The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	484969	494954	2895726		Prochlorococcus_phage(22.22%)	11	NA	NA
WP_094396828.1|484969_486496_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.9e-69
WP_094396829.1|486512_487121_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-23
WP_094044352.1|487117_488128_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.4	1.8e-71
WP_094396830.1|488144_489542_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	2.7e-62
WP_013298556.1|489551_490259_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	41.6	5.1e-41
WP_094396831.1|490259_490751_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.5	3.8e-27
WP_094396832.1|490830_492279_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.7	1.7e-46
WP_094396833.1|492825_493158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094396834.1|493306_493687_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	47.3	4.0e-24
WP_023062295.1|493710_493986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094398112.1|494006_494954_-	DUF5131 family protein	NA	A0A1B1IPY1	uncultured_Mediterranean_phage	30.2	3.2e-30
>prophage 2
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	505226	513925	2895726	integrase	Clostridium_phage(33.33%)	8	506592:506606	521982:521996
WP_094396846.1|505226_506222_-	DUF4373 domain-containing protein	NA	H7BVC7	unidentified_phage	41.1	2.5e-49
WP_094396847.1|506225_506462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
506592:506606	attL	CAAAAAGCTTTAAAG	NA	NA	NA	NA
WP_094396848.1|506618_507179_+	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	43.0	3.7e-10
WP_094396849.1|507270_507786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094396850.1|507839_508946_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	56.7	1.5e-111
WP_094396851.1|509025_510564_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	3.4e-21
WP_015312250.1|510577_512032_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	43.2	8.7e-104
WP_094396852.1|512299_513925_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.0	1.7e-156
521982:521996	attR	CAAAAAGCTTTAAAG	NA	NA	NA	NA
>prophage 3
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	1068231	1114201	2895726	transposase,integrase	Bacillus_phage(28.57%)	41	1090822:1090839	1124013:1124030
WP_094046709.1|1068231_1069485_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094397190.1|1069709_1070426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094397191.1|1070619_1070976_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094397192.1|1071134_1071758_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_094044130.1|1071765_1072245_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_013299083.1|1072258_1072426_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_015312690.1|1072438_1073560_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.0	6.7e-11
WP_094397193.1|1073643_1074894_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_094397194.1|1075015_1075834_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_094397195.1|1075849_1077103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094044122.1|1077115_1077511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094398127.1|1077657_1079355_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.2	8.8e-39
WP_013299090.1|1079344_1080043_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.1	4.3e-40
WP_013299091.1|1080049_1080865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094397196.1|1081024_1082290_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	47.9	1.9e-22
WP_094044114.1|1082476_1083448_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_174664666.1|1083437_1084421_+	ATP-binding protein	NA	H7BWC4	unidentified_phage	34.8	1.1e-14
WP_094397197.1|1084417_1085860_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_094397198.1|1086049_1086664_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_094397199.1|1086940_1088611_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_094397200.1|1088829_1089879_+	DUF1646 family protein	NA	NA	NA	NA	NA
WP_094398128.1|1089980_1090652_-	hypothetical protein	NA	NA	NA	NA	NA
1090822:1090839	attL	GCATACATTTCGCATACA	NA	NA	NA	NA
WP_013299110.1|1090872_1091676_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_094397201.1|1092260_1093598_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_174664667.1|1096627_1096870_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.8	1.9e-11
WP_094398129.1|1098229_1099033_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_094397202.1|1099309_1100014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164906163.1|1100142_1100571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045413510.1|1100678_1100879_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094398130.1|1100941_1101547_+	molecular chaperone	NA	NA	NA	NA	NA
WP_094397204.1|1101540_1102938_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_094397205.1|1103225_1103492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397206.1|1104411_1104672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397207.1|1105053_1105947_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_094397208.1|1106283_1107003_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
WP_094397209.1|1107061_1107616_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_094397210.1|1107761_1108592_-	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_094397211.1|1108613_1109840_-	Tm-1-like ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_094397212.1|1110033_1111884_-	phosphoenolpyruvate hydrolase family protein	NA	NA	NA	NA	NA
WP_094397213.1|1112136_1112454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174664687.1|1112962_1114201_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	36.2	6.0e-53
1124013:1124030	attR	GCATACATTTCGCATACA	NA	NA	NA	NA
>prophage 4
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	1181147	1190096	2895726	tRNA	Staphylococcus_phage(50.0%)	9	NA	NA
WP_094397245.1|1181147_1182803_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	34.2	1.5e-67
WP_164906164.1|1183032_1184115_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.1	1.6e-54
WP_094397246.1|1184123_1184744_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.1	5.1e-37
WP_094397247.1|1184817_1186008_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.9	6.7e-110
WP_015310609.1|1186031_1186499_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.0	6.8e-42
WP_015310610.1|1186551_1187616_-	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_013296602.1|1187707_1187875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013296603.1|1188021_1188558_+	signal peptidase I	NA	NA	NA	NA	NA
WP_094045973.1|1188824_1190096_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.6	1.2e-96
>prophage 5
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	1330416	1340556	2895726		Hokovirus(28.57%)	9	NA	NA
WP_015310725.1|1330416_1331430_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.7	3.9e-26
WP_015310726.1|1331450_1332848_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_013296746.1|1333005_1333854_+	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	28.1	1.9e-05
WP_013296747.1|1334016_1334298_+	septation regulator SpoVG	NA	NA	NA	NA	NA
WP_094045693.1|1334404_1335778_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	38.0	1.1e-34
WP_013296749.1|1335780_1336731_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	36.1	3.5e-45
WP_013296750.1|1336832_1337516_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.1	4.4e-50
WP_015310729.1|1337517_1338939_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.2	1.2e-20
WP_094045695.1|1339197_1340556_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	1.2e-22
>prophage 6
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	1415485	1446352	2895726	transposase,terminase,integrase	Clostridium_phage(50.0%)	28	1441227:1441246	1446481:1446500
WP_094396859.1|1415485_1416928_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013296814.1|1417095_1417371_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	59.6	2.3e-21
WP_013296815.1|1417416_1417656_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_174664697.1|1417781_1418717_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	30.6	1.8e-22
WP_013296817.1|1418797_1419091_+	sporulation protein YabP	NA	NA	NA	NA	NA
WP_013296818.1|1419158_1419791_+	MtnX-like HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_094397351.1|1419792_1421412_-	putative manganese-dependent inorganic diphosphatase	NA	NA	NA	NA	NA
WP_094397352.1|1421572_1422049_+	spore cortex biosynthesis protein YabQ	NA	NA	NA	NA	NA
WP_094045572.1|1422126_1422426_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_015310889.1|1422625_1423879_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013296822.1|1424142_1424565_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_094397353.1|1424609_1425530_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_094398138.1|1425842_1426460_-	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_164906167.1|1426696_1427341_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	56.7	1.7e-59
WP_094397355.1|1427352_1427637_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_094046703.1|1427788_1429231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094397356.1|1429439_1429721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094398139.1|1432158_1432539_-	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	50.0	2.5e-18
WP_094397357.1|1432941_1433160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397358.1|1433330_1433846_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_094397359.1|1434283_1435459_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_094397360.1|1435567_1436977_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
1441227:1441246	attL	TGATTCCACTGCAAAAAGTC	NA	NA	NA	NA
WP_094397361.1|1441411_1441924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397362.1|1442240_1443044_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_094397363.1|1443065_1444304_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_094397364.1|1444534_1445107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094397365.1|1445342_1446065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397366.1|1445998_1446352_+|transposase	transposase	transposase	NA	NA	NA	NA
1446481:1446500	attR	GACTTTTTGCAGTGGAATCA	NA	NA	NA	NA
>prophage 7
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	2100681	2118522	2895726	protease,tail,terminase,portal,head	Erysipelothrix_phage(87.5%)	24	NA	NA
WP_094045305.1|2100681_2101233_+|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	67.6	9.1e-70
WP_094045303.1|2101232_2101415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094397702.1|2102694_2103948_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	46.7	1.3e-100
WP_094397703.1|2104064_2104757_+	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	35.2	4.8e-28
WP_013782363.1|2104749_2105085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013782362.1|2105081_2105312_+	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_094397704.1|2105453_2106353_+	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	41.1	4.3e-53
WP_094397705.1|2106414_2106882_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_094397706.1|2106885_2107080_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_094397707.1|2107134_2108787_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.4	1.5e-245
WP_094397708.1|2108783_2110106_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.2	5.2e-188
WP_003516023.1|2110044_2110770_+|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.1	8.5e-76
WP_094398159.1|2112006_2112315_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	73.5	3.3e-37
WP_094045289.1|2112317_2112653_+|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	56.0	1.4e-28
WP_094045287.1|2112669_2113101_+	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	60.8	7.9e-45
WP_094045285.1|2113097_2113442_+	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	58.6	1.8e-31
WP_094045283.1|2113447_2114047_+|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	74.7	1.4e-79
WP_094045323.1|2114046_2114430_+	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.0	5.7e-39
WP_003520671.1|2114426_2114618_+	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	75.6	3.9e-12
WP_013810281.1|2114666_2115071_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_004463997.1|2115067_2115340_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_094397709.1|2115473_2117660_+|tail	phage tail protein	tail	A0A2K5B297	Erysipelothrix_phage	38.5	2.4e-12
WP_094397710.1|2117673_2118075_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034841962.1|2118282_2118522_-	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	39.5	4.4e-05
>prophage 8
NZ_CP016893	Thermoanaerobacterium thermosaccharolyticum strain TG57 chromosome, complete genome	2895726	2750142	2759892	2895726	tRNA	Moumouvirus(16.67%)	10	NA	NA
WP_094045048.1|2750142_2751444_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	33.3	1.1e-62
WP_094398027.1|2751523_2752414_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	46.9	9.2e-56
WP_174664713.1|2752421_2753714_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_094045054.1|2753741_2754365_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	57.6	5.5e-15
WP_013297855.1|2754423_2755407_-	tyrosine recombinase XerC	NA	S5M9V8	Brevibacillus_phage	28.3	4.2e-17
WP_094045058.1|2755491_2755941_-	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	50.0	5.2e-31
WP_013297853.1|2755942_2756734_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_013297852.1|2756806_2757061_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_094398028.1|2757104_2758055_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_094398029.1|2758065_2759892_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.7	4.8e-75
