The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	928946	937535	4785142	integrase,transposase	Stx2-converting_phage(42.86%)	8	926561:926577	937739:937755
926561:926577	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_000691818.1|928946_929168_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_047646086.1|929304_929484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395295.1|931031_931256_+|transposase	transposase	transposase	Q76S41	Shigella_phage	70.8	1.2e-17
WP_000381401.1|931420_932992_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_000624622.1|933011_933359_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|933358_934036_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001395296.1|934910_935834_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
WP_001218852.1|936272_937535_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
937739:937755	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 2
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	1179998	1190456	4785142		Escherichia_phage(71.43%)	8	NA	NA
WP_000081550.1|1179998_1180991_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001136934.1|1182535_1183312_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1183316_1183955_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1183951_1185214_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1185210_1186119_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1186314_1187082_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1187132_1187789_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272895.1|1187894_1190456_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
>prophage 3
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	1397271	1433742	4785142	holin,transposase,integrase,tail	Escherichia_phage(64.71%)	39	1400370:1400386	1432076:1432092
WP_001299507.1|1397271_1398738_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138270.1|1398806_1400384_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1400370:1400386	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954554.1|1400576_1401827_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.8e-238
WP_001077941.1|1401830_1402025_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
WP_000163467.1|1402021_1402672_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	98.6	5.6e-127
WP_001335975.1|1402664_1402916_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1403073_1403322_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_044316667.1|1403371_1404313_-	recombinase RecT	NA	A0A0F6TJP0	Escherichia_coli_O157_typing_phage	99.4	1.1e-176
WP_044316666.1|1404309_1405131_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	5.2e-162
WP_044316665.1|1405127_1405427_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.7e-46
WP_000836293.1|1405735_1406320_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282457.1|1406474_1406705_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
WP_044317171.1|1407071_1407887_+	primosomal protein	NA	Q286X4	Escherichia_phage	96.0	2.7e-118
WP_001406039.1|1407883_1408669_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_047608207.1|1408901_1409099_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	98.4	1.7e-07
WP_000852414.1|1409113_1410793_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000133160.1|1410789_1411086_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_044316663.1|1411088_1411784_+	peptidase	NA	G9L6C4	Escherichia_phage	98.3	1.9e-93
WP_044316662.1|1411798_1412785_+	phage protein	NA	G9L6C5	Escherichia_phage	98.8	1.4e-185
WP_044316659.1|1414880_1417394_+	bacteriophage protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.7	0.0e+00
WP_044316658.1|1417390_1419193_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_044317170.1|1419198_1421673_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.5	0.0e+00
WP_024203028.1|1421869_1422166_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	99.0	5.6e-50
WP_000708858.1|1422197_1422359_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000671196.1|1422452_1422896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095033715.1|1423177_1423792_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	85.4	3.1e-95
WP_044316655.1|1423787_1424072_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_044316654.1|1424264_1424993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001546908.1|1425015_1425273_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_001317493.1|1426754_1427537_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001295213.1|1427533_1428556_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_095033698.1|1428612_1430028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044317117.1|1430175_1430580_+	membrane protein	NA	G9L6E6	Escherichia_phage	91.0	2.0e-58
WP_001546697.1|1430566_1430875_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_025651158.1|1430864_1431494_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	2.0e-113
WP_044316652.1|1431490_1431988_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	65.8	2.3e-48
WP_000755173.1|1432182_1432722_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
1432076:1432092	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000669402.1|1432737_1433253_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_001344399.1|1433568_1433742_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 4
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	1601211	1628884	4785142	integrase,tail,tRNA	Enterobacteria_phage(81.82%)	30	1607134:1607153	1627751:1627770
WP_000683789.1|1601211_1603218_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|1603376_1604597_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127751.1|1604861_1606040_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615834.1|1606036_1607032_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1607134:1607153	attL	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
WP_001420124.1|1608196_1608529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078916.1|1608706_1608847_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001299564.1|1609037_1609298_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032328495.1|1609340_1610450_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	2.4e-194
WP_001397420.1|1610607_1611792_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	5.8e-223
WP_000665308.1|1612357_1612723_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|1612758_1612887_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_001394249.1|1612873_1615681_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.6	0.0e+00
WP_000979954.1|1615693_1616182_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000599412.1|1621083_1621449_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	1.3e-59
WP_111986922.1|1621445_1622066_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	7.0e-10
WP_000714524.1|1622119_1622950_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	98.9	9.6e-132
WP_001036813.1|1622946_1623150_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_001274216.1|1623161_1623461_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	96.0	3.5e-44
WP_000153702.1|1623457_1623724_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	5.8e-30
WP_000985149.1|1623720_1623924_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	2.5e-25
WP_001583389.1|1623923_1624187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001363442.1|1624276_1624390_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	2.8e-10
WP_000514277.1|1624386_1624629_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_032328491.1|1624640_1624928_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000813363.1|1624938_1625280_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000200503.1|1625532_1625739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001705258.1|1625745_1626033_-	regulatory phage cox family protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.1e-23
WP_032327937.1|1626146_1626467_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	4.8e-15
WP_000023402.1|1626563_1627568_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001705257.1|1627726_1628884_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
1627751:1627770	attR	AAAATCCTTGTTGATGAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	1845473	1853781	4785142		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569357.1|1845473_1846400_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783115.1|1846404_1847136_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1847116_1847224_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1847283_1848015_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1848236_1849922_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1849918_1850638_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1850684_1851155_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1851194_1851656_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_047646017.1|1851780_1853781_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
>prophage 6
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	2417791	2430160	4785142	transposase,integrase	Salmonella_phage(36.36%)	12	2415755:2415814	2439058:2439827
2415755:2415814	attL	GGTAGTGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACCTTGTC	NA	NA	NA	NA
WP_000598292.1|2417791_2418118_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001355548.1|2418323_2419538_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	4.1e-46
WP_001394316.1|2419549_2420569_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001389342.1|2420626_2420755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876998.1|2420756_2422037_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	7.8e-157
WP_001296941.1|2422071_2422308_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_040036049.1|2422395_2424852_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_085947771.1|2424923_2426085_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001557860.1|2427826_2427934_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000887491.1|2427978_2428191_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000836768.1|2429744_2429978_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2430046_2430160_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
2439058:2439827	attR	GACAAGGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCACTACCAATAATTTCAAACATATAAATCCGATTATTCTGAAAATATGTTTAAGACTATTTGATCTTCTTCTTAACTTTAGTGAGTTAAATTCTCTGAATATTTGACAGCTAGTTGCCTGATTTTAAATGCCTTATAACAATTGGTAGTATTCTTATTTGTCAATTATAAAAATAGCAACCAGACTTAATAAGTCAAACCAAACGCAATTAAGGAGTTAGTATGAAATTTCAGGCCATTGTATTAGCAAGTTTTCTTGTCATGCCTTATGCGTTGGCAGATGACCAGGGCGGTTTAAAACAGGATGCAGCGCCACCGCCGCCTCATGCAATAGAAGATGGCTATCGCGGAACCGATGATGCAAAAAAAATGACCGTTGATTTCGCAAAAACCATGCACGATGGCGCTTCGGTTTCACTACGCGGTAATTTGATTTCTCACAAAGGAGAGGACCGTTACGTTTTTCGCGATAAGAGCGGTGAAATTAATGTCGTTATTCCTGCGGCCGTCTTTGATGGACGAGAAGTTCAGCCGGACCAGATGATCAACATTAGCGGCAGTCTGGATAAGAAAAGCGCGCCGGCCGTCGTTCGGGTCACTCATTTGCAGAAATAAAAATAAATTAGCCTGATGGCCTGAACTACTGGGCCATTAGGGTATTGGGTTATGCTATTTGTCATCCTTTTATTTACGATAATGCAGAGGTAATTTACAGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	2826828	2850377	4785142	holin,tail,portal	Enterobacteria_phage(26.32%)	29	NA	NA
WP_000531594.1|2826828_2827965_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799406.1|2827948_2828812_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001394135.1|2829043_2829310_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	81.7	9.2e-20
WP_000239880.1|2829366_2830035_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071597385.1|2830089_2830188_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	75.0	6.1e-06
WP_000985933.1|2831648_2832278_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	1.2e-102
WP_047646118.1|2832264_2832600_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	1.3e-50
WP_000839572.1|2832604_2832820_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193722.1|2833687_2834566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024152.1|2834815_2835202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532210.1|2835215_2835566_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.5e-54
WP_000904105.1|2835555_2835927_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.0e-36
WP_001265281.1|2835939_2836989_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.5e-110
WP_032289145.1|2836990_2837263_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	6.1e-11
WP_001179382.1|2838495_2839089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355535.1|2839262_2839382_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.8	1.2e-08
WP_000200161.1|2839539_2840586_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001151206.1|2841070_2841526_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	2.3e-63
WP_001262390.1|2841566_2842637_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|2842708_2843134_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2843130_2843385_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2843464_2843884_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379589.1|2844181_2844337_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171936.1|2844496_2844715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327945.1|2844737_2845052_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	6.2e-07
WP_047646132.1|2846671_2846878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449195.1|2847436_2847625_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083284.1|2847621_2847813_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048555.1|2847905_2850377_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	1.6e-57
>prophage 8
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	3441048	3493753	4785142	integrase,tRNA,lysis,transposase,protease	Enterobacteria_phage(45.45%)	47	3474581:3474627	3488388:3488434
WP_001393886.1|3441048_3442161_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3442237_3442390_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130653.1|3442842_3443961_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682524.1|3444026_3444275_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3444339_3444708_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351480.1|3444801_3445455_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3445562_3446810_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786320.1|3446877_3448254_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3448355_3451499_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3451510_3452734_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3452749_3453082_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3453239_3454613_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3454769_3455453_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253838.1|3455442_3456891_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_032327979.1|3457627_3459529_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	9.6e-26
WP_001160804.1|3459556_3460018_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_001289021.1|3460037_3464291_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_071608736.1|3464297_3464555_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.9	1.4e-12
WP_000889443.1|3464587_3464848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|3464973_3465135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072327956.1|3466098_3467235_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383906.1|3467505_3469617_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001355527.1|3469729_3472702_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224564.1|3472702_3473593_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|3473775_3474537_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3474581:3474627	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201820.1|3475050_3476004_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000355602.1|3478453_3478747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235988.1|3478757_3479462_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.1	3.0e-57
WP_000654156.1|3479471_3479753_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001395371.1|3479749_3480442_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	41.8	1.1e-40
WP_000453611.1|3480852_3481398_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|3481786_3481981_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|3482340_3482634_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135280.1|3483122_3483620_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|3483619_3483835_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737293.1|3484423_3485506_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	3.5e-166
WP_001204791.1|3485695_3486079_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001393963.1|3486164_3486305_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	3.6e-07
WP_001099705.1|3486301_3486664_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	9.5e-60
WP_000488419.1|3486733_3487012_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.9	1.7e-48
WP_000446905.1|3486983_3487355_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|3487210_3488374_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001310555.1|3489252_3490269_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
3488388:3488434	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_000729160.1|3490622_3491489_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3491490_3491703_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3491810_3492332_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|3492367_3493753_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	3730533	3738513	4785142	integrase	Enterobacteria_phage(28.57%)	12	3724701:3724715	3743507:3743521
3724701:3724715	attL	CTCTGGTGAGCGATT	NA	NA	NA	NA
WP_032328337.1|3730533_3731136_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	1.2e-22
WP_000181940.1|3731128_3731350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|3731346_3731610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3731606_3731801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095033707.1|3731793_3732861_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	37.3	5.2e-13
WP_000476150.1|3732854_3733037_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019362.1|3733029_3733863_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412538.1|3733875_3734307_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3734306_3734510_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000772646.1|3734937_3736152_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	2.2e-132
WP_047646027.1|3736420_3737755_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027663134.1|3737835_3738513_-	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	1.9e-45
3743507:3743521	attR	AATCGCTCACCAGAG	NA	NA	NA	NA
>prophage 10
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	4182356	4194642	4785142	transposase	Enterobacteria_phage(46.15%)	13	NA	NA
WP_000459282.1|4182356_4182806_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	67.3	1.3e-45
WP_001133040.1|4182798_4183098_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.1	6.9e-32
WP_001355524.1|4183090_4183645_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.0	6.6e-36
WP_024171719.1|4183641_4183908_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	64.8	4.7e-24
WP_001339397.1|4184186_4184864_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4184863_4185211_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|4185230_4186802_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_001317493.1|4187896_4188679_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_095033709.1|4188675_4189698_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.5	9.5e-198
WP_000984214.1|4189925_4190168_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
WP_000090076.1|4190184_4190760_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.9	2.3e-39
WP_001299662.1|4191990_4193010_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001355687.1|4193139_4194642_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 11
NZ_CP022912	Escherichia coli O6:H16 strain 2011EL-1370-2 chromosome, complete genome	4785142	4320869	4368595	4785142	transposase,integrase	Stx2-converting_phage(23.08%)	44	4315186:4315200	4359238:4359252
4315186:4315200	attL	TCAGTTCCCGGTAGA	NA	NA	NA	NA
WP_047646056.1|4320869_4322120_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.9	5.6e-83
WP_001403331.1|4322264_4323575_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	32.5	3.5e-43
WP_000395305.1|4323605_4325267_+	DUF262 domain-containing protein	NA	A0A1V0SF45	Hokovirus	26.3	1.6e-05
WP_001403330.1|4325263_4326418_+	DUF3696 domain-containing protein	NA	A0A2I7RNF1	Vibrio_phage	28.3	1.5e-05
WP_000650437.1|4326422_4327391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278133.1|4327519_4327831_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000964083.1|4328638_4330141_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_000549475.1|4330217_4331318_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_000884143.1|4331310_4331592_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000655890.1|4331682_4331898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366107.1|4332439_4333324_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_001084939.1|4333835_4334486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224780.1|4334502_4335057_-	lipoprotein	NA	NA	NA	NA	NA
WP_032276840.1|4335072_4335639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059603.1|4336144_4336477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029404514.1|4337358_4338060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047646055.1|4338161_4338629_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287394.1|4338782_4339187_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_047646054.1|4340102_4340483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000041813.1|4340532_4340823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291073.1|4340917_4341205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001545719.1|4341221_4341608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000837631.1|4341622_4341934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000616796.1|4341930_4342179_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.0	6.8e-09
WP_023280554.1|4342394_4343255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218741.1|4343734_4344925_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_021517873.1|4345359_4346403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281244.1|4346545_4348219_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_021517875.1|4348284_4348482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766272.1|4348621_4348888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328150.1|4350503_4351583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032328152.1|4351631_4352528_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000571845.1|4352951_4353698_-	porin family protein	NA	NA	NA	NA	NA
WP_001421562.1|4353927_4354098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328154.1|4357089_4358625_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	40.4	9.5e-101
WP_047646053.1|4358641_4359397_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.4	1.4e-44
4359238:4359252	attR	TCAGTTCCCGGTAGA	NA	NA	NA	NA
WP_021552170.1|4360339_4361464_+	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	30.3	4.6e-36
WP_047646052.1|4361420_4362923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024190829.1|4363385_4363574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095033710.1|4363714_4364988_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
WP_077776906.1|4365346_4365901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001704819.1|4365979_4366657_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4366656_4367004_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_095033711.1|4367023_4368595_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	3.2e-168
>prophage 1
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	0	4679	63392		Pseudomonas_phage(100.0%)	2	NA	NA
WP_032142224.1|2490_2862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|3170_4679_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 2
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	7685	18476	63392	transposase,integrase	Macacine_betaherpesvirus(42.86%)	7	16468:16481	21512:21525
WP_000817031.1|7685_8657_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|8656_9823_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_095033718.1|10355_11569_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_157720809.1|12778_14310_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	3.1e-43
WP_001254933.1|14543_15695_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
16468:16481	attL	GGCTTTCTGGAAAA	NA	NA	NA	NA
WP_000361613.1|16515_17493_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	3.9e-100
WP_001066944.1|17735_18476_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
21512:21525	attR	TTTTCCAGAAAGCC	NA	NA	NA	NA
>prophage 3
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	21896	22607	63392		Vibrio_virus(100.0%)	1	NA	NA
WP_113705914.1|21896_22607_+	type IV pilus major pilin	NA	Q8LTI3	Vibrio_virus	36.7	4.4e-16
>prophage 4
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	33519	34792	63392	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|33519_34792_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 5
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	39411	40593	63392		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001467544.1|39411_40593_-	DUF3800 domain-containing protein	NA	U5N3F3	Enterobacteria_phage	29.2	8.3e-36
>prophage 6
NZ_CP022913	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence	63392	50799	60351	63392	transposase	Stx2-converting_phage(37.5%)	13	NA	NA
WP_001339397.1|50799_51477_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|51476_51824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381401.1|51843_53415_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.9e-168
WP_001705702.1|53441_54248_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.1	1.9e-44
WP_001272251.1|54358_54655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550495.1|54717_54951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000775238.1|55549_55711_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001178556.1|55886_56405_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	68.5	1.3e-57
WP_052158500.1|56404_58081_-	plasmid SOS inhibition protein A	NA	G8DH78	Emiliania_huxleyi_virus	31.8	3.4e-19
WP_000005971.1|58144_58378_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290820.1|58434_58962_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	4.6e-47
WP_024173136.1|59026_59263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297832.1|59787_60351_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
>prophage 1
NZ_CP022914	Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed2, complete sequence	117021	8811	57104	117021	transposase,integrase	Stx2-converting_phage(40.0%)	38	34663:34722	47785:47862
WP_095033721.1|8811_10090_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_013188496.1|10231_10588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001416764.1|12493_13738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124092.1|16610_16976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001393122.1|17868_19680_+	two-partner secretion system transporter EtpB	NA	NA	NA	NA	NA
WP_013188499.1|19769_24398_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000894830.1|24422_24608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393184.1|24679_26593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001203081.1|26589_27084_+	DUF2919 family protein	NA	NA	NA	NA	NA
WP_044307862.1|27476_27650_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	65.9	2.3e-11
WP_000343720.1|27646_28855_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
WP_000219392.1|28970_29987_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_000959870.1|30453_31416_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001393279.1|31418_31769_+	plasmid stability family protein	NA	NA	NA	NA	NA
WP_095033722.1|32594_33557_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000780221.1|33879_34161_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000471255.1|34141_34471_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	2.6e-08
34663:34722	attL	CGATTTCACTGGCTGATACTTGTCGTGTACAGAGTGCCATGACAGCCTGACGTTTGACTT	NA	NA	NA	NA
WP_013188501.1|35462_35681_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_047646152.1|39369_39678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144037.1|39764_40409_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016960.1|40586_41393_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	93.9	1.7e-53
WP_001159871.1|41393_41699_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000829078.1|41700_41919_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343095.1|42440_42698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032328642.1|42697_43240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300024.1|43504_44326_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_064734538.1|44328_45417_+	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_032328199.1|45421_46372_+	virulence factor VirK	NA	NA	NA	NA	NA
WP_000998103.1|49231_50770_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	96.9	2.9e-291
47785:47862	attR	AAGTCAAACGTCAGGCTGTCATGGCACTCTGTACACGACAAGTATCAGCCAGTGAAATCGCCAGGCGTATTGGTGTCA	NA	NA	NA	NA
WP_000612591.1|50819_51167_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|51163_51544_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_095033723.1|51834_52996_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_122994480.1|53251_53443_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095033721.1|53583_54862_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	2.2e-167
WP_085950855.1|55028_55722_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	7.5e-130
WP_140159966.1|55811_56039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|56079_56757_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|56756_57104_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
