The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022915	Rhodococcus pyridinivorans strain GF3 chromosome, complete genome	5303895	326692	382925	5303895	transposase,tRNA,protease,integrase	Tupanvirus(21.05%)	44	351522:351537	385801:385816
WP_094979526.1|326692_329236_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.3	3.5e-132
WP_033096931.1|329506_330937_-	phospholipase D	NA	NA	NA	NA	NA
WP_006550504.1|331086_331446_-	Lsr2 family protein	NA	A0A160DEV0	Gordonia_phage	39.3	8.7e-13
WP_094979527.1|331541_333053_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.9	8.3e-73
WP_094979528.1|333106_333592_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_006550509.1|333685_334519_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_094979529.1|334521_334959_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_006550511.1|335003_335942_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_024102843.1|335934_336870_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_094979530.1|337029_338094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019290198.1|338225_338702_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_006550515.1|338695_339238_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_033096934.1|339237_339618_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_006550517.1|339614_340472_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	33.7	4.4e-23
WP_006550518.1|340468_341134_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.6	4.2e-45
WP_019290199.1|341204_343763_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	46.3	3.0e-107
WP_006550520.1|344014_344569_-	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	25.0	7.6e-08
WP_052039998.1|344581_345631_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_019290201.1|345606_346668_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_019290202.1|346652_347996_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_006550524.1|348258_348750_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	45.5	6.3e-30
WP_033096936.1|348818_349649_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_094979531.1|349766_350975_+|transposase	transposase	transposase	A0A1D8ETH9	Propionibacterium_phage	66.2	1.4e-128
WP_006550527.1|351079_351553_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
351522:351537	attL	TCACCGCGGCGATCGA	NA	NA	NA	NA
WP_006550528.1|351771_352302_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094979532.1|352364_352982_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094979533.1|353190_354504_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A2K9L2Y3	Tupanvirus	24.6	3.4e-30
WP_094979534.1|354855_358761_+	non-ribosomal peptide synthetase	NA	NA	NA	NA	NA
WP_033096938.1|358727_360107_+	M1 family metallopeptidase	NA	A0A2K9L1R3	Tupanvirus	22.9	3.1e-18
WP_006550533.1|360103_360634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006552400.1|366436_366634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094979535.1|367037_368225_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	31.7	1.5e-08
WP_094980938.1|368945_371891_-	type I DNA topoisomerase	NA	J3E777	Acanthamoeba_polyphaga_lentillevirus	34.9	1.1e-102
WP_094979536.1|372008_372614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003935252.1|372776_372980_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	57.8	5.2e-15
WP_064061130.1|373415_375764_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	26.9	6.5e-08
WP_024102822.1|375929_376289_-	flp pilus-assembly TadE/G-like family protein	NA	NA	NA	NA	NA
WP_100167921.1|376285_376660_-	pilus assembly protein TadE	NA	NA	NA	NA	NA
WP_094979537.1|376669_376798_-	DUF4244 domain-containing protein	NA	NA	NA	NA	NA
WP_084222366.1|376834_378571_+	recombinase family protein	NA	A0A0K2CLK0	Mycobacterium_phage	48.9	2.0e-123
WP_039586575.1|379319_379658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094979538.1|379654_381385_+	hypothetical protein	NA	U5XGR4	Phormidium_phage	31.6	3.9e-26
WP_001389365.1|381350_382115_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_094979539.1|382133_382925_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.0	1.5e-44
385801:385816	attR	TCACCGCGGCGATCGA	NA	NA	NA	NA
>prophage 2
NZ_CP022915	Rhodococcus pyridinivorans strain GF3 chromosome, complete genome	5303895	1061595	1112605	5303895	transposase,protease,integrase	Acinetobacter_phage(28.57%)	37	1077185:1077201	1118886:1118902
WP_094979727.1|1061595_1062702_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	30.9	2.5e-34
WP_094979728.1|1062698_1063994_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006550712.1|1063990_1065148_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_094979729.1|1065177_1066299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006550710.1|1066591_1067167_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	7.4e-06
WP_064060028.1|1067271_1068378_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	45.6	1.1e-61
WP_064060027.1|1068499_1069159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006550707.1|1069257_1069452_-	nitroreductase family deazaflavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064060026.1|1069532_1070357_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094979730.1|1070498_1071230_+	amidohydrolase	NA	NA	NA	NA	NA
WP_094979731.1|1071252_1072653_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_050993545.1|1072954_1073746_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_157741775.1|1074517_1075270_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_094980963.1|1075356_1077345_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1077185:1077201	attL	TGGCCGCCCGCACCCGC	NA	NA	NA	NA
WP_094979734.1|1077335_1078364_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_094979735.1|1078360_1079254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068159118.1|1082005_1082332_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094979736.1|1082328_1084437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094979737.1|1085760_1086591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147430364.1|1086897_1087170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094979739.1|1087260_1088427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029547333.1|1088854_1089220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094979740.1|1092852_1094370_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.0	1.1e-112
WP_094980964.1|1094371_1094797_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094979741.1|1094887_1096303_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	34.7	2.3e-45
WP_094980965.1|1096358_1096991_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094979742.1|1097095_1098103_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_147430366.1|1099502_1100159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094979745.1|1101014_1103126_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_064257580.1|1103236_1103716_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064257581.1|1103748_1104942_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_094979747.1|1105410_1107036_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	37.0	2.2e-15
WP_094979748.1|1107128_1108127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094979749.1|1108249_1108453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121209252.1|1108560_1109841_-	MFS transporter	NA	NA	NA	NA	NA
WP_094979750.1|1110231_1111149_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_094979751.1|1111360_1112605_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.9	7.5e-80
1118886:1118902	attR	TGGCCGCCCGCACCCGC	NA	NA	NA	NA
>prophage 3
NZ_CP022915	Rhodococcus pyridinivorans strain GF3 chromosome, complete genome	5303895	1238074	1289839	5303895	transposase	Mycobacterium_phage(20.0%)	41	NA	NA
WP_094979797.1|1238074_1239268_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_039586175.1|1239574_1239994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094979798.1|1240102_1241215_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_094979799.1|1241211_1242534_+	MFS transporter	NA	NA	NA	NA	NA
WP_094980979.1|1244318_1245104_-	M23 family metallopeptidase	NA	G8I8L5	Mycobacterium_phage	51.6	9.7e-25
WP_094980980.1|1245384_1246929_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_094979800.1|1247027_1247993_-	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_094979801.1|1247996_1249619_-	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_039586210.1|1249615_1250437_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_050993546.1|1250436_1251069_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_084222353.1|1251065_1251659_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_094979802.1|1251902_1252592_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_006554845.1|1252749_1253595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006554844.1|1253762_1254488_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006554843.1|1255240_1255771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100167977.1|1255811_1257503_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_006554841.1|1257702_1258650_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_006554840.1|1258646_1259009_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_094979803.1|1259535_1261299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052227337.1|1262799_1263774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019290647.1|1263770_1264760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010596700.1|1264960_1265581_-	recombinase family protein	NA	NA	NA	NA	NA
WP_094979804.1|1265698_1266208_-	universal stress protein	NA	NA	NA	NA	NA
WP_064257765.1|1266233_1267775_-	MFS transporter	NA	NA	NA	NA	NA
WP_008382024.1|1267962_1268649_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094979805.1|1268786_1270011_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	56.1	1.3e-87
WP_094979806.1|1270033_1270594_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003937321.1|1271125_1272757_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.1	7.0e-17
WP_003937320.1|1272831_1273899_-	BtrH N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003937319.1|1273948_1274785_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003937318.1|1274781_1276311_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_094979807.1|1276307_1277033_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_003937316.1|1277029_1278490_-	cytochrome P450	NA	NA	NA	NA	NA
WP_003937315.1|1278561_1279764_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003937314.1|1279760_1281149_-	cytochrome P450	NA	NA	NA	NA	NA
WP_003937313.1|1281172_1281493_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003937312.1|1281646_1282615_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_094980981.1|1282719_1283516_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003937311.1|1283608_1284364_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	36.4	1.1e-30
WP_029540274.1|1284360_1286007_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071935988.1|1286824_1289839_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	32.2	2.1e-123
>prophage 4
NZ_CP022915	Rhodococcus pyridinivorans strain GF3 chromosome, complete genome	5303895	2018962	2086659	5303895	transposase,protease,integrase	Bacillus_phage(25.0%)	38	2023863:2023884	2030675:2030696
WP_094980062.1|2018962_2020396_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_094980063.1|2020562_2020976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094980064.1|2022800_2023817_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	24.9	5.5e-12
WP_094980065.1|2023770_2024256_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2023863:2023884	attL	CGGCAGACACGCCGAGATCACC	NA	NA	NA	NA
WP_064851781.1|2024397_2025753_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_016695443.1|2025749_2026574_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	39.6	5.4e-42
WP_094980066.1|2026743_2027097_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_157741781.1|2027435_2028719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094980068.1|2029048_2029888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094981013.1|2031457_2031745_-	hypothetical protein	NA	NA	NA	NA	NA
2030675:2030696	attR	GGTGATCTCGGCGTGTCTGCCG	NA	NA	NA	NA
WP_094980069.1|2032097_2032859_-	DUF108 domain-containing protein	NA	NA	NA	NA	NA
WP_147430380.1|2034186_2034600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980071.1|2034798_2035725_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.8	7.6e-45
WP_094981014.1|2036325_2037771_+	sugar transferase	NA	NA	NA	NA	NA
WP_094980072.1|2037868_2039224_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.2	1.7e-69
WP_094980073.1|2039295_2040063_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_094980074.1|2040072_2041227_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_147430382.1|2041399_2042632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980076.1|2042632_2043706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741782.1|2043702_2044791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741783.1|2044849_2045635_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_094980079.1|2045631_2046201_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_094980080.1|2046197_2047226_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	56.5	2.0e-107
WP_094980081.1|2047225_2048194_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	56.5	2.6e-96
WP_094980082.1|2048264_2050046_-	DUF4012 domain-containing protein	NA	NA	NA	NA	NA
WP_094981016.1|2050325_2069075_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	3.4e-115
WP_094981015.1|2069074_2070835_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_024101937.1|2070805_2071321_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_094980083.1|2071502_2072918_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_064852480.1|2072927_2074211_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_051121643.1|2074542_2075793_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_006553044.1|2075965_2076169_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	59.4	6.8e-15
WP_064256517.1|2076382_2077555_+	alkane 1-monooxygenase	NA	NA	NA	NA	NA
WP_094980084.1|2078199_2079150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980085.1|2079208_2082388_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_006553039.1|2082822_2083521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980086.1|2083853_2085161_-|protease	protease	protease	NA	NA	NA	NA
WP_006553037.1|2085327_2086659_-|protease	protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP022915	Rhodococcus pyridinivorans strain GF3 chromosome, complete genome	5303895	3074245	3117230	5303895	transposase,integrase	Gordonia_phage(53.33%)	52	3077111:3077127	3119323:3119339
WP_094980333.1|3074245_3074635_+	hypothetical protein	NA	A0A0U4K3Z3	Gordonia_phage	38.0	3.7e-09
WP_001389365.1|3075202_3075967_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_157741796.1|3075995_3077003_+	hypothetical protein	NA	A0A1D8ETU0	Propionibacterium_phage	27.4	8.4e-13
WP_094981051.1|3077085_3078408_+	DUF935 family protein	NA	A0A142K8P5	Gordonia_phage	54.2	5.1e-111
3077111:3077127	attL	TGCGGTGGCCGAACTCG	NA	NA	NA	NA
WP_094980336.1|3078395_3079778_+	hypothetical protein	NA	A0A142K9Z2	Gordonia_phage	43.3	4.1e-87
WP_094980337.1|3079785_3080226_+	hypothetical protein	NA	G9FH30	Rhodococcus_phage	60.4	1.1e-36
WP_094980338.1|3080248_3081187_+	hypothetical protein	NA	A0A142KC12	Gordonia_phage	56.3	3.9e-97
WP_094980339.1|3081196_3081631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980340.1|3081627_3082008_+	hypothetical protein	NA	A0A1B3AZ27	Gordonia_phage	44.8	4.5e-20
WP_094980341.1|3082000_3082336_+	hypothetical protein	NA	A0A142KC15	Gordonia_phage	38.3	1.7e-10
WP_094980342.1|3082339_3082621_+	hypothetical protein	NA	A0A142K9Z8	Gordonia_phage	51.6	1.6e-14
WP_094980343.1|3082617_3083007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980344.1|3083052_3083880_+	hypothetical protein	NA	A0A1C9EHP5	Gordonia_phage	49.1	1.4e-58
WP_157741797.1|3083948_3084119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980345.1|3084102_3084414_+	hypothetical protein	NA	A0A1C9EHP9	Gordonia_phage	30.9	3.0e-06
WP_094980346.1|3084394_3084898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741798.1|3084945_3085299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741799.1|3085311_3089217_+	hypothetical protein	NA	A0A1B3B020	Gordonia_phage	32.9	2.6e-102
WP_094980349.1|3089213_3090140_+	hypothetical protein	NA	A0A166Y339	Gordonia_phage	52.1	2.0e-85
WP_094980350.1|3090130_3091798_+	hypothetical protein	NA	A0A2H4PF53	Gordonia_phage	54.8	1.8e-169
WP_094980351.1|3091799_3092177_+	DUF2744 domain-containing protein	NA	A0A2D1G9P8	Mycobacterium_phage	45.9	1.2e-20
WP_094980352.1|3092176_3092716_+	M23 family metallopeptidase	NA	D4P815	Rhodococcus_phage	60.4	1.1e-48
WP_094980353.1|3092712_3093687_+	glycoside hydrolase family 25 protein	NA	G9FHQ8	Rhodococcus_virus	54.0	2.2e-66
WP_094980354.1|3093683_3094022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980355.1|3094025_3094310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064061857.1|3094306_3094513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980356.1|3094509_3094872_+	hypothetical protein	NA	G9FI12	Nocardia_phage	33.6	2.6e-09
WP_157741800.1|3094858_3096184_+	hypothetical protein	NA	A0A2H4JC23	uncultured_Caudovirales_phage	48.0	3.7e-16
WP_094980358.1|3096195_3096489_+	hypothetical protein	NA	A0A2H4JC25	uncultured_Caudovirales_phage	50.5	5.4e-21
WP_033097155.1|3096546_3096915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094980359.1|3097028_3097514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741801.1|3097515_3099006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157741802.1|3098994_3099828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094980362.1|3100286_3101216_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	46.5	2.4e-62
WP_094980363.1|3101289_3101805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157741803.1|3101896_3102067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094981052.1|3102086_3102896_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1SGM4	Mycobacterium_phage	55.0	6.2e-75
WP_006554460.1|3103458_3103839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006554459.1|3103835_3104282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006554458.1|3104711_3106565_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	35.6	1.2e-46
WP_006554456.1|3106886_3107633_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006554455.1|3107706_3108096_+	glyoxalase	NA	NA	NA	NA	NA
WP_006554454.1|3108108_3108546_-	VOC family protein	NA	NA	NA	NA	NA
WP_006554453.1|3108547_3109120_-	DinB family protein	NA	NA	NA	NA	NA
WP_006554452.1|3109181_3110147_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_157741804.1|3110372_3110693_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	81.6	4.1e-38
WP_094980365.1|3110689_3111181_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	50.0	3.0e-32
WP_094981053.1|3111790_3113182_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.9	8.7e-61
WP_039584096.1|3113662_3114745_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K1Y646	Mycobacterium_phage	31.4	1.2e-09
WP_039584095.1|3114710_3116633_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7K6	Escherichia_phage	25.2	2.6e-07
WP_039584094.1|3116629_3116935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094980366.1|3117020_3117230_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	53.3	4.5e-14
3119323:3119339	attR	CGAGTTCGGCCACCGCA	NA	NA	NA	NA
