.1|668504_668966_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	84.9	4.3e-73
WP_023198768.1|668968_669658_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	89.8	1.9e-88
WP_058649962.1|669700_671023_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	97.0	3.1e-233
WP_093976764.1|671022_672915_+	DNA transfer protein	NA	E7C9U6	Salmonella_phage	77.6	3.4e-249
WP_031624841.1|672932_673262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059056898.1|673501_675262_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	88.3	3.0e-58
WP_043856212.1|675297_676749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059056899.1|676745_677663_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	93.1	1.3e-161
WP_023138702.1|677659_678022_-	GtrA family protein	NA	I1TED9	Salmonella_phage	82.5	6.2e-51
WP_017441447.1|678156_679326_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	99.2	7.7e-228
679608:679624	attR	TAGCGCCGCCTGACTGG	NA	NA	NA	NA
>prophage 3
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	921842	931013	4796292	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_017441997.1|921842_922790_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	3.7e-10
WP_000824854.1|922773_923505_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|923485_923593_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|923652_924384_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|924606_926292_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|926288_927008_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_017441996.1|927054_927522_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.0e-74
WP_017441995.1|927578_928109_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|928280_928739_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|928979_931013_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	1103796	1111028	4796292		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1103796_1104216_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017441837.1|1104218_1105487_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1105932_1106145_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1106155_1106344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017441838.1|1106603_1107788_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.1	5.1e-110
WP_000107435.1|1108437_1108749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017441839.1|1108828_1109524_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_017441840.1|1109597_1111028_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	2012882	2057307	4796292	tail,integrase,terminase,lysis,protease	Salmonella_phage(45.83%)	62	2007752:2007765	2058229:2058242
2007752:2007765	attL	CACGCTGCAAACGC	NA	NA	NA	NA
WP_017440933.1|2012882_2013563_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.6e-82
WP_000503667.1|2014274_2014922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|2014964_2015162_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|2015344_2015590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|2015787_2016180_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|2016289_2016898_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|2016960_2017146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|2017394_2017913_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|2017927_2019460_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|2019459_2020140_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|2020136_2021336_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|2021336_2021690_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|2021689_2022442_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|2022560_2023016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|2023099_2023432_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000081749.1|2023428_2024496_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	91.5	2.0e-174
WP_000155111.1|2024498_2024801_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_023972346.1|2024800_2025376_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	99.5	9.1e-97
WP_000990866.1|2025375_2027385_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_000389049.1|2027562_2028015_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000257262.1|2028018_2028459_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	73.3	2.5e-54
WP_023972347.1|2028470_2029616_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.8	5.9e-164
WP_023972348.1|2029619_2030165_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.8	7.4e-48
WP_001526520.1|2030157_2030562_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	4.1e-43
WP_023972349.1|2030561_2031071_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	8.5e-22
WP_023972350.1|2031067_2031478_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	57.4	2.5e-32
WP_023972351.1|2031446_2031815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023972352.1|2031864_2032812_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	55.9	1.2e-98
WP_024156459.1|2032823_2033327_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.4	3.4e-31
WP_023972354.1|2033338_2034616_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	1.6e-77
WP_001526527.1|2034667_2035201_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	5.5e-48
WP_023972355.1|2035271_2036741_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	55.7	1.1e-157
WP_024156460.1|2036780_2038199_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.0	6.8e-186
WP_023972357.1|2038164_2038917_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	55.2	2.6e-11
WP_024156461.1|2038980_2039169_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_023972360.1|2039481_2039949_-|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	80.6	2.5e-60
WP_023972361.1|2039945_2040857_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	53.0	3.2e-88
WP_001526511.1|2040853_2041342_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	4.6e-57
WP_001526513.1|2041319_2041622_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|2041824_2042013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|2042405_2042984_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|2042980_2043274_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|2043270_2043867_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|2043935_2044127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|2044310_2044649_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_023972395.1|2044648_2044819_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|2044815_2045418_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|2045410_2045659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|2045662_2046343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|2046380_2047769_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|2047765_2048746_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|2048748_2048973_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|2048995_2049442_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_000467661.1|2049838_2050303_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_000387662.1|2050987_2051311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|2051318_2051564_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_023972393.1|2051593_2053867_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.0	9.4e-105
WP_000205292.1|2053863_2054418_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|2054420_2054603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|2054815_2055040_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|2055040_2056060_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|2056647_2057307_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
2058229:2058242	attR	CACGCTGCAAACGC	NA	NA	NA	NA
>prophage 6
NZ_CP022489	Salmonella enterica subsp. enterica serovar Mbandaka strain SA20026234 chromosome, complete genome	4796292	3550161	3597808	4796292	tail,plate,tRNA	Burkholderia_phage(36.36%)	50	NA	NA
WP_001825318.1|3550161_3551160_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|3551247_3552558_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_017441254.1|3552804_3553320_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|3553418_3553628_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|3553649_3553763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|3553759_3555085_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|3555263_3555872_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|3555980_3556349_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|3556519_3558940_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|3559038_3559911_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_017441255.1|3559924_3560422_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|3560602_3561520_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001594897.1|3561683_3563039_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|3563127_3564237_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_001651229.1|3564598_3565789_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|3565920_3567465_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|3567479_3568370_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|3568535_3568946_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|3569088_3571185_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_017441256.1|3571184_3571922_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|3571918_3572587_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|3572620_3572863_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790025.1|3573306_3574956_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136392.1|3575344_3576694_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001651225.1|3576828_3577176_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	52.6	7.5e-22
WP_001226440.1|3577752_3578040_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_017441257.1|3578042_3578648_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.0e-58
WP_000777266.1|3578660_3578975_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_017441258.1|3579134_3579590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|3579586_3579784_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_017441259.1|3579773_3581201_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	1.8e-194
WP_017441260.1|3581200_3581725_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
WP_001003641.1|3581776_3582094_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|3582053_3582182_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_017441261.1|3582278_3584633_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
WP_017441262.1|3584632_3585586_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|3585585_3585795_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_017441263.1|3585782_3586826_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
WP_000679395.1|3586835_3587558_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|3587884_3588247_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|3588243_3589173_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_017441264.1|3589172_3590720_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
WP_001093501.1|3590883_3591243_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_017441265.1|3591233_3592349_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
WP_000359502.1|3592341_3592974_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_017441266.1|3592976_3594635_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.0e-53
WP_017441267.1|3594641_3595256_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017441268.1|3595252_3595708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024142925.1|3596084_3596501_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587738.1|3597079_3597808_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
