The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	295954	305774	3742258		Streptococcus_phage(16.67%)	8	NA	NA
WP_025949231.1|295954_297319_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	7.9e-123
WP_025949230.1|297536_298823_+	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.3	7.8e-72
WP_025949229.1|299011_299725_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.4	1.3e-44
WP_025949228.1|299731_301561_+	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.2	5.6e-23
WP_025949227.1|301553_302882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025949226.1|302868_303651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025949225.1|303657_304452_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	36.5	6.5e-45
WP_025949224.1|304553_305774_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	3.6e-18
>prophage 2
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	496403	532678	3742258	integrase,transposase	Rhodobacter_phage(25.0%)	21	526158:526176	533400:533418
WP_014195145.1|496403_497282_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_014195146.1|497793_498351_+	signal peptidase I	NA	NA	NA	NA	NA
WP_014196900.1|500665_501466_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011229853.1|501458_502706_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.1	1.3e-10
WP_011229674.1|502848_503412_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021321441.1|504069_504468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014196899.1|506028_507396_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_014196898.1|507968_509279_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_047752540.1|510245_511619_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.1	1.1e-87
WP_014196895.1|511875_513204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033026504.1|513360_514590_+	hydantoinase/carbamoylase family amidase	NA	NA	NA	NA	NA
WP_033026498.1|514623_515808_+	amidohydrolase	NA	NA	NA	NA	NA
WP_068895790.1|517350_517431_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_011232718.1|517497_519180_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_011232717.1|519195_521229_+	potassium-transporting ATPase subunit KdpB	NA	A0A218MNH6	uncultured_virus	27.2	6.9e-22
WP_011232716.1|521247_521826_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_011232715.1|521815_522940_+	universal stress protein	NA	NA	NA	NA	NA
WP_011232711.1|525526_525727_+	DUF3311 domain-containing protein	NA	NA	NA	NA	NA
526158:526176	attL	AACTCACATTTCGCACCCT	NA	NA	NA	NA
WP_053004378.1|526287_527847_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_020278768.1|528413_529625_-	MFS transporter	NA	NA	NA	NA	NA
WP_033012449.1|531265_532678_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	9.6e-07
533400:533418	attR	AGGGTGCGAAATGTGAGTT	NA	NA	NA	NA
>prophage 3
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	721000	729415	3742258		Bacillus_phage(33.33%)	10	NA	NA
WP_167367370.1|721000_722101_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	2.4e-05
WP_081804132.1|722213_722474_+	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	52.9	2.5e-17
WP_025949837.1|722442_722703_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	66.3	1.8e-28
WP_025949838.1|722839_723703_+	YitT family protein	NA	NA	NA	NA	NA
WP_025949839.1|723765_724101_+	cytochrome c	NA	NA	NA	NA	NA
WP_025949840.1|724319_725015_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.3	4.1e-27
WP_025949841.1|724995_725889_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025949842.1|725913_727212_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A222YZS8	Streptomyces_phage	44.0	2.1e-16
WP_025949843.1|727410_727704_+	transporter	NA	NA	NA	NA	NA
WP_025949844.1|727774_729415_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.8	5.9e-48
>prophage 4
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	957384	1025300	3742258	integrase,transposase,holin	Staphylococcus_phage(30.77%)	60	950086:950101	969790:969805
950086:950101	attL	TTGTTCCTTGAAAACT	NA	NA	NA	NA
WP_082131166.1|957384_958371_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	49.2	2.6e-75
WP_053915553.1|959292_960048_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	47.7	9.2e-57
WP_094248672.1|960044_961247_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	2.3e-49
WP_094248673.1|961636_962887_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.6	5.7e-11
WP_094248674.1|962879_963680_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_094248675.1|964843_966502_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_047752600.1|966881_967244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033027894.1|967611_967893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752602.1|968128_968308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752603.1|968586_968838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752604.1|968888_969341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025950783.1|970079_971741_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
969790:969805	attR	TTGTTCCTTGAAAACT	NA	NA	NA	NA
WP_025950170.1|972732_973272_+	YobA family protein	NA	NA	NA	NA	NA
WP_025950171.1|973380_974607_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_047752605.1|974975_975587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013524490.1|976000_976942_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053004379.1|976972_977971_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_025950175.1|977963_978944_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_047752630.1|978978_980481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752607.1|981031_981676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752608.1|982057_982990_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047752609.1|983028_984075_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_047752610.1|984058_984874_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	6.3e-11
WP_053004380.1|984921_985974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752611.1|986025_986337_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_047752613.1|988177_988804_-	LysE family translocator	NA	NA	NA	NA	NA
WP_047752614.1|988934_989885_-	cation transporter	NA	NA	NA	NA	NA
WP_128733409.1|990061_992104_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_082131167.1|991985_993152_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_047752615.1|993151_994186_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_047752616.1|995627_998042_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	46.2	1.4e-10
WP_025950186.1|998151_998946_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_047752617.1|999045_999855_-	yteA family sporulation protein	NA	NA	NA	NA	NA
WP_025950188.1|999940_1000870_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_025950189.1|1001037_1002414_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_047752618.1|1002406_1004155_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_025950191.1|1004151_1004964_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_025950192.1|1004964_1005783_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_047752619.1|1005888_1007370_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.7	1.4e-64
WP_025950194.1|1007668_1007866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075261389.1|1007931_1008093_-	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_047752620.1|1008408_1008699_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_025950196.1|1008717_1009206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752621.1|1009352_1011431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025950198.1|1011527_1013486_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_047752622.1|1013589_1014621_-	membrane protein	NA	NA	NA	NA	NA
WP_047752623.1|1014636_1015986_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_047752624.1|1016117_1017104_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047752625.1|1017183_1018368_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_011232336.1|1018454_1018700_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	61.3	7.7e-21
WP_025950203.1|1018913_1019390_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_081804137.1|1019412_1019673_-	YtzI protein	NA	NA	NA	NA	NA
WP_025950204.1|1019724_1020165_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	69.9	3.9e-55
WP_025950205.1|1020317_1020713_+|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	48.7	8.3e-25
WP_047752626.1|1020771_1021104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025950207.1|1021162_1021630_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	40.6	3.0e-21
WP_025950208.1|1021753_1022563_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025950209.1|1022546_1023338_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.6e-35
WP_047752627.1|1023353_1024361_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025950211.1|1024511_1025300_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	36.9	4.4e-33
>prophage 5
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	1624661	1634509	3742258		Staphylococcus_phage(50.0%)	11	NA	NA
WP_021321991.1|1624661_1625804_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.5	4.1e-56
WP_011231778.1|1625758_1626403_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.3	1.9e-39
WP_014196246.1|1626423_1627617_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.1	1.5e-117
WP_011231776.1|1627637_1628102_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	61.1	1.0e-42
WP_011231775.1|1628222_1628579_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011231774.1|1628601_1629141_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_047752861.1|1629335_1630091_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.9	2.5e-09
WP_011231772.1|1630266_1630920_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.3	1.7e-14
WP_011231771.1|1630938_1631340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033012345.1|1631697_1633011_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.6	5.2e-39
WP_162832688.1|1633414_1634509_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.6	3.7e-22
>prophage 6
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	1735532	1804975	3742258	protease,tRNA,transposase	Bacillus_phage(25.0%)	57	NA	NA
WP_020278328.1|1735532_1736861_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	3.3e-57
WP_013144925.1|1736928_1737630_+	DnaD domain-containing protein	NA	A0A0N7AE27	Bacillus_phage	50.0	4.3e-24
WP_025948461.1|1737735_1738407_+	endonuclease III	NA	NA	NA	NA	NA
WP_025948460.1|1738512_1741203_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_025948459.1|1741236_1741839_-	Holliday junction resolvase RecU	NA	R9TMF8	Paenibacillus_phage	36.4	3.0e-26
WP_025948458.1|1742062_1742305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025948457.1|1742421_1742805_+	YppE family protein	NA	NA	NA	NA	NA
WP_167372770.1|1743108_1743279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948456.1|1743398_1743599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948455.1|1743792_1744137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011231646.1|1744220_1744475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948454.1|1744474_1744660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167372771.1|1744743_1744905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752897.1|1745020_1745485_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_013144934.1|1746005_1746680_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.5	7.8e-31
WP_047752898.1|1746676_1748074_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155836594.1|1748083_1748248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752899.1|1748263_1748848_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_047752900.1|1749008_1750661_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_047752901.1|1750775_1752965_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_047752902.1|1753025_1753808_-	EcsC family protein	NA	NA	NA	NA	NA
WP_089113886.1|1753996_1755181_+	galactokinase	NA	NA	NA	NA	NA
WP_047752904.1|1755177_1756164_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_047752905.1|1756167_1757694_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_047752906.1|1757747_1758770_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025949014.1|1758786_1759230_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_025949013.1|1759297_1759588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752907.1|1768471_1768756_+	LysE family transporter	NA	NA	NA	NA	NA
WP_047752331.1|1768848_1770129_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047752908.1|1771800_1772010_+	hypothetical protein	NA	S6C469	Thermus_phage	51.5	1.8e-10
WP_167372772.1|1772302_1773970_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_025948783.1|1774330_1774675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128733418.1|1774696_1774861_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_094248679.1|1775033_1776221_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_053004386.1|1776273_1776537_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_025950322.1|1776973_1778203_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.3e-84
WP_047752912.1|1780405_1783186_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_047752913.1|1783406_1784648_-	aminopeptidase	NA	NA	NA	NA	NA
WP_047752914.1|1784993_1786430_+	sodium/proline symporter	NA	NA	NA	NA	NA
WP_025948855.1|1786791_1787307_+	DoxX family protein	NA	NA	NA	NA	NA
WP_047753588.1|1789311_1789671_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_047753587.1|1790149_1790434_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025948852.1|1790423_1791068_+	SdpI family protein	NA	NA	NA	NA	NA
WP_047753589.1|1791123_1791873_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_047753586.1|1791869_1792235_+	glyoxalase	NA	NA	NA	NA	NA
WP_167372773.1|1792329_1792467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025948849.1|1792516_1792699_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_089113887.1|1792905_1794078_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	28.3	1.1e-35
WP_047752916.1|1795095_1795671_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_025948844.1|1796748_1797153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033024004.1|1797582_1798902_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025948842.1|1799073_1800381_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025948841.1|1800394_1801222_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_025948840.1|1801463_1801919_+	dehydratase	NA	NA	NA	NA	NA
WP_025948839.1|1802052_1803348_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_025948838.1|1803448_1803886_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047752917.1|1804090_1804975_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	1976863	2051627	3742258	transposase	Staphylococcus_phage(33.33%)	52	NA	NA
WP_025950322.1|1976863_1978093_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.3e-84
WP_047753030.1|1978530_1979721_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_047753019.1|1979879_1981343_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025950845.1|1981533_1982037_+	DUF3368 domain-containing protein	NA	NA	NA	NA	NA
WP_089113912.1|1982178_1983630_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_047753021.1|1983898_1985989_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_047753022.1|1985994_1986438_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_047753023.1|1986437_1987598_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_047753024.1|1991487_1992408_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_047753025.1|1992788_1993829_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_047753026.1|1993881_1994337_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_047753027.1|1994350_1995877_+	transporter	NA	NA	NA	NA	NA
WP_025950854.1|1995956_1997555_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_025950855.1|1997604_1998291_+	response regulator	NA	NA	NA	NA	NA
WP_047753028.1|1998350_1999286_+	AEC family transporter	NA	NA	NA	NA	NA
WP_047753029.1|2001855_2002758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_047753031.1|2004208_2005225_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_047753032.1|2005242_2006787_+	gluconokinase	NA	NA	NA	NA	NA
WP_025950860.1|2006921_2008271_+	GntP family permease	NA	NA	NA	NA	NA
WP_047753044.1|2010208_2011465_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047753033.1|2011525_2012419_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_047753045.1|2012430_2013489_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_047753034.1|2013463_2014228_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	22.8	3.1e-12
WP_025950866.1|2014206_2014908_+	urea ABC transporter ATP-binding subunit UrtE	NA	G3M9Y6	Bacillus_virus	28.7	5.4e-19
WP_025950867.1|2015102_2015408_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_089113914.1|2015483_2015819_+	urease subunit beta	NA	NA	NA	NA	NA
WP_053915408.1|2015815_2017525_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_053915410.1|2017535_2017982_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_089113915.1|2017974_2018652_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_025950872.1|2018701_2019316_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_089113916.1|2019312_2020128_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_089113917.1|2020145_2020769_+	urease accessory protein UreH	NA	NA	NA	NA	NA
WP_025950875.1|2020883_2021363_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_089114005.1|2021474_2022653_-	MFS transporter	NA	NA	NA	NA	NA
WP_025950877.1|2022926_2024306_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_025950878.1|2024357_2024915_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_025950879.1|2024975_2025626_-	cyclase family protein	NA	NA	NA	NA	NA
WP_089113918.1|2026045_2027482_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_089113919.1|2027578_2029036_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_089113920.1|2029219_2029984_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_141104708.1|2032232_2032637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261360.1|2034115_2034964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025949022.1|2034956_2035616_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.3	2.1e-28
WP_157720885.1|2036242_2036929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141104710.1|2037048_2037759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752930.1|2042007_2042760_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	42.7	7.8e-40
WP_047752331.1|2044215_2045496_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015374613.1|2046429_2046777_-	DUF4260 domain-containing protein	NA	NA	NA	NA	NA
WP_094248683.1|2046974_2048177_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	3.0e-49
WP_025949139.1|2049005_2049239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141104707.1|2049417_2050119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089113823.1|2050748_2051627_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	2516485	2547128	3742258	transposase	Bacillus_phage(50.0%)	22	NA	NA
WP_047752599.1|2516485_2518144_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_094248688.1|2519884_2521471_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_089113997.1|2521715_2522486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053915570.1|2522648_2523539_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_089113990.1|2523616_2523982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089113989.1|2523948_2525184_-	MFS transporter	NA	NA	NA	NA	NA
WP_025950577.1|2525715_2526012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047753599.1|2526176_2526362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089113956.1|2526780_2528439_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_167372754.1|2529008_2529290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025949140.1|2529347_2531105_-	TIGR03986 family CRISPR-associated RAMP protein	NA	NA	NA	NA	NA
WP_025949141.1|2531043_2531619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025949142.1|2531630_2533001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047753282.1|2532984_2535204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047753283.1|2535175_2536771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089113944.1|2536802_2538077_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_025949146.1|2538273_2538891_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_025949147.1|2539181_2540012_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025949148.1|2540001_2541750_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	49.2	2.2e-133
WP_167372755.1|2542010_2542859_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094248689.1|2544734_2546003_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_128733428.1|2546546_2547128_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	29.2	6.1e-08
>prophage 9
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	2936008	2965000	3742258	integrase,protease,transposase	Trichoplusia_ni_ascovirus(33.33%)	21	2954415:2954430	2967140:2967155
WP_089113956.1|2936008_2937667_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_025951319.1|2938638_2940012_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_047753276.1|2940390_2940711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025949150.1|2940907_2941408_+	VanZ family protein	NA	NA	NA	NA	NA
WP_025948351.1|2947224_2947776_+|protease	spore protease YyaC	protease	NA	NA	NA	NA
WP_047753423.1|2947824_2949546_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_025948353.1|2949545_2949812_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_025948354.1|2949918_2951937_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_047753425.1|2953225_2953498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025948357.1|2953447_2954596_-	cation:proton antiporter	NA	NA	NA	NA	NA
2954415:2954430	attL	ATGACGCCGATTTGGC	NA	NA	NA	NA
WP_025948358.1|2954919_2956212_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_025948359.1|2956268_2956514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948360.1|2956579_2957329_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.6e-16
WP_047753426.1|2957596_2958271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948362.1|2958441_2958636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047753427.1|2958836_2959421_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	46.8	2.2e-42
WP_047753428.1|2959632_2960058_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_047752331.1|2960458_2961739_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047753429.1|2961922_2962303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082131209.1|2962304_2963693_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	21.3	6.1e-06
WP_094248695.1|2963812_2965000_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
2967140:2967155	attR	GCCAAATCGGCGTCAT	NA	NA	NA	NA
>prophage 10
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	3216354	3246691	3742258	integrase,bacteriocin,transposase	Anomala_cuprea_entomopoxvirus(20.0%)	26	3218736:3218795	3233173:3233307
WP_025951019.1|3216354_3217245_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_025948436.1|3217519_3218191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047753555.1|3218261_3218987_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.2	1.1e-22
3218736:3218795	attL	GATGAGCCGACTCTTGGCCTTGATGTGGAGTCGCAGCATCATATCCGAACCATGTTAACG	NA	NA	NA	NA
WP_033024330.1|3218940_3219771_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047753556.1|3220105_3220426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094248685.1|3220913_3222575_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013146145.1|3222921_3223932_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	30.0	3.6e-40
WP_047753558.1|3224234_3225422_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_025949653.1|3226097_3226688_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_047753559.1|3226701_3228096_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_061912121.1|3228149_3228860_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094248700.1|3229310_3230225_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1IQT7	uncultured_Mediterranean_phage	25.4	7.6e-13
WP_025950788.1|3233572_3234076_+	DUF1572 family protein	NA	NA	NA	NA	NA
3233173:3233307	attR	GATGAGCCGACTCTTGGCCTTGATGTGGAGTCGCAGCATCATATCCGAACCATGTTAACGGAAGAAAACCAATGGTGGAAAGCCGTTCTCATCACCACCCACGACATTCCTTTTGCCCACGCCGTTGGAAATAAG	NA	NA	NA	NA
WP_025950787.1|3234287_3234695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025950786.1|3234687_3234891_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094248685.1|3235265_3236927_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_047753420.1|3237834_3238470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089113969.1|3238957_3239275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047753418.1|3239691_3240765_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047753417.1|3240765_3241569_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047753416.1|3241565_3242375_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047753415.1|3242371_3243430_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.9	4.9e-40
WP_047753414.1|3243552_3244203_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.6e-12
WP_047753413.1|3244251_3244761_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_047753412.1|3244774_3246394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146157.1|3246460_3246691_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
>prophage 11
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	3540368	3648021	3742258	integrase,transposase,holin	Bacillus_phage(23.53%)	82	3577733:3577750	3627725:3627742
WP_011229671.1|3540368_3541232_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.5	6.4e-46
WP_025039269.1|3541228_3541555_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047752306.1|3543265_3544129_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_047752307.1|3544241_3545003_+	sporulation protein	NA	NA	NA	NA	NA
WP_047752308.1|3545183_3546572_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	33.5	3.7e-51
WP_025949029.1|3546805_3547222_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_047752331.1|3547400_3548681_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047752309.1|3549079_3549955_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025949027.1|3550347_3551817_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_167372790.1|3552189_3552354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167372756.1|3552475_3552637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128733398.1|3552690_3553800_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	NA	NA	NA	NA
WP_047752310.1|3554448_3555822_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	48.9	9.4e-124
WP_047752311.1|3555900_3556821_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.6	6.0e-26
WP_025951313.1|3556970_3558494_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	1.6e-07
WP_025951312.1|3558515_3559055_-	NfeD family protein	NA	NA	NA	NA	NA
WP_047752312.1|3559260_3560139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025951310.1|3560240_3560570_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_047752320.1|3560920_3562309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752313.1|3562560_3563607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752316.1|3564816_3565617_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_047752317.1|3565609_3566860_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	7.4e-11
WP_094248703.1|3567833_3569558_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.9	9.0e-15
WP_047752322.1|3569554_3570265_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.3e-36
WP_047752323.1|3570362_3571046_+	membrane protein	NA	NA	NA	NA	NA
WP_047752324.1|3572268_3572457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752325.1|3572491_3572740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157720892.1|3572843_3573050_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157720893.1|3573399_3573588_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	44.8	3.1e-06
WP_047752326.1|3573822_3574035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089113827.1|3574202_3574868_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_094248704.1|3574880_3575990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047752599.1|3575961_3577620_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
3577733:3577750	attL	GGGTGCGAAATGTGAGTT	NA	NA	NA	NA
WP_128733402.1|3578457_3578610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094248705.1|3578705_3579893_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_047752330.1|3581112_3581790_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_047752331.1|3582187_3583468_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015375203.1|3583784_3584315_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157720896.1|3584329_3584842_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.3	1.1e-08
WP_047752334.1|3585863_3587066_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.6	2.3e-49
WP_094248706.1|3590041_3590572_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047752336.1|3590571_3591099_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.5	2.7e-07
WP_157856408.1|3591081_3591882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047752337.1|3591902_3592517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053004367.1|3592561_3593572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082131150.1|3595727_3596750_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	23.8	3.1e-07
WP_014196899.1|3597446_3598814_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_047752339.1|3599159_3600368_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025950795.1|3600449_3601199_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_025950796.1|3601327_3601909_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047752340.1|3602175_3602658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025948820.1|3606647_3606950_+	4Fe-4S ferredoxin	NA	NA	NA	NA	NA
WP_025948821.1|3606955_3607156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089113991.1|3608292_3609498_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.6	1.0e-12
WP_047752344.1|3609687_3610113_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_047752348.1|3610291_3610954_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.6e-33
WP_082131151.1|3610943_3612317_+	GHKL domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.4	1.5e-12
WP_047752346.1|3613009_3613534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025948873.1|3613493_3614147_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_025948874.1|3614380_3615613_+	MFS transporter	NA	NA	NA	NA	NA
WP_047752347.1|3615673_3616720_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_025948876.1|3618274_3619417_-	type III-B CRISPR module RAMP protein Cmr6	NA	NA	NA	NA	NA
WP_025948877.1|3619429_3619834_-	type III-B CRISPR module-associated protein Cmr5	NA	NA	NA	NA	NA
WP_047752350.1|3619848_3620736_-	type III-B CRISPR module RAMP protein Cmr4	NA	NA	NA	NA	NA
WP_025948879.1|3620735_3621866_-	CRISPR-associated protein Cmr3	NA	NA	NA	NA	NA
WP_089113992.1|3621862_3623503_-	type III-B CRISPR-associated protein Cas10/Cmr2	NA	NA	NA	NA	NA
WP_025948881.1|3623499_3624405_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_047752353.1|3624404_3625745_-	TIGR02221 family CRISPR-associated protein	NA	NA	NA	NA	NA
WP_047752354.1|3625747_3626947_-	CRISPR-associated protein	NA	NA	NA	NA	NA
WP_167372791.1|3628124_3630533_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
3627725:3627742	attR	GGGTGCGAAATGTGAGTT	NA	NA	NA	NA
WP_047752357.1|3630623_3631388_-	CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_047752358.1|3631390_3632455_-	type I CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_053004368.1|3632477_3634541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082131153.1|3634558_3635407_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_047752359.1|3635661_3636588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_047752360.1|3636720_3637941_-	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_047752361.1|3637937_3642059_-	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_014194803.1|3642018_3643215_-	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_014194802.1|3643217_3644708_-	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_014194801.1|3644852_3645500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014194799.1|3645974_3646877_+	proline/glycine betaine ABC-type transport system, permease component fused to periplasmic component	NA	NA	NA	NA	NA
WP_011229819.1|3646893_3648021_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.5	2.5e-29
>prophage 12
NZ_CP018058	Geobacillus thermocatenulatus strain KCTC 3921 chromosome, complete genome	3742258	3695128	3703549	3742258		Synechococcus_phage(33.33%)	8	NA	NA
WP_025948708.1|3695128_3695764_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.0	3.2e-26
WP_025948707.1|3695760_3696801_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.9	4.2e-68
WP_025948706.1|3696923_3698336_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.9	2.2e-51
WP_025948705.1|3698311_3700540_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	6.3e-170
WP_025948704.1|3700523_3701210_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_025948703.1|3701206_3701461_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_047752374.1|3701448_3702177_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.5	3.6e-42
WP_025948701.1|3702253_3703549_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	2.9e-18
