The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	119043	157509	5456357	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	148622:148636	154631:154645
WP_004152576.1|119043_119910_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|119909_120683_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|120679_121876_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|121875_122229_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|122230_122884_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|122937_123504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|123546_123729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|123778_124120_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|124119_125142_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|125144_125447_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|125447_126047_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|126046_128050_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|128039_128192_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|128227_128653_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|128656_129097_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|129107_130253_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|130256_130697_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|130791_131178_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|131177_131684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|131680_132100_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|132068_132350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|132389_133331_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|133342_133837_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|133840_135043_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|135094_135643_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|135698_137150_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|137387_138788_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|138738_139491_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|139592_139913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|140147_140537_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|140533_141064_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|141066_141315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|141720_142503_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|142499_142976_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|142972_143935_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|143936_145595_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|146171_146393_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|146490_147159_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|147329_147644_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|147636_147825_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|147994_148360_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|148352_148607_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|148578_148797_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
148622:148636	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|148793_149219_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|149215_149410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|149406_150234_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|150338_150857_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|150862_151573_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|151562_151787_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|151783_151996_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|151992_152472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|152650_152893_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|152873_154055_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|154251_154800_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
154631:154645	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|154998_156531_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|156747_157509_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 2
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	190442	221486	5456357	holin,integrase,transposase	Enterobacteria_phage(35.48%)	41	190224:190239	218792:218807
190224:190239	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|190442_191114_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|191300_192128_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|192203_193469_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|193470_193890_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|193969_195454_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|196351_196774_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|197366_198071_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|198686_199034_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|199197_199989_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|200970_201675_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|201711_201999_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|201995_202535_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|202531_202831_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|203480_204170_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|204169_204310_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|204306_204945_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|204937_205606_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|205602_205770_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|205750_206218_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|206738_207767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|207974_208220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|208275_208578_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|208574_209423_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|209419_210280_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|210365_210587_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|210627_210855_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|210966_211665_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|211687_211807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|211952_213029_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|213110_213314_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|213742_213937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|214025_214310_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|214325_215171_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|215167_215455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|215456_216137_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|216133_216562_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|216558_217221_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|217428_218616_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|218792_219683_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
218792:218807	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|219682_220675_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|220676_221486_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 3
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	350224	438103	5456357	portal,lysis,tail,capsid,head,integrase,tRNA,terminase	Klebsiella_phage(44.19%)	93	377027:377041	435914:435928
WP_002901088.1|350224_350725_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|350841_351288_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|351271_352063_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|352164_353349_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|353380_354073_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|354218_354728_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|354714_355071_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|355060_355300_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|355600_356614_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|356671_356773_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|356772_356847_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|356964_357090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|357149_357413_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|357543_358182_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|358271_359186_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|359847_360891_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|361193_362402_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|362475_364260_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|364266_365157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|365277_366786_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|367096_367783_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|368232_368421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|368399_369032_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|369598_369796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|369911_370922_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|370918_372325_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|372380_373268_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|373284_373791_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|373817_374312_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|374402_374588_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|375209_376403_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|376515_376743_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
377027:377041	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|377179_377503_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|377495_377888_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|377884_378598_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|378870_379023_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|379177_380674_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_073547060.1|380742_393447_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|393509_394103_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|394129_394552_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|394593_395304_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|395305_396061_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|396057_396396_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|396395_399731_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|399963_400329_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|400386_400848_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|400879_401281_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|401277_401667_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|401647_401986_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|401982_402300_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|402280_402541_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|402599_403886_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|403963_404884_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|404920_406180_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|406179_406359_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|406352_408074_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|408073_408508_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|408756_409188_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|409184_409508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|409459_409822_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|410148_410373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|410411_410849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|411798_412149_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|412145_412643_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|412642_412858_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|413775_413925_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|414662_414866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|415109_415712_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|415728_416760_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|416959_417352_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|417392_417683_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|417694_417928_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|418006_419491_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|420331_421693_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|421866_422580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|422931_423801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|423889_425281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|425629_426070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|426083_426548_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|426540_427545_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|427604_428159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|428161_428386_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|428474_428912_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|429233_429548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|429938_430133_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|430175_430520_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|430661_432800_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|432852_433098_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|433078_434206_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|434323_435574_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|435814_436465_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
435914:435928	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|436481_436940_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|436996_438103_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	654446	739852	5456357	portal,lysis,tail,capsid,head,protease,integrase,plate,tRNA,transposase,terminase	Salmonella_phage(47.92%)	80	709972:709990	739927:739945
WP_002898139.1|654446_655739_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|655829_657173_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|657181_657793_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|657915_662169_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|662304_662799_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|663304_664300_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|664414_666181_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|666181_667903_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|667947_668649_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|669002_669221_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|669341_671621_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|671651_671969_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|672294_672516_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|672592_674533_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|674529_675645_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|675791_677450_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|677869_678565_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|678680_679580_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|679723_681376_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|681386_682355_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|682566_683001_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|683152_684871_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|684909_685911_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|685921_687364_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|687451_688465_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|688461_689292_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|689323_690463_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|691340_691856_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|692082_692811_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|692831_693563_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|693569_694286_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|694285_694954_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|695137_695869_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|695911_697384_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|697380_698097_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|698175_699303_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|699344_699833_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|699890_700736_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|700732_701686_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|701696_702830_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|702993_704106_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|704454_704934_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|705022_705925_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|706746_707034_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|707236_707500_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|707506_707890_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|708156_709842_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
709972:709990	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|710061_710280_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|710371_711472_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|711468_711954_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|711950_714578_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|714570_714690_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|714704_715004_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|715056_715572_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|715581_716754_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|716892_717969_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|717998_718202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|718198_718930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|718933_721885_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|721886_722486_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|722478_723387_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|723373_723736_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|723732_724305_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|724399_725092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|725088_725535_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|725527_725959_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|726054_726483_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|726479_726863_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|726867_727377_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|727357_727573_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|727576_727780_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|727779_728244_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|728339_728990_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|728993_730052_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|730068_730902_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|731044_732811_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|732810_733836_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|733897_735640_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000019473.1|735987_736968_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004151720.1|738799_739852_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
739927:739945	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 5
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	1393546	1405199	5456357	integrase	Enterobacteria_phage(70.0%)	13	1393996:1394010	1417052:1417066
WP_004144574.1|1393546_1394650_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1393996:1394010	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|1394660_1395914_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|1396266_1397457_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|1397444_1398395_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|1398394_1398820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|1399387_1399954_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|1399971_1400217_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|1400213_1400951_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|1401492_1401759_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|1401755_1402313_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|1402309_1402537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|1402533_1402854_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|1402865_1405199_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
1417052:1417066	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 6
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	1873446	1881563	5456357	transposase	Enterobacteria_phage(83.33%)	8	NA	NA
WP_004152207.1|1873446_1875780_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|1875794_1876115_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|1876111_1876339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|1876335_1876884_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|1877707_1878445_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|1878441_1878687_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|1878704_1879271_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_000019473.1|1880582_1881563_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 7
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	2954075	2987333	5456357	portal,tail,capsid,head,protease,integrase,tRNA,terminase	uncultured_Caudovirales_phage(73.33%)	33	2971683:2971700	2987678:2987695
WP_002919147.1|2954075_2955023_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|2955037_2955547_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|2955675_2956800_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|2956771_2957245_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|2957270_2957813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|2957817_2958390_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|2958393_2959212_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|2959208_2959466_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|2959441_2959996_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|2965791_2966013_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|2966306_2969417_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|2969429_2970569_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|2970947_2971598_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
2971683:2971700	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|2971873_2973100_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|2973192_2974134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|2974315_2974600_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|2974610_2975390_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|2975841_2976111_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|2976103_2976292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|2976284_2976599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|2976595_2976964_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|2976960_2977326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2977325_2979461_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|2979803_2980139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|2980187_2980700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|2980963_2982130_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|2982181_2982742_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|2982743_2983985_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|2983981_2984317_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|2984313_2984613_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|2984612_2985056_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|2985331_2985688_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|2985671_2987333_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
2987678:2987695	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 8
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	3741351	3790495	5456357	portal,lysis,tail,capsid,head,integrase,plate,coat,tRNA,transposase,terminase	Salmonella_phage(79.55%)	61	3740766:3740812	3779121:3779167
3740766:3740812	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000019473.1|3741351_3742332_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|3742377_3743376_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|3743378_3744008_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|3744130_3744373_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|3744405_3744915_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|3744922_3745123_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|3745086_3745425_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|3745492_3745726_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|3745725_3745953_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|3745949_3746801_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|3746797_3749182_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|3749662_3751147_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|3751254_3751443_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|3751454_3751688_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|3751783_3752467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|3752453_3753533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|3753532_3754534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|3755055_3755325_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|3755381_3756425_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|3756424_3758188_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|3758328_3759162_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|3759178_3760231_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|3760234_3760888_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|3760983_3761448_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|3761447_3761651_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|3761654_3761870_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|3761850_3762360_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|3762364_3762748_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|3762744_3763173_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|3763268_3763691_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|3763683_3764130_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|3764152_3765019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|3765113_3765686_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|3765682_3766045_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|3766031_3766940_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|3766932_3767604_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|3767605_3769555_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|3769564_3770683_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|3770734_3771808_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|3771956_3773129_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|3773138_3773654_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|3773706_3774006_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|3774020_3774140_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|3774132_3776763_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|3776759_3777245_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|3777241_3778336_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|3778402_3778621_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|3778648_3779026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|3779629_3780112_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
3779121:3779167	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|3780222_3780699_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|3780688_3780979_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|3781045_3781387_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|3781534_3783196_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|3783282_3784161_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|3784285_3784876_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|3784995_3786282_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|3786301_3787093_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|3787256_3788621_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|3788880_3789129_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|3789147_3789696_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|3789727_3790495_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	3895211	3947954	5456357	tail,holin,integrase,transposase,terminase	Salmonella_phage(40.0%)	57	3888546:3888560	3918651:3918665
3888546:3888560	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|3895211_3896678_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|3896745_3898323_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|3898514_3899765_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|3899707_3899950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|3899946_3900540_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|3900536_3901199_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|3901195_3901354_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|3901346_3901640_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|3901749_3901998_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|3902046_3902928_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|3902924_3903746_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|3903742_3904042_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|3904408_3904990_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|3905144_3905378_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|3905524_3905734_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|3905733_3906501_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|3906497_3907283_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|3907402_3907750_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|3907942_3908353_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|3908336_3908528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|3908524_3909169_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|3909462_3909930_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|3909929_3910223_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|3910219_3910840_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|3910839_3911043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|3911035_3911374_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|3911470_3912955_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|3913358_3913616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|3913693_3914278_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|3914274_3915750_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|3915793_3916165_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|3916918_3917125_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|3917139_3918822_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
3918651:3918665	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|3918818_3919115_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|3919117_3919798_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|3919812_3920799_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|3920852_3921290_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|3921300_3921642_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|3921692_3922016_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|3922015_3922621_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|3922620_3925098_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|3925097_3925562_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|3925561_3926101_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|3926111_3928646_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|3928645_3930556_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|3930555_3933312_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_062955133.1|3933788_3934085_-	hypothetical protein	NA	T1SA06	Salmonella_phage	63.9	6.9e-24
WP_062955131.1|3936912_3937176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|3937216_3938482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|3938463_3939444_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|3940312_3941575_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|3942683_3944000_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|3944086_3944491_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|3944477_3944783_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|3944772_3945402_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|3945398_3945899_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|3946085_3947954_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 10
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	4278151	4285057	5456357	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|4278151_4279015_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|4279025_4279799_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|4280040_4280934_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|4281179_4282541_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4282859_4283582_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|4283578_4285057_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 11
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	4326879	4342625	5456357		Enterobacteria_phage(33.33%)	15	NA	NA
WP_062955058.1|4326879_4328286_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|4328509_4329574_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|4329587_4330457_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|4330488_4331379_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|4331393_4331948_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|4332127_4333294_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|4333722_4333842_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|4334242_4335247_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_073547076.1|4336086_4337151_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_063002077.1|4337164_4338034_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_048996045.1|4338065_4338956_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|4338970_4339525_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_015958692.1|4339611_4340442_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062955124.1|4340470_4341304_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062955125.1|4341293_4342625_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 12
NZ_CP022882	Klebsiella pneumoniae strain 911021 chromosome, complete genome	5456357	5327539	5338426	5456357		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|5327539_5330647_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|5330701_5331967_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|5331997_5333086_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|5333172_5333433_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|5333730_5334591_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|5334611_5335373_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|5335633_5336536_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|5336547_5337813_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|5337805_5338426_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
