The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	530338	538017	5130228		Thermobifida_phage(16.67%)	10	NA	NA
WP_042291907.1|530338_531193_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_042325036.1|531226_531718_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_042325038.1|531833_532121_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	5.5e-10
WP_042325041.1|532143_533577_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_042325043.1|533624_534350_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.4e-22
WP_042325045.1|534356_534911_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_042325047.1|534879_535455_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_042325049.1|535451_536018_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	1.4e-54
WP_042325051.1|536038_537025_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.1e-38
WP_042325053.1|537039_538017_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	21.7	9.6e-06
>prophage 2
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	671373	713018	5130228	integrase,head,terminase,tail,tRNA,portal,lysis,plate,capsid	Salmonella_phage(84.62%)	50	670398:670444	703727:703773
670398:670444	attL	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_094464751.1|671373_672429_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	59.1	8.0e-115
WP_094464753.1|672655_673270_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.6	1.2e-38
WP_015386350.1|673371_673608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094464755.1|673642_674152_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	3.9e-83
WP_032442472.1|674159_674360_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.4	6.7e-31
WP_048971665.1|674323_674665_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	87.6	9.0e-52
WP_063867217.1|674732_674966_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	9.2e-24
WP_013098805.1|674965_675193_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
WP_094464757.1|675189_676047_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	94.7	1.1e-154
WP_094464759.1|676037_678446_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.1	0.0e+00
WP_046669924.1|678464_678692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046669925.1|678829_679018_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	3.3e-24
WP_052946580.1|679289_679472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094464761.1|680337_681318_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_094464763.1|681314_682259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094464765.1|682274_683309_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.4	2.6e-179
WP_094464767.1|683308_685075_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
WP_094464769.1|685215_686049_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	96.8	2.7e-126
WP_094464771.1|686065_687130_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	4.6e-195
WP_094464773.1|687133_687784_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	99.1	1.1e-114
WP_094464775.1|687877_688342_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	1.2e-83
WP_094464777.1|688341_688545_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	1.1e-33
WP_001397650.1|688548_688764_+	membrane protein	NA	E5G6N0	Salmonella_phage	97.2	8.5e-32
WP_094464779.1|688744_689260_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.8	3.0e-75
WP_167382379.1|689256_689685_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	91.5	9.2e-62
WP_094464781.1|689780_690212_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	96.5	2.1e-74
WP_094464783.1|690204_690654_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.1	8.7e-63
WP_094464785.1|690655_691351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465824.1|691451_692030_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	93.8	5.5e-102
WP_094464787.1|692026_692386_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	3.1e-55
WP_094464789.1|692372_693281_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	91.7	1.8e-144
WP_094464791.1|693273_693879_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	8.6e-114
WP_094464793.1|693875_695093_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	71.3	5.0e-121
WP_094464795.1|695079_695271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094464797.1|695376_696444_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_094464799.1|696749_697922_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	6.2e-209
WP_094464801.1|697931_698447_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.7	3.3e-90
WP_060773291.1|698501_698804_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	2.3e-43
WP_094464803.1|698818_698938_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	2.6e-14
WP_094464805.1|698930_701723_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.7	7.1e-296
WP_094464807.1|701719_702205_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	87.6	1.5e-71
WP_094464809.1|702201_703302_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.3	2.7e-190
WP_024146528.1|703371_703590_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_042324328.1|703926_704433_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
703727:703773	attR	TGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGTC	NA	NA	NA	NA
WP_042324326.1|704463_706461_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	3.2e-08
WP_094464811.1|706471_707521_-	YncE family protein	NA	NA	NA	NA	NA
WP_042324322.1|707682_709530_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_042324320.1|709700_711446_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.1	1.3e-77
WP_001144069.1|711561_711777_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_042324318.1|712004_713018_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	2.6e-107
>prophage 3
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	1359755	1393924	5130228	integrase,head,terminase,tail,tRNA,portal,holin,capsid	Cronobacter_phage(58.62%)	38	1374072:1374087	1398890:1398905
WP_042324410.1|1359755_1360235_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_042324407.1|1360436_1361231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042324405.1|1361372_1363874_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	7.9e-113
WP_094465010.1|1364134_1364644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465012.1|1365152_1366877_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	60.7	1.1e-169
WP_094465014.1|1366880_1367426_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	53.3	8.7e-41
WP_094465016.1|1367397_1368120_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	42.4	9.2e-46
WP_094465017.1|1368175_1368526_-	hypothetical protein	NA	N0DPE7	Edwardsiella_phage	36.2	1.6e-08
WP_094465019.1|1370316_1370907_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	65.8	3.4e-75
WP_094465021.1|1370899_1372084_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	71.0	2.0e-159
WP_094465023.1|1372076_1372412_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	58.7	1.6e-29
WP_094465025.1|1372408_1374481_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	42.6	1.1e-147
1374072:1374087	attL	CTGGCTTTCACGCCTG	NA	NA	NA	NA
WP_086512667.1|1374482_1374662_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	65.2	6.4e-09
WP_094465027.1|1374670_1374940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465029.1|1375042_1375426_-	hypothetical protein	NA	A0A2I6PD12	Escherichia_phage	38.4	1.1e-05
WP_094465031.1|1375425_1375764_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	87.1	6.2e-45
WP_086512662.1|1375760_1376063_-|holin	holin	holin	NA	NA	NA	NA
WP_094465033.1|1376067_1376523_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	53.0	2.3e-39
WP_094465035.1|1376525_1377668_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	61.6	5.6e-130
WP_139155876.1|1377670_1378327_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	3.3e-66
WP_094465039.1|1378362_1378839_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_094465041.1|1378835_1379309_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.5	4.5e-33
WP_094465043.1|1379412_1380117_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	56.3	4.9e-68
WP_094465045.1|1380119_1381151_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	52.9	3.1e-95
WP_094465047.1|1381175_1382240_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	41.4	2.2e-32
WP_094465049.1|1382417_1384229_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	55.7	1.4e-188
WP_094465051.1|1384225_1385287_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.0	1.2e-121
WP_086512651.1|1385334_1385610_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	59.6	6.2e-27
WP_094465053.1|1385637_1386360_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	70.2	4.6e-90
WP_094465055.1|1386581_1389191_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	38.5	2.0e-127
WP_094465057.1|1389199_1389463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465059.1|1389462_1390452_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	61.4	8.3e-106
WP_094465061.1|1390522_1390912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086512645.1|1390928_1391159_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	48.5	5.2e-11
WP_086513021.1|1391155_1391491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086512644.1|1391718_1392018_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	54.5	1.3e-25
WP_086512643.1|1392087_1393110_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.2	1.1e-92
WP_042324404.1|1393210_1393924_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.2	3.7e-15
1398890:1398905	attR	CTGGCTTTCACGCCTG	NA	NA	NA	NA
>prophage 4
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	1888661	1986514	5130228	integrase,head,terminase,protease,tail,portal,holin,capsid,plate	Salmonella_phage(20.93%)	105	1899514:1899529	1913904:1913919
WP_042319993.1|1888661_1890422_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_042319990.1|1890607_1891060_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_042319987.1|1891143_1892199_-	porin OmpA	NA	NA	NA	NA	NA
WP_042319986.1|1892555_1893065_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_042319983.1|1893282_1893912_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_094465132.1|1893865_1896028_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_042319980.1|1896046_1896493_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_042319976.1|1896616_1898671_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.4e-19
WP_042319974.1|1898702_1899161_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_042319972.1|1899254_1899917_-	DUF2057 family protein	NA	NA	NA	NA	NA
1899514:1899529	attL	ACGGCGAGGATATCCA	NA	NA	NA	NA
WP_042319968.1|1900089_1900503_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_042319966.1|1900548_1900866_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_042319964.1|1900923_1902114_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_042319962.1|1902208_1902490_+	acylphosphatase	NA	NA	NA	NA	NA
WP_042319960.1|1902486_1902816_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_012905355.1|1902906_1903566_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
WP_061070694.1|1904030_1905059_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	5.6e-81
WP_094465134.1|1904997_1905276_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_094465136.1|1905345_1907628_-	exonuclease	NA	S4TNL0	Salmonella_phage	46.0	3.3e-113
WP_094465842.1|1907769_1908096_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_043001146.1|1908107_1908446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046402092.1|1908606_1908798_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_167382385.1|1908794_1908992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465140.1|1909425_1909833_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	52.3	4.0e-30
WP_044266820.1|1909963_1910191_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	78.7	3.8e-30
WP_094465142.1|1910193_1910748_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	33.7	2.0e-16
WP_167382406.1|1910819_1911902_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	50.8	1.1e-45
WP_139155853.1|1911813_1912359_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	73.2	1.6e-66
WP_094465144.1|1912374_1913091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465146.1|1913087_1913294_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	63.1	9.0e-15
WP_094465148.1|1913290_1913524_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	45.5	4.7e-12
WP_094465150.1|1913520_1914009_+	hypothetical protein	NA	NA	NA	NA	NA
1913904:1913919	attR	TGGATATCCTCGCCGT	NA	NA	NA	NA
WP_094465152.1|1914005_1914842_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	51.1	3.9e-72
WP_094465154.1|1914923_1915796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139155854.1|1915792_1916842_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	28.9	6.5e-16
WP_094465158.1|1916852_1917938_-	hypothetical protein	NA	Q684B3	Sulfolobus_virus	26.2	2.0e-12
WP_044266846.1|1918149_1918383_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	84.4	3.5e-31
WP_043001133.1|1918426_1918672_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.3	6.3e-23
WP_094465160.1|1918797_1918998_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	59.1	7.9e-16
WP_043001131.1|1919000_1919381_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.9	4.4e-47
WP_094465162.1|1919356_1920391_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	52.6	2.2e-101
WP_094465164.1|1920404_1921004_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	4.9e-77
WP_094465166.1|1921844_1922237_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	96.2	1.6e-60
WP_044268894.1|1922223_1922505_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.2	1.4e-34
WP_094465168.1|1922661_1923276_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.9	6.1e-91
WP_044266511.1|1923282_1923558_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	3.0e-21
WP_044266513.1|1923760_1924051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465170.1|1924166_1924808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465848.1|1924842_1925346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465172.1|1925636_1926206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465174.1|1926147_1928271_+|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.8	1.2e-96
WP_000483309.1|1928279_1928543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465176.1|1928542_1930180_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_094465178.1|1930176_1931043_+	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.6	2.8e-49
WP_094465179.1|1931044_1931635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465181.1|1931634_1932039_+|head	head decoration protein	head	NA	NA	NA	NA
WP_094465183.1|1932137_1933187_+|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	1.1e-50
WP_094465185.1|1933158_1933569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465187.1|1933573_1933933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465189.1|1933929_1934475_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_094465191.1|1934478_1934676_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_094465194.1|1934672_1936175_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.9	3.8e-102
WP_000896638.1|1936178_1936550_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_094465197.1|1936551_1936830_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_167382386.1|1936971_1938777_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	49.0	3.2e-31
WP_094465199.1|1938846_1940247_+	DNA circularization protein	NA	NA	NA	NA	NA
WP_094465201.1|1940243_1941329_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	33.2	6.2e-46
WP_094465203.1|1941325_1941910_+|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	34.1	2.3e-07
WP_094465205.1|1941906_1942356_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	47.7	2.5e-17
WP_094465207.1|1942345_1943488_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	29.4	1.0e-27
WP_094465209.1|1943484_1944078_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_094465211.1|1944796_1944982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465213.1|1944962_1945544_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.0	7.9e-48
WP_094465215.1|1945543_1946029_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	45.0	8.6e-24
WP_094465217.1|1946138_1946690_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	82.5	4.8e-79
WP_094465220.1|1947035_1947356_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	5.5e-27
WP_042319958.1|1947917_1948115_+	hypothetical protein	NA	Q687E8	Enterobacteria_phage	55.7	9.5e-14
WP_084196591.1|1948156_1950670_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.9	3.3e-98
WP_042319956.1|1951095_1951839_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	3.6e-21
WP_042319955.1|1952009_1952390_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_042319952.1|1952897_1955324_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_042319950.1|1955768_1956266_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_042319948.1|1956301_1957852_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_042319946.1|1957869_1959210_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_042319943.1|1959206_1959896_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_042319942.1|1959892_1961602_+	OmpA family protein	NA	NA	NA	NA	NA
WP_042319939.1|1961603_1962095_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_042319937.1|1962265_1964917_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.2	3.2e-96
WP_084196582.1|1964916_1967286_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.4	1.1e-18
WP_072015701.1|1967298_1968132_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_094465224.1|1968148_1970725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139155855.1|1970904_1971099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139155856.1|1971151_1971796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139155857.1|1971914_1972511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042319930.1|1972527_1972920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042319928.1|1973289_1975383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042319927.1|1975385_1976042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072015700.1|1976081_1976348_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_094465228.1|1976347_1977583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042319924.1|1977829_1981123_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_094465230.1|1981119_1982715_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_094465232.1|1982741_1984496_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042319918.1|1984459_1985545_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042319914.1|1985522_1986059_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042319911.1|1986058_1986514_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	2148357	2286311	5130228	integrase,head,terminase,transposase,tail,tRNA,portal,plate,capsid	Enterobacteria_phage(23.4%)	155	2145372:2145388	2243282:2243298
2145372:2145388	attL	GGCAGGTGGTGTTTAAT	NA	NA	NA	NA
WP_001281697.1|2148357_2148747_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
WP_000988476.1|2148743_2149172_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.1	1.1e-25
WP_000967768.1|2149161_2149377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135926.1|2149373_2150063_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.9	5.9e-26
WP_001569383.1|2150049_2150346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246284.1|2150361_2150634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569384.1|2150630_2150819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|2150897_2151509_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_000835317.1|2151526_2151796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410679.1|2151798_2152965_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
WP_011410680.1|2152975_2154745_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_006687266.1|2154748_2155657_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_000042842.1|2155666_2155972_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_001041677.1|2155968_2156193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569385.1|2156281_2156692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001569386.1|2156727_2157261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664222.1|2157308_2158079_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	7.6e-99
WP_000793140.1|2158326_2158677_+	membrane protein	NA	A4JWP3	Burkholderia_virus	54.8	4.0e-23
WP_001569387.1|2158676_2159414_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.9e-62
WP_011410681.1|2159403_2160057_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	30.7	2.4e-08
WP_000175096.1|2160053_2160386_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122433.1|2160378_2160690_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_011410682.1|2160689_2161235_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_016246282.1|2161231_2162755_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	3.4e-183
WP_011410684.1|2162754_2164251_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.8	1.5e-170
WP_011410685.1|2164231_2165053_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.5	5.8e-97
WP_011410686.1|2165055_2165514_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.6	1.3e-29
WP_011410687.1|2165728_2166826_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_011410688.1|2166839_2167793_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.0	7.5e-64
WP_011410689.1|2167803_2168160_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271666.1|2168161_2168608_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_001101809.1|2168607_2169072_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_001446463.1|2169068_2169323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729861.1|2169312_2170740_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
WP_162837902.1|2170736_2171261_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	4.7e-68
WP_000215406.1|2171263_2171545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410690.1|2171643_2171958_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2171923_2172061_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011410691.1|2172153_2174619_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	7.4e-172
WP_000458380.1|2174618_2175503_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	3.1e-51
WP_011410692.1|2175499_2175715_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.6e-17
WP_000808003.1|2175702_2176872_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.1	3.0e-86
WP_000929399.1|2176871_2177384_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_000859115.1|2177438_2177786_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_001569394.1|2177776_2178880_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	9.2e-106
WP_016246279.1|2178872_2179451_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	7.5e-67
WP_094465264.1|2180324_2180510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465266.1|2180490_2181072_-|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	41.3	7.9e-32
WP_094465268.1|2181071_2181608_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	48.0	3.1e-30
WP_001569399.1|2181656_2182238_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	2.9e-66
WP_042319594.1|2184541_2185177_-	TetR family copper-responsive transcriptional repressor ComR	NA	NA	NA	NA	NA
WP_042320085.1|2185420_2185678_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_042320081.1|2185774_2186740_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_042319593.1|2186887_2190334_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_094465270.1|2190464_2191517_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_042319589.1|2191768_2192968_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_042319588.1|2192960_2193662_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.2	1.9e-35
WP_042319586.1|2193661_2194906_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_042319585.1|2194995_2195907_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_094465272.1|2195922_2196744_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.6	6.2e-22
WP_042319581.1|2196779_2197826_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_042319578.1|2197822_2198614_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_042319576.1|2198610_2199468_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	1.5e-10
WP_042319574.1|2199451_2200588_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	3.2e-29
WP_094465274.1|2200838_2202065_+	peptidase T	NA	NA	NA	NA	NA
WP_042319570.1|2202168_2203290_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_042319568.1|2203386_2204850_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_042320079.1|2204849_2205521_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_042319567.1|2205682_2207050_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	5.0e-109
WP_042320078.1|2207053_2207695_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_042319566.1|2207731_2208838_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_042319564.1|2208891_2209353_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_042319561.1|2209356_2210025_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_094465276.1|2210196_2211447_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_094465278.1|2211560_2212703_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_094465280.1|2212692_2212929_-	excisionase	NA	NA	NA	NA	NA
WP_094465282.1|2213033_2213327_-	hypothetical protein	NA	A0A076GCP4	Escherichia_phage	52.7	2.5e-18
WP_094465284.1|2213609_2213831_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.5	3.7e-14
WP_094465286.1|2215254_2215911_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	67.0	8.2e-86
WP_057101686.1|2216010_2216208_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	73.8	9.8e-19
WP_094465288.1|2216236_2216791_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	52.8	2.0e-48
WP_044256264.1|2216954_2217134_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	4.1e-16
WP_094465290.1|2217123_2218008_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	85.5	8.0e-60
WP_094465292.1|2218007_2218886_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	85.7	2.0e-148
WP_094465294.1|2218878_2220744_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	57.9	3.3e-212
WP_167382407.1|2220743_2221061_+	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	48.6	3.8e-20
WP_044256254.1|2221057_2221444_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	84.0	4.0e-56
WP_094465858.1|2221547_2222417_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	46.1	1.4e-61
WP_094465296.1|2222413_2222935_+	hypothetical protein	NA	V5URU3	Shigella_phage	31.0	1.7e-17
WP_094465298.1|2222945_2223935_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	73.9	4.2e-150
WP_094465300.1|2223949_2224549_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.3	8.3e-77
WP_094465304.1|2224957_2226010_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	82.1	7.6e-174
WP_094465306.1|2226147_2226462_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	94.2	8.6e-49
WP_094465308.1|2226463_2226994_+	lysozyme	NA	H6WRZ4	Salmonella_phage	88.2	8.4e-89
WP_094465860.1|2227017_2227536_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	40.6	1.1e-08
WP_167382387.1|2228242_2232181_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.3	2.3e-143
WP_167382388.1|2232170_2232461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167382389.1|2232756_2233269_+|terminase	terminase	terminase	K7PJS9	Enterobacteria_phage	48.4	2.7e-15
WP_094465314.1|2233240_2235163_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	92.0	0.0e+00
WP_043001120.1|2235162_2235369_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	86.8	1.5e-25
WP_094465316.1|2235365_2236958_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	86.6	1.5e-274
WP_044257427.1|2236938_2238264_+	S49 family peptidase	NA	O64320	Escherichia_phage	78.5	3.2e-185
WP_094465318.1|2238273_2238603_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	72.6	9.3e-38
WP_094465864.1|2239081_2240317_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.2	1.4e-99
WP_094465320.1|2240318_2240552_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_094465322.1|2240562_2241384_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_072057059.1|2241409_2241601_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_094465324.1|2241737_2242025_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	53.7	4.9e-19
WP_094465326.1|2242017_2242206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054177289.1|2242198_2242510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465328.1|2242870_2244244_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	67.0	1.4e-172
2243282:2243298	attR	ATTAAACACCACCTGCC	NA	NA	NA	NA
WP_094465330.1|2244467_2245043_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	51.4	1.3e-47
WP_094465332.1|2245709_2246750_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	41.4	8.2e-64
WP_094465334.1|2246759_2247101_+|head	head decoration protein	head	NA	NA	NA	NA
WP_094465866.1|2247105_2247489_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_094465336.1|2247704_2248214_+|terminase	terminase	terminase	O64316	Escherichia_phage	45.4	3.9e-35
WP_094465868.1|2248240_2248831_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	66.3	2.0e-62
WP_094465337.1|2248827_2249214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465339.1|2249344_2250217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465341.1|2251235_2251634_+	hypothetical protein	NA	K7P7M3	Enterobacteria_phage	46.7	1.1e-16
WP_094465343.1|2251645_2251999_+|tail	phage tail protein	tail	K7PHD8	Enterobacteria_phage	67.5	3.0e-42
WP_094465345.1|2252008_2252563_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	85.9	5.9e-69
WP_094465347.1|2252559_2252958_+|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	72.7	1.4e-51
WP_094465349.1|2252965_2253703_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	80.4	6.0e-109
WP_094465351.1|2253737_2254151_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	49.3	1.6e-26
WP_046401854.1|2254159_2254492_+|tail	phage tail assembly protein T	tail	K7P6V0	Enterobacteria_phage	76.4	1.3e-42
WP_094465353.1|2254457_2256971_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	75.9	0.0e+00
WP_094465355.1|2256976_2257324_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	75.7	4.9e-45
WP_094465357.1|2257320_2258076_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	84.9	6.9e-129
WP_094465359.1|2258077_2258788_+	peptidase P60	NA	K7PGR2	Enterobacteria_phage	93.2	4.5e-138
WP_094465361.1|2258818_2259154_+	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	47.7	3.0e-23
WP_094465870.1|2259229_2259823_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	66.5	8.5e-66
WP_094465363.1|2259875_2263079_+	host specificity protein J	NA	O64335	Escherichia_phage	83.4	0.0e+00
WP_094465365.1|2263086_2264049_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	63.8	2.3e-116
WP_094465367.1|2266708_2267527_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_094465369.1|2267523_2268264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465371.1|2268365_2268605_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	87.3	1.2e-31
WP_094465375.1|2269361_2270408_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004892953.1|2270902_2271055_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_042320076.1|2271293_2271476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042319557.1|2271688_2272180_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042319554.1|2272349_2273654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465377.1|2273650_2274370_-	molecular chaperone	NA	NA	NA	NA	NA
WP_052425384.1|2274409_2276995_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_167382390.1|2277115_2277697_-	fimbrial protein	NA	NA	NA	NA	NA
WP_042319548.1|2278522_2279125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042319545.1|2279168_2279864_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_042319541.1|2280301_2281033_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.8	2.9e-55
WP_042319539.1|2281256_2282477_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_042319536.1|2282801_2283041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052425383.1|2283112_2283418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167382408.1|2283448_2283727_+	two-component-system connector protein AriR	NA	NA	NA	NA	NA
WP_042319534.1|2283840_2284401_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084196574.1|2284784_2284901_-	arsenate reductase	NA	NA	NA	NA	NA
WP_042320067.1|2284868_2286311_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	2924331	3001551	5130228	integrase,head,tail,transposase,tRNA,plate	Vibrio_phage(56.1%)	88	2957023:2957039	2981245:2981261
WP_042318579.1|2924331_2924916_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_042318577.1|2925032_2926124_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_052425369.1|2926223_2927909_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	1.2e-11
WP_139155865.1|2928574_2928829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042318574.1|2928922_2929402_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_042318573.1|2929461_2932617_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_042318571.1|2932640_2933816_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042318569.1|2934150_2934489_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052425368.1|2934681_2935500_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042318568.1|2935752_2936463_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_042318566.1|2936672_2936897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042318563.1|2937107_2938577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042318562.1|2938626_2940528_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_042318561.1|2940771_2941842_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_042318559.1|2941852_2942485_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_042318557.1|2942495_2943929_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_042318556.1|2944031_2945738_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_042318694.1|2945791_2947903_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_042318555.1|2948021_2948276_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_042318554.1|2948479_2949214_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_042318553.1|2949214_2949826_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_042318552.1|2949964_2950879_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_042318551.1|2950976_2952713_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_094465477.1|2952821_2953892_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_042318547.1|2953904_2955203_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_042318545.1|2955531_2957064_+	SpoVR family protein	NA	NA	NA	NA	NA
2957023:2957039	attL	GAACTGCTGGAGCGCTG	NA	NA	NA	NA
WP_042318544.1|2957097_2957817_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_042318543.1|2958039_2959584_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_042318542.1|2959725_2960256_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_080343242.1|2960304_2960766_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_042318541.1|2960843_2961503_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_042318540.1|2961571_2961865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042318538.1|2961991_2962699_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_042318537.1|2962722_2963535_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|2963538_2963805_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_167382392.1|2964798_2965467_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_042318536.1|2965614_2966043_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	48.6	8.7e-28
WP_042318535.1|2966076_2966937_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042318533.1|2967118_2968003_+	SED family class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	72.9	3.7e-105
WP_094465479.1|2968462_2969017_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	83.5	4.4e-80
WP_094465481.1|2969446_2969689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465483.1|2969666_2970092_-|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	45.2	3.2e-22
WP_094465485.1|2970450_2970879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465487.1|2970890_2971316_+|tail	tail assembly chaperone	tail	S5FXM8	Shigella_phage	37.0	6.4e-15
WP_046493927.1|2971287_2971881_-|tail	phage tail protein	tail	K7PMC4	Enterobacterial_phage	56.1	1.0e-55
WP_094465489.1|2971880_2972699_-|integrase	integrase	integrase	K7PH60	Enterobacterial_phage	47.1	2.5e-31
WP_058587150.1|2972698_2973289_-	DUF2313 domain-containing protein	NA	M4M9M8	Vibrio_phage	49.7	5.4e-52
WP_094465491.1|2973273_2974350_-|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.7	2.1e-99
WP_058587152.1|2974339_2974792_-	phage GP46 family protein	NA	M1PPW1	Vibrio_phage	46.9	6.8e-23
WP_094465493.1|2974788_2975331_-|plate	phage baseplate assembly protein	plate	M1Q572	Vibrio_phage	39.9	4.2e-27
WP_094465494.1|2975321_2976413_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	46.5	1.7e-88
WP_094465496.1|2976412_2977744_-	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	37.2	8.3e-77
WP_094465498.1|2977743_2979660_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	35.0	1.1e-61
WP_058587157.1|2979746_2980142_-	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	3.1e-19
WP_058587158.1|2980145_2980502_-|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	43.8	5.9e-22
WP_058587159.1|2980511_2981990_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	54.6	2.3e-152
2981245:2981261	attR	CAGCGCTCCAGCAGTTC	NA	NA	NA	NA
WP_058587160.1|2981989_2982178_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_094465500.1|2982170_2982782_-	hypothetical protein	NA	M4MHF0	Vibrio_phage	43.9	1.6e-35
WP_094465502.1|2982778_2983321_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	59.8	8.1e-55
WP_094465504.1|2983320_2983761_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.3	1.7e-34
WP_094465506.1|2983760_2984363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465508.1|2984446_2985340_-|head	phage head protein	head	M4MB71	Vibrio_phage	55.7	3.8e-94
WP_058587166.1|2985343_2986300_-	peptidase	NA	M1Q578	Vibrio_phage	50.8	8.9e-81
WP_058587167.1|2986503_2987298_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.9	1.3e-90
WP_058587168.1|2987290_2988859_-	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	54.8	9.6e-157
WP_094465510.1|2988858_2990442_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	3.5e-199
WP_058587170.1|2990438_2991017_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	50.8	3.5e-40
WP_094465512.1|2991006_2991279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465514.1|2991268_2991646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587173.1|2991648_2991936_-	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	1.1e-26
WP_058587174.1|2991947_2992253_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	36.2	1.3e-12
WP_058587175.1|2992253_2992460_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_094465516.1|2992456_2993065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465518.1|2993052_2993460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587178.1|2993452_2993671_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	72.2	3.2e-26
WP_094465520.1|2993672_2994263_-	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	45.7	4.1e-36
WP_094465522.1|2994348_2994867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465524.1|2994879_2995287_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	2.3e-38
WP_094465526.1|2995283_2995811_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	48.1	1.7e-41
WP_139155866.1|2995807_2996023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094465530.1|2996029_2996464_-	hypothetical protein	NA	R9TQX3	Aeromonas_phage	86.0	8.6e-15
WP_058587185.1|2996553_2997081_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.7	3.7e-44
WP_094465532.1|2997094_2997349_-	host nuclease inhibitor protein	NA	A0A0U5KSG7	unidentified_phage	48.1	3.5e-16
WP_058587187.1|2997366_2997606_-	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	55.4	2.8e-15
WP_094465534.1|2997610_2998549_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	49.3	1.3e-76
WP_094465536.1|2998627_3000610_-|transposase	transposase	transposase	A0A0C4UR24	Shigella_phage	51.8	1.3e-190
WP_058587190.1|3000609_3000846_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	54.5	8.7e-14
WP_094465538.1|3001029_3001551_+	helix-turn-helix transcriptional regulator	NA	A0A076FRF7	Pseudomonas_phage	50.0	6.5e-09
>prophage 7
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	3346652	3355073	5130228	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_094465584.1|3346652_3348686_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	8.0e-55
WP_042318022.1|3348887_3349346_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	66.7	3.9e-50
WP_042318021.1|3349391_3349862_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.8	1.6e-62
WP_042318020.1|3349908_3350628_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_042318019.1|3350620_3352309_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.7	1.3e-279
WP_042318017.1|3352531_3353263_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.5	5.2e-105
WP_042318015.1|3353322_3353430_+	protein YohO	NA	NA	NA	NA	NA
WP_042318013.1|3353410_3354142_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_042318011.1|3354125_3355073_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.5	9.0e-09
>prophage 8
NZ_CP022695	Citrobacter farmeri strain AUSMDU00008141 chromosome, complete genome	5130228	3824087	3869796	5130228	tRNA,transposase,integrase	Escherichia_phage(66.67%)	38	3861344:3861361	3879924:3879941
WP_042325913.1|3824087_3824855_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_042325915.1|3824899_3825448_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_042325918.1|3825466_3825715_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_042325920.1|3825970_3827332_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_042325922.1|3827497_3828289_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_102601129.1|3828308_3829595_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_042325925.1|3829674_3830268_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_042325929.1|3830390_3831269_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_042325930.1|3831354_3833016_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_042325933.1|3833165_3833510_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_084196690.1|3833566_3833857_-	RnfH family protein	NA	NA	NA	NA	NA
WP_071887579.1|3833846_3834323_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_042325938.1|3834453_3834936_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	1.4e-29
WP_094465630.1|3835552_3836755_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_167382396.1|3836751_3837495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3837506_3838211_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|3838216_3838357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075255.1|3839003_3840017_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_012695484.1|3840179_3840761_+	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_006473457.1|3841248_3842604_+|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695485.1|3842845_3843655_+	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_012695486.1|3843782_3844196_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_167382377.1|3844467_3844605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012695487.1|3844558_3844990_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000679427.1|3846299_3846647_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3846640_3847480_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|3847607_3848108_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|3848183_3848888_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977770.1|3848833_3849265_-	hypothetical protein	NA	A0A077SK32	Escherichia_phage	97.3	2.9e-55
WP_002903955.1|3850521_3851424_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|3851685_3852447_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|3852467_3853328_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|3853464_3854169_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094465632.1|3854344_3863083_+	type I secretion C-terminal target domain-containing protein	NA	NA	NA	NA	NA
3861344:3861361	attL	GTACTGGACAAACTGAGC	NA	NA	NA	NA
WP_094465634.1|3863166_3864573_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_042325942.1|3864569_3866756_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	35.1	2.6e-19
WP_042325944.1|3866736_3867927_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_094465636.1|3868554_3869796_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	7.0e-102
3879924:3879941	attR	GCTCAGTTTGTCCAGTAC	NA	NA	NA	NA
>prophage 1
NZ_CP022696	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence	328945	22628	110478	328945	protease,transposase,integrase	Escherichia_phage(30.0%)	89	63899:63958	93782:94603
WP_072201439.1|22628_23597_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_000952689.1|24040_24493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836981.1|24482_24908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235773.1|24916_25471_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_001232109.1|25590_29895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286760.1|30172_30685_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001256132.1|30671_32183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447965.1|32321_33383_+	TraU family protein	NA	NA	NA	NA	NA
WP_000776701.1|33401_36590_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000771834.1|36618_37491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517885.1|37670_39455_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	23.1	6.0e-22
WP_000041927.1|39849_40722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120822.1|40779_41157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000810361.1|41217_42195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000063335.1|42252_43311_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001176645.1|43442_43616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174396.1|43679_44807_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_000762700.1|44883_46890_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000192120.1|46962_47184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220379.1|47297_48530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011130.1|48799_49321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762003.1|49399_50278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691119.1|50347_51283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991697.1|51351_52272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000472041.1|52338_53277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000149830.1|53448_54405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004200.1|54668_54944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578891.1|54988_55579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371933.1|55586_55844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107167.1|55917_56454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001424628.1|56533_56917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119428.1|57007_57970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198595.1|57979_58885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795949.1|59186_60362_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60531_60744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033487958.1|61104_62187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|62766_63471_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
63899:63958	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
WP_032488579.1|64074_64629_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
63899:63958	attL	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCG	NA	NA	NA	NA
WP_012695455.1|64856_65597_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_077249983.1|65583_67092_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_001067855.1|67251_67956_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011191340.1|68214_68463_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_001173919.1|68589_69165_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_000845048.1|69507_70521_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001261740.1|70666_71458_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
70522:70635	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCA	NA	NA	NA	NA
WP_000679427.1|71621_71969_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
70522:70635	attR	GGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCA	NA	NA	NA	NA
WP_000259031.1|71962_72802_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|72929_73430_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|73936_74701_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000050481.1|75163_76705_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|76968_77625_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_004193231.1|77810_78686_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|78689_79055_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|78947_79283_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|79276_80116_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|80520_82062_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|82325_82982_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_004193231.1|83167_84043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|84046_84412_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|84304_84640_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|84633_85473_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|85877_87419_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|87684_88185_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|88184_88754_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_000845039.1|89356_90370_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001082319.1|90527_91331_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|91330_92167_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_004248792.1|92347_93139_+|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000057569.1|93153_93495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|93834_94539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|94550_95207_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|95302_96487_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|96581_97691_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|98180_98885_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|99194_100088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|100259_100490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|100668_100989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|101505_101817_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|101821_102313_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781547.1|102865_103069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|103123_103348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|103387_103588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|103810_104122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802040.1|104175_104352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|104497_104779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137794.1|104995_105601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|105933_107302_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|107477_108818_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|109239_110478_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
>prophage 2
NZ_CP022696	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence	328945	153633	185734	328945	transposase	uncultured_Caudovirales_phage(42.86%)	36	NA	NA
WP_100185530.1|153633_154548_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_000900745.1|154713_155031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|155081_155489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|155946_156618_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|156662_156968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|156990_157308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|157521_158925_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|158953_159586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652343.1|159660_160629_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|160848_162252_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|162284_162989_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|163075_163396_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|163441_164731_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|164743_165169_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|165228_166056_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|166074_167553_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|168044_168320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|168460_168658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|169644_169902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|169975_170290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|170337_171234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|171236_171752_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|171966_173394_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|173454_173622_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078513.1|173644_174964_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|174976_175180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|175243_176449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|176445_177264_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|177729_178002_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|178124_179240_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|179497_179932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|180149_181496_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_072196614.1|181534_182503_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|182691_184311_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|184387_184864_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|185029_185734_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP022696	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence	328945	217713	293027	328945	protease,transposase,integrase	Escherichia_phage(52.0%)	77	210426:210438	220985:220997
210426:210438	attL	GCTGTATCCGACC	NA	NA	NA	NA
WP_000174662.1|217713_218478_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.9e-25
WP_001067855.1|218954_219659_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001143760.1|223450_226456_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
220985:220997	attR	GGTCGGATACAGC	NA	NA	NA	NA
WP_001235713.1|226619_227177_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|227359_228220_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001371925.1|228549_228930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|228987_229653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|230207_230444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100635.1|230469_230763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287391.1|230940_231345_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000784387.1|231951_232809_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001224686.1|232824_233133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278471.1|233681_234107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|234784_235240_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|235311_235677_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|235692_235968_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|235995_236421_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|236459_238145_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|238162_238528_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|238524_238761_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|238744_238864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|238826_239039_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_094465914.1|239047_240124_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_033488201.1|240120_242526_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.0	3.9e-141
WP_000405672.1|242611_243046_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_050868990.1|243136_244141_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001805097.1|244322_244847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|244859_245270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134171.1|245370_245577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088044.1|245637_246963_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_012477377.1|246967_247261_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012695445.1|247661_249050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340139.1|249054_249552_-	membrane protein	NA	NA	NA	NA	NA
WP_000462754.1|249754_250411_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000341066.1|251069_251462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211823.1|252382_253369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|254289_254994_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|255064_255829_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|256321_256906_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|256905_258144_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|258140_259046_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|259167_259872_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|260104_260965_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|260977_261520_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|262001_262193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|262216_262444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|262494_263631_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|263597_263747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000971921.1|263745_265116_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342213.1|265257_265383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|265936_266797_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000427619.1|267322_268327_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|268405_271372_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001067855.1|271492_272197_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000130000.1|272476_272782_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|272792_273998_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|274153_274357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|274484_275324_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|275317_275665_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|275887_276340_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|276424_277057_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|277194_278025_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|278155_278710_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|280272_280977_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|281113_281974_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|281994_282756_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|283017_283920_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_011977770.1|285176_285608_+	hypothetical protein	NA	A0A077SK32	Escherichia_phage	97.3	2.9e-55
WP_001067855.1|285553_286258_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|286337_286838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|286987_287629_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|287772_288477_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|288992_289187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|289183_289495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|289557_289797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|291612_291942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072223036.1|292058_293027_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
>prophage 1
NZ_CP022697	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence	149207	1365	75874	149207	protease,transposase,integrase	Escherichia_phage(33.33%)	61	1182:1195	33389:33402
1182:1195	attL	AAACTTCCACCATT	NA	NA	NA	NA
WP_022652310.1|1365_2106_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_001572362.1|3181_4204_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652309.1|4710_6189_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430841.1|6206_7034_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652307.1|7115_7319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021314637.1|7596_7827_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_050483874.1|8998_9508_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022652300.1|10098_11052_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|11672_12383_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|12384_13590_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|13586_14738_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|14734_15343_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652300.1|15530_16484_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|16902_17232_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|17212_17494_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|17771_18752_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_022652299.1|19074_19683_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652298.1|20059_21871_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.8	1.1e-302
WP_022652297.1|21867_23241_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652296.1|23289_24555_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652295.1|24856_26041_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652294.1|26147_27617_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652293.1|27636_29067_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_032430963.1|29284_30073_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_022652290.1|30955_33853_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	1.2e-181
33389:33402	attR	AATGGTGGAAGTTT	NA	NA	NA	NA
WP_001067855.1|34157_34862_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|35082_38049_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|38127_39132_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|39313_39490_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|39819_40635_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|40721_41024_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|40917_41169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|41199_42693_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|42903_43128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|43124_43862_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|44347_44488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|44493_45198_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|45277_45778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|45927_46569_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|46712_47417_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|47428_48085_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|48180_49365_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|49459_50569_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001067855.1|51058_51763_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_022652277.1|52423_54583_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.5	5.4e-25
WP_001567323.1|54582_55836_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001567322.1|55838_56489_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000027057.1|57549_58410_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|58592_59150_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|59313_62319_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_022652279.1|63370_64027_-	recombinase family protein	NA	NA	NA	NA	NA
WP_022652281.1|66325_67306_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_022652283.1|67700_68312_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_022652284.1|68308_69259_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.9	2.0e-77
WP_040219232.1|69405_69606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|69739_70444_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612591.1|71783_72131_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|72127_72508_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_052687741.1|72635_73841_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	1.0e-09
WP_045342033.1|73940_74258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|75169_75874_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP022697	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence	149207	137539	147467	149207	transposase	Stx2-converting_phage(37.5%)	8	NA	NA
WP_022652318.1|137539_138505_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652317.1|138504_139671_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_032430835.1|140496_141855_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_094465919.1|141911_143435_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.1	3.5e-257
WP_000609174.1|143484_143832_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|143828_144212_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_022652315.1|144320_145472_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_077873527.1|146573_147467_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
>prophage 1
NZ_CP022698	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence	107249	50	9300	107249		Escherichia_phage(57.14%)	9	NA	NA
WP_004118283.1|50_917_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|2026_3232_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_011977819.1|3231_4206_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977820.1|4287_5559_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	1.1e-150
WP_001568036.1|5558_5990_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_011977821.1|6223_7195_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	8.2e-74
WP_032435767.1|7197_7869_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|7931_8162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977792.1|8598_9300_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.4e-27
>prophage 2
NZ_CP022698	Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence	107249	53703	84699	107249	integrase,transposase	Escherichia_phage(25.0%)	27	61305:61319	95966:95980
WP_085956494.1|53703_54907_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.2	4.8e-100
WP_004198206.1|54941_55631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153015.1|58071_63333_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
61305:61319	attL	GCTGGCCGATATGGC	NA	NA	NA	NA
WP_004152379.1|63413_64139_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
WP_004152380.1|64210_64804_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015060010.1|64964_65567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|65616_66261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152382.1|66316_66967_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|66963_67272_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_014343478.1|67447_67927_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	2.7e-17
WP_013609506.1|68044_68314_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171450.1|68545_68623_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152386.1|68615_69473_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093200.1|69523_69682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093201.1|69766_69901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152388.1|70691_71255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152389.1|71238_71850_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_004152390.1|72058_72220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|72246_73239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001404092.1|73287_73443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152391.1|73737_75453_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|75562_78592_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|78698_79724_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|79720_80500_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|80787_81669_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|81918_83238_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|83514_84699_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
95966:95980	attR	GCCATATCGGCCAGC	NA	NA	NA	NA
