The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	19014	77717	2165984	transposase,integrase	Bacillus_phage(14.29%)	44	21890:21949	84580:85947
WP_095439300.1|19014_20277_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_035162072.1|20476_21310_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
21890:21949	attL	GGGAACTGTATAATTTTATGTGTAAGGATGAACAGTTCCTTAAACTAAATTCCAATTGGG	NA	NA	NA	NA
WP_095439197.1|22016_23195_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.3	7.2e-24
WP_003616373.1|24108_24414_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003616370.1|24875_25514_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	7.6e-20
WP_003616369.1|25510_26278_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003616368.1|26280_26526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616367.1|26746_27901_-	SLAP domain-containing protein	NA	Q38317	Lactobacillus_phage	56.7	3.6e-60
WP_002880554.1|28161_28683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003616366.1|28962_29739_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003616364.1|29774_30332_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_035182862.1|30358_33124_-	DEAD/DEAH box helicase	NA	Q9T1H9	Lactobacillus_phage	26.3	2.1e-26
WP_003616362.1|33272_33983_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_003616361.1|34071_34551_+	YcxB family protein	NA	NA	NA	NA	NA
WP_003616360.1|34642_35071_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616358.1|35209_36055_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002880537.1|36133_36322_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003616356.1|36789_37362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616354.1|42971_43319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183044.1|43672_44635_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003616351.1|44674_45550_+	ROK family protein	NA	NA	NA	NA	NA
WP_003613533.1|45769_46213_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	44.2	1.1e-25
WP_003616350.1|46235_47414_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	53.3	9.5e-109
WP_003613541.1|47375_47579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616349.1|48185_48950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002880600.1|48946_49729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182858.1|49779_50265_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_035170660.1|50692_51412_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.4	4.6e-21
WP_003616344.1|52669_54112_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_095439300.1|54239_55502_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_095439198.1|57512_58562_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.1e-52
WP_003613545.1|60640_61588_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.6	1.9e-75
WP_003616342.1|63303_63507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616341.1|63549_66045_+	phage/plasmid primase	NA	A8ATF3	Listeria_phage	28.7	8.0e-73
WP_003616340.1|66689_66920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080553966.1|69163_69547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616336.1|70264_70522_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_095439199.1|70680_72048_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_157737562.1|72166_73255_+	AlwI family type II restriction endonuclease	NA	A0A2K5B262	Erysipelothrix_phage	25.5	3.0e-16
WP_011544347.1|73317_73542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439200.1|73513_75265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003616334.1|75685_76153_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_003616333.1|76789_77443_+|integrase	phage integrase N-terminal SAM-like domain-containing protein	integrase	NA	NA	NA	NA
WP_080553965.1|77339_77717_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
84580:85947	attR	CCCAATTGGAATTTAGTTTAAGGAACTGTTCATCCTTACACATAAAATTATACAGTTCCCACTAGCTATGTACGGCTAGTCTTTTTCTACTTTTTTACTCTTCTTCTTGGCCGGTAAACTGGGCAAAGTACTTGTCCAGGTAGACCTTGTAGCTGACGGTCATGATGACGTTGCGGAGCATGGTTTTGTATTCGCCATGCTCGTGGCCGACGTCGGTCAGCTCGCCTTTAAAGCCGAAGACGTAGGCCAGAACGTTTTCCAGTTCATCAACCATGTAGTTGTAGGCTGTCTCAGTGTCGTAGCTGGACCGTTGCAGCTTCAGGGCCTCGCACAGGTCAGCCAGGGAGAGGACGTTTTTGGACACGGCGATAAAGGCCAGCTCAGCGATCTGCTGGCGGCTGTAGAGCTTCTTTTTAGGTGAGGCGATCAGGTCATGCTTGACATAGTTGCTGACCATGGAACTGGTCAGGTGGACGTTTTCCAAGGGGGCCAGGGCCTCATTGATATAAGTCGCGGTCTGCTCCAGGTACAGGCCCATCTGGGGCAGTTCCTGGTAACGGGGCAGGTGCAGGCCGGCCAGGGAACGGGCAATTTTTTCCATAAAAACCTCCTGTCAGCTGATACAAAAAATAAAGACAAAACAAAATTCGATCATCCACATTATAGCAAAGCAGCTTAGCGGTTTTCAAAAAACTTGACACGAGGACTTTCCTGCTATAGACTTAAGCAAAAGTTTTTAAGAAACCGATGACGAGGATTATGAAATATGCCAATTAAGATAGTAACTGATTCCGGAGCTAACATGACAGCGGGCAACTTGGGGAGCTGCCAGTTGGAAGTAGCGGCCTTGAGCCTGATTCAAGGGGATAAGACTTGGCTGGACGACGCCAGCTTTGACCAGGCGGAATTCAATCAAAGAGCCAAGGACGGGATCGCGGCGTCTTCAGCCTGCCCCAGTATTTCAGCCTGGCTGGACGCTTACGCCGGGGGCAGCGAGATCTATGTCGTGACCATCTCATCGGTCTTGTCCGGCAGCTACAATTCAGCAATGCAGGCGGCAAAGATTTACCAGGAAGAATACCCGGATGCCTTGATTCACGTTTTTGACAGTAAAAGCGCGGGTCCGGCCCAGTTTTTGGCGGCGGAGAAGATCGCGGAACTGAAGGAAAAGGGGATGCAGTTCCCGGACCTGGTGGAAGCAGTGAGCGACTACCTGGAAAACCATGTCCGCATCTTTTTTGCCTTAAAGTCGATGACTAATCTGGCCAACAATGGCCGGGTCAGCCCGGTGGTGGCCAAGATCGCCGGACTTTTGAAAATCTGGGTCTATGGCTGGGCAGAGGAAGGCGAAATCAAGCCCCTGGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	83333	141917	2165984	transposase	Ralstonia_virus(21.05%)	48	NA	NA
WP_095439197.1|83333_84512_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.3	7.2e-24
WP_003616324.1|84673_85180_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_003616322.1|85345_86179_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	37.9	4.6e-41
WP_035182853.1|86440_87025_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003616319.1|87021_87675_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003616318.1|87750_88578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035160836.1|88937_89129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035183031.1|89672_90113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396016.1|90090_90363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616311.1|91234_91780_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002879656.1|92177_92891_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_003616310.1|92940_93099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616308.1|93156_93984_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.6	5.3e-98
WP_002879652.1|94063_94603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439201.1|96439_97807_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
WP_095439201.1|97908_99276_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
WP_002879651.1|99433_100342_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_016396011.1|100460_101318_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	6.6e-51
WP_003616305.1|101613_103833_+	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	W0LIV6	Mycobacterium_phage	32.8	7.3e-86
WP_003616304.1|103897_104347_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003616303.1|104348_104897_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003616301.1|104889_105453_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003616300.1|105710_106712_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.6	2.2e-50
WP_003616299.1|107001_108399_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003616298.1|108587_109019_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	41.7	9.1e-09
WP_002879583.1|109583_110063_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003614608.1|110653_111322_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_003616294.1|113626_114328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003612481.1|114566_115475_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	43.3	2.0e-05
WP_003616291.1|115610_116741_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	38.9	5.6e-66
WP_003616290.1|116907_117846_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003616289.1|117897_118821_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003616288.1|119543_120770_-	MFS transporter	NA	NA	NA	NA	NA
WP_072538343.1|121091_121247_+	fumarate reductase flavoprotein subunit	NA	NA	NA	NA	NA
WP_003616285.1|121390_122311_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616283.1|122495_122981_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_155517557.1|123665_124361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003612438.1|124394_124574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737563.1|124655_126061_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.2	4.6e-25
WP_050782123.1|126192_127125_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003612485.1|127169_128096_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	40.7	1.0e-57
WP_003616276.1|128257_130138_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	64.0	1.0e-221
WP_016395838.1|130185_131553_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003616273.1|132327_133086_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003616272.1|133174_134371_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041812036.1|136826_138050_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_016395838.1|138830_140198_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_095439300.1|140654_141917_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
>prophage 3
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	160304	262020	2165984	protease,transposase	unidentified_phage(19.23%)	92	NA	NA
WP_095439204.1|160304_161354_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_002877735.1|162072_162438_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_081036454.1|162572_163241_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003616244.1|163250_164606_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	1.1e-10
WP_003616243.1|164905_166381_+	MFS transporter	NA	NA	NA	NA	NA
WP_003616242.1|166444_167293_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003616241.1|167349_168168_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003616240.1|168225_168438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616238.1|168451_169066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439200.1|169592_171344_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011544347.1|171315_171540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616235.1|171802_172702_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003616234.1|172718_173273_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.0	7.8e-13
WP_003616233.1|173430_174588_-	cation transporter	NA	NA	NA	NA	NA
WP_072538245.1|175086_176136_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_095439205.1|176689_177601_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_035182845.1|177830_178958_+	LysM peptidoglycan-binding domain-containing protein	NA	D2KRB9	Lactobacillus_phage	45.0	1.8e-19
WP_003616227.1|179458_182170_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003616225.1|182242_183199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439301.1|183358_184621_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_035183021.1|186076_186265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616221.1|187672_189256_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003611679.1|189644_190271_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003616220.1|190353_190725_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_035182842.1|190711_191410_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003611605.1|191520_192000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616218.1|192051_193515_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_003616217.1|193516_194461_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003616215.1|194533_195301_+	viroplasmin family protein	NA	C1KFJ1	Lactobacillus_virus	33.5	9.2e-28
WP_003616213.1|195388_196345_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_086356046.1|196514_197351_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003616211.1|197334_197994_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003616207.1|199963_200797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616206.1|200836_201487_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616204.1|201524_202832_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_003616202.1|202979_204068_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003616200.1|204116_204752_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616199.1|204885_205995_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003616198.1|205991_206786_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_003616197.1|206751_207618_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003616196.1|207778_209401_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003616195.1|209550_210510_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.3	8.8e-12
WP_003616194.1|210629_212285_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_016395838.1|212367_213735_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_095439206.1|213973_215197_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	2.3e-97
WP_003616193.1|215594_216734_+	LCP family protein	NA	NA	NA	NA	NA
WP_002879494.1|216852_217230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616190.1|217244_218789_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.8	9.1e-43
WP_016396189.1|218841_219597_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003616188.1|219599_220091_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_095439300.1|220324_221587_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003616186.1|221828_221960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616185.1|222015_222465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616183.1|222471_223347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616182.1|223884_225267_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	34.2	1.5e-52
WP_002879488.1|225770_226286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616181.1|226288_226915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616180.1|226965_228504_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002879482.1|228567_228897_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_002879481.1|228986_229529_+	AAA family ATPase	NA	U5J9X2	Bacillus_phage	35.4	2.2e-12
WP_003616177.1|229653_230139_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	40.4	2.5e-15
WP_057727110.1|230423_231470_+	lactate dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	30.1	3.3e-28
WP_035182838.1|231550_232402_+	magnesium transporter	NA	NA	NA	NA	NA
WP_148465392.1|232609_233863_+	glycosyltransferase	NA	A0A1V0S9E5	Catovirus	24.2	3.8e-07
WP_003616172.1|233878_235015_+	beta-glucanase	NA	NA	NA	NA	NA
WP_169787792.1|235014_235341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095439198.1|235454_236504_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.1e-52
WP_003616168.1|236810_237284_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	1.2e-14
WP_003616166.1|237471_238254_+	C40 family peptidase	NA	A0A2L1IW19	Streptomyces_phage	42.7	3.4e-14
WP_095439207.1|239272_240031_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	40.2	5.2e-15
WP_003611201.1|240076_240856_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.9	1.1e-07
WP_003616162.1|240904_242188_-	GTPase HflX	NA	NA	NA	NA	NA
WP_095439208.1|242323_243373_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.5e-52
WP_003616161.1|243768_244803_+	LCP family protein	NA	NA	NA	NA	NA
WP_003616160.1|244802_245690_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003616159.1|245699_246482_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003616158.1|246485_247262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161536.1|247295_248168_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_095439198.1|248321_249371_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.1e-52
WP_003616151.1|250159_251239_+	glycoside hydrolase family 99-like domain-containing protein	NA	A0A1V0SDW6	Indivirus	28.8	9.9e-28
WP_003616150.1|251263_252406_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003616149.1|252416_253502_+	EpsG family protein	NA	NA	NA	NA	NA
WP_003616148.1|253523_253907_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.0	1.1e-10
WP_003616147.1|253912_254497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439210.1|254651_255749_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011544347.1|255680_255905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439200.1|255876_257628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057727135.1|257785_258025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439211.1|258073_259516_+	flippase	NA	NA	NA	NA	NA
WP_003616140.1|259723_259906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011544347.1|260072_260297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439212.1|260268_262020_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	289105	343765	2165984	protease,transposase	unidentified_phage(21.43%)	43	NA	NA
WP_095439214.1|289105_289774_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	9.7e-50
WP_095439215.1|289742_291449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095439216.1|291698_291944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035182815.1|292260_293148_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_035182812.1|293487_296742_+	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003616098.1|296905_298135_+	LCP family protein	NA	NA	NA	NA	NA
WP_003616097.1|300030_301011_+	LCP family protein	NA	NA	NA	NA	NA
WP_095439199.1|301284_302652_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003616096.1|302782_303379_+	sugar transferase	NA	NA	NA	NA	NA
WP_003616095.1|303395_304172_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_003616094.1|304192_305308_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	71.5	3.1e-157
WP_003616092.1|305528_306434_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_095439217.1|306740_307790_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	8.6e-53
WP_003616085.1|310129_311563_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003616084.1|311576_312488_+	LicD family protein	NA	A0A1V0SD50	Indivirus	51.1	3.6e-07
WP_003616083.1|312504_312969_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A0F7LBI5	uncultured_marine_virus	39.2	8.3e-16
WP_003616082.1|313036_314299_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
WP_003616081.1|314309_314978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616076.1|316982_318644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616075.1|318740_319550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616074.1|319792_320242_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003616072.1|320968_321676_+	VanZ family protein	NA	NA	NA	NA	NA
WP_095439217.1|321999_323049_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	8.6e-53
WP_003613114.1|324589_324724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035165265.1|324743_325247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616066.1|325553_326246_-	glycerophosphoryl diester phosphodiesterase	NA	M1ICP4	Paramecium_bursaria_Chlorella_virus	29.8	4.7e-15
WP_003616065.1|326356_327010_-	phosphoglycerate mutase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	45.6	3.2e-05
WP_003612123.1|327024_327687_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003616061.1|327882_330162_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_003616060.1|330525_331167_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003616059.1|331178_331811_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	9.8e-28
WP_013440141.1|331813_332644_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003616057.1|332705_333455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616056.1|333460_333904_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616055.1|334032_334602_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_003612148.1|334704_335619_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	33.9	6.4e-28
WP_002879354.1|335671_336229_+	elongation factor P	NA	NA	NA	NA	NA
WP_003616052.1|336284_337082_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003616051.1|337229_338144_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_016395838.1|338895_340263_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_016396871.1|340992_342588_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	7.0e-14
WP_157737565.1|342564_342741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439217.1|342715_343765_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	8.6e-53
>prophage 5
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	368050	463105	2165984	tRNA,transposase	Ralstonia_virus(17.65%)	58	NA	NA
WP_003612150.1|368050_369358_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.0	2.0e-91
WP_003616016.1|369515_370079_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003616015.1|370092_370959_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_003616013.1|376776_377379_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003616012.1|377457_378177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057727119.1|378253_379123_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003616008.1|379429_380431_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003616007.1|380449_381379_+	carbamate kinase	NA	NA	NA	NA	NA
WP_095439221.1|381720_382944_+	arginine deiminase	NA	NA	NA	NA	NA
WP_003616000.1|388463_389633_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003611152.1|389625_390675_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003615999.1|390667_391681_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_095439222.1|391699_393772_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.2	3.1e-139
WP_002876914.1|393826_394060_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_035182797.1|394126_396496_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.2	1.1e-76
WP_003611142.1|396518_396980_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.6	7.9e-43
WP_095439300.1|397184_398447_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003615992.1|398972_399449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615990.1|399460_400696_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003615989.1|400695_401376_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.7e-23
WP_003615988.1|401378_401546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615987.1|401810_403145_+	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_003615985.1|405161_405944_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615984.1|405943_406444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615983.1|406449_406938_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003615982.1|407110_407605_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615981.1|407815_408595_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	29.7	4.5e-14
WP_003615979.1|408604_409768_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003615977.1|409748_410963_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	1.5e-88
WP_003615975.1|410949_411390_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003615973.1|411390_412818_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003615971.1|412903_414118_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_095439223.1|419965_420625_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	47.7	9.2e-45
WP_003615967.1|422618_423998_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_016395838.1|424398_425766_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003615966.1|426404_427439_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_003615963.1|427457_428270_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003615961.1|428298_429213_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_003615959.1|429222_429591_+	DUF956 family protein	NA	NA	NA	NA	NA
WP_003615956.1|430214_431585_-	amino acid permease	NA	NA	NA	NA	NA
WP_003615955.1|431777_432620_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_003615954.1|432812_433802_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	38.7	3.6e-53
WP_003615953.1|433919_435062_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	29.6	2.5e-29
WP_003615951.1|435210_436398_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_003615944.1|438287_439457_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_003615943.1|439462_439912_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	63.0	8.5e-34
WP_095439224.1|441312_441588_-	hypothetical protein	NA	V5US45	Oenococcus_phage	76.6	3.9e-21
WP_095439225.1|441804_443172_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035182793.1|445018_447769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615939.1|449706_450672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615937.1|450673_451381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615935.1|451386_452379_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_095439226.1|452413_453601_+	DNA (cytosine-5-)-methyltransferase	NA	D2IZY5	Enterococcus_phage	32.6	3.5e-26
WP_003617894.1|455378_455636_+	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_157737566.1|456899_457238_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_003615931.1|458410_459646_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_003615930.1|459932_461222_+	alpha-amylase	NA	NA	NA	NA	NA
WP_016395838.1|461737_463105_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
>prophage 6
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	549972	600503	2165984	transposase,bacteriocin	Planktothrix_phage(13.64%)	45	NA	NA
WP_095439235.1|549972_551022_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	8.6e-53
WP_003616753.1|551590_552511_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003616755.1|552532_553564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013439040.1|553577_554621_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.7e-19
WP_003616760.1|554635_555589_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	3.5e-21
WP_095439236.1|555542_555803_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_003616764.1|555934_557248_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.3	3.7e-61
WP_003616771.1|558710_559124_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_002877232.1|559351_559813_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003616773.1|559894_561184_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	38.2	1.4e-73
WP_003616774.1|561368_562361_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	68.7	2.7e-133
WP_016395838.1|562631_563999_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003619451.1|565156_565516_+	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	34.8	7.8e-06
WP_003616783.1|565585_566878_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.2	1.4e-28
WP_003616785.1|566907_567477_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_095439201.1|567735_569103_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
WP_002877243.1|569347_570505_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.2	5.6e-53
WP_095439237.1|570504_572058_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.7	7.8e-18
WP_003616790.1|572382_572634_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_003616793.1|572620_572992_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	45.6	8.9e-21
WP_095439300.1|573274_574537_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003616800.1|577199_578810_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	27.6	1.1e-17
WP_035182900.1|578844_579687_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003616804.1|579843_581316_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.9	3.7e-25
WP_003616806.1|581368_581599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616808.1|581648_581864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876658.1|581964_582777_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003616812.1|582828_583578_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.9e-31
WP_035161049.1|583574_584285_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003616815.1|584705_584960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616821.1|585547_586810_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_035160947.1|586902_587868_-	Crp/Fnr family transcriptional regulator	NA	A0A1B3AYT3	Gordonia_phage	31.7	2.8e-05
WP_003616826.1|588013_589408_-	amino acid permease	NA	NA	NA	NA	NA
WP_035160948.1|589485_590418_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003616830.1|590473_590935_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_002876645.1|591295_591742_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616833.1|591723_592746_+	asparaginase	NA	NA	NA	NA	NA
WP_016395838.1|592835_594203_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003616837.1|595302_595779_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003616839.1|595858_597292_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.3e-103
WP_003616841.1|597360_597915_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	39.1	3.1e-33
WP_035160952.1|598167_599025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616849.1|599017_599284_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_003616851.1|599380_600151_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	25.0	1.6e-08
WP_157737568.1|600326_600503_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 7
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	722029	792811	2165984	tRNA,transposase	Catovirus(18.75%)	55	NA	NA
WP_003617020.1|722029_722335_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_002878083.1|722334_723777_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003617022.1|723782_725213_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003617024.1|725248_726175_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	25.9	1.4e-14
WP_003617027.1|726235_726949_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003617030.1|726951_728307_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.1	5.8e-110
WP_003617032.1|728727_729525_+	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_003617037.1|729804_730440_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003617044.1|732708_733269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617046.1|733417_735346_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.0	4.9e-94
WP_003617048.1|735368_735596_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003617050.1|735646_735928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617051.1|735952_736603_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_157737569.1|736685_738090_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.7	1.4e-42
WP_003617053.1|738153_738921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617055.1|739036_739324_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617057.1|739345_739609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617060.1|740922_742344_+	pyridoxal-dependent decarboxylase	NA	NA	NA	NA	NA
WP_003617067.1|745726_746941_+	MFS transporter	NA	NA	NA	NA	NA
WP_016395775.1|747072_747399_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003617072.1|747512_747926_+	trp repressor-binding protein	NA	NA	NA	NA	NA
WP_003617074.1|748042_748924_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.4	9.8e-50
WP_095439199.1|748994_750362_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_035183061.1|752131_752803_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003617081.1|752846_753353_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_148465398.1|753668_755804_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003617084.1|756213_757542_+	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	39.5	8.6e-58
WP_003617086.1|757634_758219_+	nodulation protein L	NA	NA	NA	NA	NA
WP_003617088.1|758289_758646_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003617090.1|758771_759257_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617092.1|759465_761277_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.7	6.0e-94
WP_016395838.1|762088_763456_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003611500.1|765158_767030_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_003617099.1|767495_768641_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_035182921.1|768765_771495_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_003617105.1|771887_773510_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	28.2	4.3e-51
WP_003617107.1|773569_773692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035162331.1|773853_774219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439245.1|774461_775661_-	MFS transporter	NA	NA	NA	NA	NA
WP_095439305.1|775789_777052_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.4	5.9e-56
WP_003617113.1|777256_777970_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_003617115.1|778236_779022_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003617117.1|779099_780521_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003617119.1|780534_781620_+	M42 family peptidase	NA	NA	NA	NA	NA
WP_016395747.1|781827_782397_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003617123.1|782726_783353_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	42.8	7.2e-39
WP_003617126.1|783352_784009_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	9.9e-39
WP_003617127.1|784551_785292_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	1.1e-33
WP_003617129.1|785313_786153_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002878013.1|786152_786794_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002878011.1|786805_787474_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003617132.1|787515_788361_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016395838.1|788497_789865_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003617134.1|790082_791594_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_095439208.1|791761_792811_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.5e-52
>prophage 8
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	932802	985770	2165984	tRNA,transposase	Bacillus_phage(26.67%)	51	NA	NA
WP_095439306.1|932802_934065_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_095439250.1|934064_934403_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_002880036.1|934399_934837_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_003617365.1|934826_935093_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_050782112.1|935061_935679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002880040.1|935820_936819_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003614731.1|936852_938040_+	acetate kinase	NA	NA	NA	NA	NA
WP_095439300.1|938885_940148_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003617369.1|940224_940380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002880043.1|940559_941285_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003617371.1|941281_942847_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.0	9.9e-29
WP_003617373.1|942894_945117_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	43.2	1.7e-146
WP_095439199.1|945313_946681_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_050782113.1|946835_947405_+	VanZ family protein	NA	NA	NA	NA	NA
WP_095439201.1|947430_948798_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
WP_003617377.1|949000_950341_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003617386.1|952513_953518_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	22.2	2.3e-10
WP_003617388.1|953540_953792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016396364.1|953853_955209_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_013439306.1|955349_955952_+	thymidine kinase	NA	C1KFH3	Lactobacillus_virus	49.7	2.2e-45
WP_003617391.1|955975_957061_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_003617392.1|957053_957896_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002880061.1|957895_958891_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	38.0	7.2e-49
WP_002880062.1|958990_959620_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003613585.1|959736_960456_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003617393.1|960474_960699_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003617394.1|960752_961259_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003617395.1|961258_961801_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016396362.1|961823_963335_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003617398.1|963345_964308_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016396361.1|964327_965767_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003617401.1|965778_966219_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004560494.1|966267_966498_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_016396360.1|966583_967573_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003617406.1|967575_967863_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	45.8	6.0e-17
WP_002880076.1|967875_968103_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_003617409.1|968127_969318_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003617412.1|969389_969851_-	universal stress protein	NA	NA	NA	NA	NA
WP_003617414.1|969908_970193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617415.1|970544_971849_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.4	2.9e-106
WP_003617417.1|971845_972310_-	YueI family protein	NA	NA	NA	NA	NA
WP_003617420.1|972434_973046_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_072538245.1|973219_974269_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_003617422.1|974594_976313_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003617423.1|976398_977556_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	32.4	7.1e-40
WP_003617425.1|977558_978776_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_003617427.1|978775_979501_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003617431.1|979763_982403_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.3	5.4e-160
WP_003617432.1|982407_983673_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_169845245.1|983690_984377_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_095439252.1|984402_985770_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	3.2e-31
>prophage 10
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1118700	1189412	2165984	tRNA,transposase	Ralstonia_virus(23.08%)	57	NA	NA
WP_016395838.1|1118700_1120068_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_072538245.1|1120231_1121281_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_003617646.1|1121434_1124296_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003617648.1|1124373_1125216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617656.1|1126523_1126808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003617658.1|1126846_1129273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877544.1|1129308_1129728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439300.1|1129768_1131031_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_155114311.1|1131243_1131390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617664.1|1131434_1132340_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617666.1|1132358_1133264_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003617670.1|1135093_1136476_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_035164806.1|1136735_1136939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617675.1|1137277_1137502_-	helix-turn-helix transcriptional regulator	NA	B8R666	Lactobacillus_phage	51.4	2.3e-11
WP_003617676.1|1137956_1138652_+	FMN-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	33.7	4.7e-15
WP_003617677.1|1138710_1139103_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_003617678.1|1139115_1139757_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_003617679.1|1139942_1140551_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_003617686.1|1140553_1141222_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	28.5	1.3e-17
WP_095439258.1|1141224_1142484_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003617689.1|1142531_1144964_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003617694.1|1145121_1145856_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_003617696.1|1145852_1147727_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_095439259.1|1147746_1148601_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_003617700.1|1149261_1150293_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_035165464.1|1150306_1150597_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_095439242.1|1151717_1153085_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	1.1e-31
WP_003617706.1|1153317_1154418_+	thiolase family protein	NA	NA	NA	NA	NA
WP_003617708.1|1154419_1155646_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003613854.1|1155649_1156813_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003617712.1|1156976_1158335_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_035164818.1|1158391_1158898_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_003617719.1|1158960_1159905_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003617724.1|1160045_1162307_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	34.9	5.7e-09
WP_003613864.1|1162335_1162773_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003617729.1|1163058_1164345_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	25.7	2.9e-26
WP_003617731.1|1164360_1166205_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SFI4	Hokovirus	33.7	3.1e-05
WP_095439260.1|1166913_1168689_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_003617737.1|1168764_1169838_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003611786.1|1171590_1172550_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016395838.1|1172711_1174079_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_002877474.1|1174138_1174384_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003617742.1|1174396_1175341_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_003617745.1|1175324_1176047_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	9.9e-16
WP_003617746.1|1176056_1177277_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_035183091.1|1177279_1177750_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002877460.1|1177751_1178195_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003617750.1|1178187_1179570_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003611769.1|1179556_1180405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617752.1|1180397_1181165_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_035183093.1|1181174_1181939_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_003617756.1|1181948_1182614_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003611793.1|1182862_1183483_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_035182949.1|1183640_1183862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003617766.1|1184298_1185069_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_035182951.1|1185191_1187894_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_095439261.1|1188362_1189412_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.1e-52
>prophage 11
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1196013	1240838	2165984	transposase	Bacillus_phage(23.08%)	37	NA	NA
WP_095439300.1|1196013_1197276_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003614946.1|1197338_1198931_-	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	39.4	1.4e-99
WP_003614947.1|1201144_1202764_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003614948.1|1202854_1203097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614953.1|1203653_1203803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614955.1|1203882_1204647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016395838.1|1204759_1206127_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003614957.1|1208327_1209212_+	phosphate ABC transporter substrate-binding protein	NA	A0A1D7SQC1	Cyanophage	30.2	3.2e-08
WP_003614665.1|1209231_1210140_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003614664.1|1210142_1211018_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_035182682.1|1211020_1211776_+	phosphate ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	1.4e-15
WP_003614960.1|1211794_1212433_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002878532.1|1212518_1213196_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.2e-32
WP_003614964.1|1213195_1214854_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	35.1	2.3e-31
WP_095439262.1|1215371_1216739_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	1.1e-31
WP_003614970.1|1218370_1219027_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_155114309.1|1219103_1219247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439243.1|1219336_1219879_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	26.7	2.2e-07
WP_095439261.1|1220072_1221122_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	1.1e-52
WP_003614974.1|1222092_1222644_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_035182684.1|1223004_1224561_-	YfcC family protein	NA	NA	NA	NA	NA
WP_003614977.1|1224807_1225575_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	28.2	3.3e-09
WP_003614648.1|1226361_1227138_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_003614981.1|1227134_1227749_-	membrane protein	NA	NA	NA	NA	NA
WP_003614982.1|1228138_1229248_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003614984.1|1229535_1230564_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	28.0	2.6e-09
WP_003614986.1|1230570_1231152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614987.1|1231251_1232073_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_035161335.1|1233062_1233383_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_051975781.1|1233468_1234026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095439263.1|1234065_1234848_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614991.1|1235461_1235812_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003614992.1|1235808_1236882_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	42.3	8.0e-38
WP_003614993.1|1236865_1238203_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003614994.1|1238192_1239284_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_003614996.1|1239295_1239832_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_095439264.1|1240253_1240838_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1268019	1332431	2165984	tRNA,transposase	Bacillus_phage(15.0%)	55	NA	NA
WP_095439266.1|1268019_1269318_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.9	1.6e-53
WP_002878410.1|1269408_1270056_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	38.4	1.0e-08
WP_002878412.1|1270077_1270707_+	endonuclease III	NA	NA	NA	NA	NA
WP_003615040.1|1270741_1271545_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_120490347.1|1271579_1272065_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_003615044.1|1272058_1272487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615046.1|1272647_1273649_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.2	2.2e-37
WP_016395838.1|1273738_1275106_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003615050.1|1277465_1279778_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_003615052.1|1279764_1280397_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.1	3.4e-20
WP_013439504.1|1280557_1281118_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003615059.1|1281193_1281658_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_003615060.1|1282175_1283300_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003615062.1|1283309_1284542_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_095439267.1|1284696_1284888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439242.1|1284963_1286331_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	29.4	1.1e-31
WP_035182686.1|1286561_1288241_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_002876847.1|1288252_1288705_+	signal peptidase II	NA	NA	NA	NA	NA
WP_003615065.1|1288706_1289621_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.9	1.5e-08
WP_002876844.1|1289622_1290678_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_003615066.1|1290677_1293869_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003615067.1|1293962_1294244_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_002876840.1|1294243_1295587_+	PFL family protein	NA	NA	NA	NA	NA
WP_003615068.1|1297169_1298861_-	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	45.2	1.9e-09
WP_003615069.1|1299013_1299475_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	57.4	2.4e-39
WP_035182688.1|1299541_1300954_+|transposase	transposase	transposase	A0A2I7RKG5	Vibrio_phage	34.0	1.4e-10
WP_003615074.1|1301866_1302409_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_095439268.1|1302566_1303448_+	DegV family protein	NA	NA	NA	NA	NA
WP_003615077.1|1303503_1304577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615080.1|1304642_1305554_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003615085.1|1305754_1306930_-	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	47.6	1.0e-102
WP_035182690.1|1306948_1308031_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.5	1.9e-79
WP_003615090.1|1308374_1308998_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003615092.1|1309056_1309398_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003615094.1|1309581_1310100_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	30.4	8.4e-09
WP_035182962.1|1310504_1311515_+	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.8	2.0e-22
WP_003615098.1|1311514_1312744_+	dihydroorotase	NA	NA	NA	NA	NA
WP_016395838.1|1312888_1314256_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003615099.1|1314328_1315405_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_003615100.1|1315627_1316776_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.5	1.7e-41
WP_003615103.1|1318105_1318684_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_002878430.1|1319662_1319833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615108.1|1319967_1320435_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_148465385.1|1320431_1321010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035184411.1|1321366_1321627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615115.1|1321814_1322849_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0K0KVL7	Prochlorococcus_phage	26.3	1.7e-08
WP_003615119.1|1322879_1323200_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_035182692.1|1324847_1325054_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_035182693.1|1325134_1325854_+	HAD family hydrolase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	24.6	1.9e-06
WP_035182695.1|1325855_1326122_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_095439300.1|1326182_1327445_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	1.7e-55
WP_003615130.1|1327684_1330228_+	YfhO family protein	NA	NA	NA	NA	NA
WP_080553950.1|1330355_1330853_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_057727132.1|1330800_1331223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072538245.1|1331381_1332431_+|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
>prophage 13
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1345489	1565738	2165984	protease,transposase,integrase,tRNA	Streptococcus_phage(16.39%)	178	1331381:1331440	1552635:1552674
1331381:1331440	attL	AATGGATCATTCATATTCTAACACTAAACCACACCAAAAGGGCAAGCACCTTACGCTAAA	NA	NA	NA	NA
WP_095439269.1|1345489_1346539_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.9	7.3e-52
1331381:1331440	attL	AATGGATCATTCATATTCTAACACTAAACCACACCAAAAGGGCAAGCACCTTACGCTAAA	NA	NA	NA	NA
WP_080553952.1|1346810_1347200_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003615157.1|1348795_1349533_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615159.1|1350177_1350819_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	34.9	2.3e-24
WP_003615160.1|1351010_1351481_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615161.1|1351785_1352700_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.8	1.3e-25
WP_057727096.1|1352696_1353557_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_035182708.1|1353773_1354238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615169.1|1354857_1355256_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	35.1	2.0e-10
WP_003615172.1|1355469_1355796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095439270.1|1355957_1356710_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	7.8e-32
WP_003615175.1|1356732_1358607_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003615177.1|1359154_1359700_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003615178.1|1359692_1360613_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_165380480.1|1361509_1361686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880312.1|1361976_1362183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615189.1|1362878_1363436_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615191.1|1363661_1364198_-	SLAP domain-containing protein	NA	NA	NA	NA	NA
WP_003614261.1|1364229_1364817_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	9.1e-28
WP_003615193.1|1364951_1366133_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003615195.1|1366169_1366949_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_003615198.1|1366951_1367881_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003615199.1|1367904_1369059_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_003615201.1|1369119_1369833_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615203.1|1370345_1371719_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003615205.1|1371720_1372707_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_016396593.1|1372753_1374022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615207.1|1374030_1374381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182710.1|1374743_1376075_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003615211.1|1377510_1378083_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.0	4.3e-30
WP_003615213.1|1380097_1380616_-	Fic family protein	NA	NA	NA	NA	NA
WP_013439619.1|1380885_1381077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615220.1|1381126_1381975_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_003615223.1|1382019_1383444_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003615224.1|1383436_1384411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161197.1|1384410_1385151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002880372.1|1385260_1385458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615228.1|1385605_1386217_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_003615229.1|1386295_1387048_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003614258.1|1387120_1388032_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_035161202.1|1388190_1389621_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_003615231.1|1389721_1391242_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003615234.1|1392490_1392949_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615236.1|1393031_1393451_+	3-beta hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_095439206.1|1395174_1396398_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	2.3e-97
WP_035164940.1|1398296_1399469_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_035182712.1|1399771_1405546_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.1	1.2e-10
WP_035161211.1|1405999_1406503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003615252.1|1406583_1407084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615254.1|1407517_1408132_+	DedA family protein	NA	NA	NA	NA	NA
WP_003615255.1|1408499_1409516_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.8	1.6e-59
WP_095439271.1|1409591_1410890_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	28.4	4.8e-53
WP_003615257.1|1410955_1411963_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003615258.1|1412005_1415029_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.5	6.2e-136
WP_035182717.1|1415032_1416916_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_095439309.1|1417073_1418336_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.9	7.2e-54
WP_003615260.1|1418555_1419146_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003615263.1|1419746_1420583_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003615265.1|1420626_1421193_+	signal peptidase I	NA	NA	NA	NA	NA
WP_072538245.1|1421256_1422306_-|transposase	IS30-like element ISL7 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_002878604.1|1422514_1422706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615268.1|1423092_1424331_-	peptidase T	NA	NA	NA	NA	NA
1422248:1423351	attR	TTTAGCGTAAGGTGCTTGCCCTTTTGGTGTGGTTTAGTGTTAGAATATGAATGATCCATTTTAACCTCTCTAGAAATGTTTGTGGTAATTCATATTCTACCAGATGGTTGAAATGGATTTTTTGTGCTCTAATCCAGTGAAAACGATTTTTCTTACTGGATCGGAACAGTGTTCAGTTTAATTTTACAATCGGCGTAAAAAATTCTGAAGCTCCCTCAACAACTTTTCAAAAAATGGTAAAATACGGTTATTAAGGAGTGAAGATCAATGAAACCAGAAGAACTTTCGGATGCAATCATCGAATTTCAGAGCAAGCACGCTGTGAGCGATACTACCCTGGCCTTTGCCAGCCACCTCTCAGTGGAAAAGGTGCACGCCATGAAGCAAGGGCGGGGCAACTTTACCAGCGATGAAATCAACCAGATGCTGGACTATCTCCAGAGCTATCTCCAGAGCTAAATGTAAGCAACCGGGCCAAACGGCCCGGTTTTCTTTTGCCCTTTTTTCTCTGCTTTTTCCCTCTCTCATTTCTTTTTATCACTTCATTGTTTCACGCTAACCATTTTACATTTTGCATAAAGTTTAAAATAGTAAGAAGATTGTTATATAAAGGACAACGGCTACTATTTCTTAACAGCTGCCATTTTTATCATTTAGCTTTAACCCGCTATCGCAAGCGATAAAGCTTGCTATTACAGCATTTATCTTTCTAACTCTGTAAGCCTTTTTCTCCAATTTTTGTTCCACGGTCTCTTTTTACCCTATCCCCGGCCAAGTTATTCACAGACAAAAAATAAGAGCCACCCTAGAGCAGCTCTTATCCTTTATATTTAAGTTATCTTGTCTTACTTGTTCCGTTCAGCTTGCAGTTCAGCCATCTTGATCATGACGTCAACAGCCTTCCACATTGATTCCAGAACCGTGTATTCGTAGCGGCCGTGCATGTTTTCTTCCCCGGCAAAGAGGTTCGGGCATGGCAGACCCATGTAAGTCAGTTGTGACCCGTCCGTACCCCCTCTGACTGGTTCTTCATTGATTTCAGTCAAGCCGCAGGCTCTGTAAGCATCCCGGGCCAGGTCAATGATTTCCATGTGCTTGGCCAGT	NA	NA	NA	NA
WP_003615270.1|1424374_1425172_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
1422248:1423351	attR	TTTAGCGTAAGGTGCTTGCCCTTTTGGTGTGGTTTAGTGTTAGAATATGAATGATCCATTTTAACCTCTCTAGAAATGTTTGTGGTAATTCATATTCTACCAGATGGTTGAAATGGATTTTTTGTGCTCTAATCCAGTGAAAACGATTTTTCTTACTGGATCGGAACAGTGTTCAGTTTAATTTTACAATCGGCGTAAAAAATTCTGAAGCTCCCTCAACAACTTTTCAAAAAATGGTAAAATACGGTTATTAAGGAGTGAAGATCAATGAAACCAGAAGAACTTTCGGATGCAATCATCGAATTTCAGAGCAAGCACGCTGTGAGCGATACTACCCTGGCCTTTGCCAGCCACCTCTCAGTGGAAAAGGTGCACGCCATGAAGCAAGGGCGGGGCAACTTTACCAGCGATGAAATCAACCAGATGCTGGACTATCTCCAGAGCTATCTCCAGAGCTAAATGTAAGCAACCGGGCCAAACGGCCCGGTTTTCTTTTGCCCTTTTTTCTCTGCTTTTTCCCTCTCTCATTTCTTTTTATCACTTCATTGTTTCACGCTAACCATTTTACATTTTGCATAAAGTTTAAAATAGTAAGAAGATTGTTATATAAAGGACAACGGCTACTATTTCTTAACAGCTGCCATTTTTATCATTTAGCTTTAACCCGCTATCGCAAGCGATAAAGCTTGCTATTACAGCATTTATCTTTCTAACTCTGTAAGCCTTTTTCTCCAATTTTTGTTCCACGGTCTCTTTTTACCCTATCCCCGGCCAAGTTATTCACAGACAAAAAATAAGAGCCACCCTAGAGCAGCTCTTATCCTTTATATTTAAGTTATCTTGTCTTACTTGTTCCGTTCAGCTTGCAGTTCAGCCATCTTGATCATGACGTCAACAGCCTTCCACATTGATTCCAGAACCGTGTATTCGTAGCGGCCGTGCATGTTTTCTTCCCCGGCAAAGAGGTTCGGGCATGGCAGACCCATGTAAGTCAGTTGTGACCCGTCCGTACCCCCTCTGACTGGTTCTTCATTGATTTCAGTCAAGCCGCAGGCTCTGTAAGCATCCCGGGCCAGGTCAATGATTTCCATGTGCTTGGCCAGT	NA	NA	NA	NA
WP_003615272.1|1425164_1425857_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003615274.1|1426128_1427427_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	39.2	1.1e-73
WP_003615275.1|1427793_1428234_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003615277.1|1428233_1429040_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011544347.1|1430356_1430581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615282.1|1431218_1431551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439310.1|1431715_1434802_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	34.9	2.9e-141
WP_035182971.1|1434812_1436681_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.9	7.5e-116
WP_003615288.1|1436688_1437312_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_003615289.1|1437312_1440549_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	43.8	5.3e-234
WP_003615290.1|1440883_1442977_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_003615291.1|1443251_1443476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615293.1|1443698_1444160_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_035182722.1|1444180_1445017_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003615301.1|1447192_1448104_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.2	2.4e-14
WP_003615302.1|1448155_1448875_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_003613025.1|1449001_1449328_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003615304.1|1449473_1450832_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_095439272.1|1451056_1452280_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.2	2.5e-96
WP_003615307.1|1452542_1453076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615309.1|1453097_1453496_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003615311.1|1453579_1453900_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003615313.1|1454375_1455821_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	3.6e-33
WP_095439273.1|1456612_1459306_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.0	3.7e-55
WP_070489256.1|1459516_1459855_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_003617847.1|1459931_1460177_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035183202.1|1460183_1460306_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095439274.1|1460706_1462413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614608.1|1462381_1463050_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_003615315.1|1463227_1464364_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	33.8	6.1e-36
WP_003615316.1|1464399_1465521_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.0	2.9e-38
WP_003615317.1|1465562_1466681_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.8	1.2e-36
WP_003615318.1|1466652_1468491_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.9	5.4e-58
WP_003615319.1|1468522_1470589_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003615321.1|1470581_1471493_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003615323.1|1471758_1472508_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003612996.1|1472507_1473413_-	GTPase Era	NA	NA	NA	NA	NA
WP_002880164.1|1473396_1473816_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_003615327.1|1473817_1474342_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_035161276.1|1474341_1475289_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.4	8.9e-49
WP_002880182.1|1475442_1475619_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003615330.1|1475787_1476645_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_003615332.1|1476705_1476978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615333.1|1477043_1477928_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	25.6	2.6e-18
WP_003615335.1|1478134_1478767_-|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	32.1	1.1e-13
WP_003615339.1|1479362_1480547_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003613129.1|1480727_1482038_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_003615341.1|1482396_1483131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050782110.1|1483272_1483557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095439276.1|1484166_1485864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003614608.1|1485832_1486501_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_155517555.1|1486605_1486863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080553953.1|1486862_1487108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003613145.1|1487430_1488327_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003615348.1|1488412_1489807_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.0	6.5e-32
WP_003613136.1|1489809_1490343_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003613135.1|1490451_1491339_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	30.5	6.4e-25
WP_003615349.1|1491338_1492658_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_003615350.1|1492789_1494964_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.9	1.0e-92
WP_003615351.1|1495090_1495930_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.9	5.3e-29
WP_003615352.1|1496020_1496791_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.2	3.3e-25
WP_003615353.1|1496780_1497638_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003613715.1|1497712_1497943_-	YozE family protein	NA	NA	NA	NA	NA
WP_002880203.1|1497946_1498792_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	45.0	1.0e-19
WP_003615360.1|1498927_1499608_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_095439277.1|1499720_1500755_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.5e-52
WP_035161293.1|1500851_1502042_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	47.8	2.4e-43
WP_095439201.1|1502104_1503472_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
WP_095439220.1|1503573_1504941_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.2	4.2e-31
WP_003615364.1|1506757_1507657_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.5	1.3e-52
WP_002880208.1|1507691_1507937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615365.1|1508010_1508307_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003615366.1|1508405_1508597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615368.1|1509073_1510846_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	5.2e-50
WP_003615372.1|1512973_1513876_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	5.2e-06
WP_035182728.1|1513946_1514744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615376.1|1515016_1515604_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003615379.1|1515699_1516536_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	39.7	5.6e-47
WP_002879863.1|1516843_1518121_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	51.4	9.3e-110
WP_003615383.1|1518377_1518986_-	DUF4230 domain-containing protein	NA	NA	NA	NA	NA
WP_002879870.1|1519494_1520235_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	7.2e-30
WP_003615385.1|1520255_1521758_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003615387.1|1521805_1522660_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	32.5	9.3e-05
WP_003615389.1|1522837_1525096_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.5	2.1e-40
WP_035182731.1|1525373_1526507_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003615395.1|1526623_1527649_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003615397.1|1527850_1528738_-	cation transporter	NA	NA	NA	NA	NA
WP_003615398.1|1528849_1529152_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035161317.1|1529231_1529759_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.8	6.5e-25
WP_003615400.1|1529748_1532025_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.4	1.8e-71
WP_003615401.1|1532021_1532723_-	class A sortase	NA	NA	NA	NA	NA
WP_003615403.1|1532703_1534542_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.5	1.5e-20
WP_003615404.1|1534663_1535803_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	25.9	3.1e-16
WP_003615406.1|1535885_1537730_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	6.0e-142
WP_003615408.1|1537789_1538389_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_035182733.1|1538423_1539473_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003615411.1|1539608_1540550_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SD03	Indivirus	26.9	9.3e-06
WP_080553976.1|1540663_1541257_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	39.6	7.8e-35
WP_052109142.1|1542764_1543181_-	Arm DNA-binding domain-containing protein	NA	Q938N9	Temperate_phage	33.6	6.1e-10
WP_095439278.1|1544049_1544844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003615418.1|1546141_1547053_+	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	41.8	6.3e-60
WP_003615419.1|1547074_1548259_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003615420.1|1548224_1548782_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_035182982.1|1549088_1549274_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_095439225.1|1549299_1550667_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_095439279.1|1550905_1552129_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	1.9e-96
WP_095439280.1|1552434_1552617_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003615423.1|1553511_1554408_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002876717.1|1554458_1554821_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_003615426.1|1554833_1557311_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.9	2.3e-19
WP_002876720.1|1557315_1557600_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_002876722.1|1557626_1557926_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002876724.1|1557935_1559087_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002876725.1|1559106_1559583_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003615435.1|1564040_1565738_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1610681	1681426	2165984	tRNA,transposase	Ralstonia_virus(15.0%)	59	NA	NA
WP_016395838.1|1610681_1612049_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_016395838.1|1612194_1613562_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003615490.1|1613861_1614104_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	55.2	5.6e-08
WP_003615492.1|1614165_1615158_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003615494.1|1615183_1617223_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003615496.1|1617222_1618887_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002879711.1|1618906_1619269_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003615500.1|1619444_1619630_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_035182735.1|1619730_1621302_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	1.1e-16
WP_003615503.1|1621466_1622177_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003618477.1|1622173_1622416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615505.1|1622647_1622785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615506.1|1622980_1623664_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003615507.1|1623693_1624587_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_080553956.1|1624587_1626612_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SD90	Indivirus	26.3	4.9e-20
WP_003615509.1|1626583_1627339_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003615510.1|1627344_1628661_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003611980.1|1628650_1629598_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.1	4.8e-10
WP_003615511.1|1629610_1631992_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002879690.1|1632054_1632276_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003615512.1|1632277_1632892_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	29.2	2.1e-19
WP_003615513.1|1633065_1633371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615514.1|1633487_1633820_-	peptide ABC transporter	NA	NA	NA	NA	NA
WP_050782116.1|1633859_1634216_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003615517.1|1634425_1636114_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003615519.1|1636135_1636951_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_035182738.1|1636950_1637814_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003615522.1|1637818_1638058_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003615524.1|1638050_1639421_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.0	2.1e-30
WP_003615525.1|1639407_1640259_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	44.7	7.2e-42
WP_002879679.1|1640317_1640716_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002879678.1|1640715_1641150_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003615527.1|1641169_1641736_-	elongation factor P	NA	NA	NA	NA	NA
WP_016396438.1|1641805_1642912_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_035162038.1|1643056_1643350_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003615531.1|1643371_1643683_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003615533.1|1643923_1644280_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	41.8	6.3e-16
WP_095439282.1|1645150_1645567_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_095439311.1|1645763_1647026_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.2	4.2e-54
WP_003615539.1|1647080_1648346_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_035162042.1|1650484_1651528_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.3	6.3e-64
WP_003615543.1|1651530_1653009_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.4	1.8e-51
WP_003615544.1|1652984_1655207_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.2	6.5e-143
WP_003615545.1|1655206_1655881_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003615547.1|1655880_1656129_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003615550.1|1656133_1656856_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	36.8	1.3e-36
WP_003615552.1|1657179_1658475_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	1.4e-20
WP_035162044.1|1658518_1659643_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003615555.1|1659632_1660100_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.2	2.3e-18
WP_148465388.1|1660539_1660722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035165062.1|1661229_1661625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035165064.1|1663080_1663323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003615571.1|1667984_1670363_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_035174951.1|1671960_1672743_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003615579.1|1672785_1673709_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	65.3	8.8e-110
WP_095439272.1|1674347_1675571_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.2	2.5e-96
WP_095439283.1|1675693_1676947_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003615583.1|1677144_1678137_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_095439201.1|1680058_1681426_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	7.1e-31
>prophage 15
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1690957	1743564	2165984	protease,tRNA,transposase	Bacillus_phage(25.0%)	43	NA	NA
WP_003615601.1|1690957_1691875_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003614167.1|1691955_1692357_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003614169.1|1692419_1692647_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_003614162.1|1692646_1693318_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003615603.1|1693310_1693883_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002879260.1|1693936_1694086_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_035182742.1|1694172_1696287_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003615605.1|1696372_1698955_+	YfhO family protein	NA	NA	NA	NA	NA
WP_003615606.1|1700663_1701152_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003615607.1|1701222_1703634_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003615610.1|1703633_1704683_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.9	1.1e-31
WP_003615612.1|1704962_1705313_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002879252.1|1705394_1706159_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_095439284.1|1706349_1707399_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	6.6e-53
WP_003615614.1|1707475_1707748_+	acylphosphatase	NA	NA	NA	NA	NA
WP_003615616.1|1707781_1708744_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003615617.1|1708832_1710425_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002879246.1|1710417_1711131_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.1	1.9e-27
WP_003614912.1|1711310_1711889_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003615619.1|1711888_1713043_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002879243.1|1713046_1713394_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003615621.1|1713435_1714029_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003615623.1|1714021_1714660_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_035182745.1|1714670_1715780_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_002879237.1|1715888_1716245_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002879235.1|1716289_1716490_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002879234.1|1716510_1717032_-	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	39.7	6.4e-17
WP_003615627.1|1717574_1718804_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003615631.1|1719987_1721919_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	32.8	2.9e-94
WP_003615632.1|1722219_1723143_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	32.5	3.9e-25
WP_003615633.1|1723153_1724488_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_002879222.1|1724491_1724959_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003615637.1|1724972_1725557_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003615639.1|1725565_1726387_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	29.5	5.8e-20
WP_035182751.1|1726397_1729061_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	29.7	2.9e-60
WP_041812036.1|1729695_1730919_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.2	1.7e-97
WP_095439220.1|1732864_1734232_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.2	4.2e-31
WP_095439220.1|1736035_1737403_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.2	4.2e-31
WP_003617920.1|1738743_1740063_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_095439285.1|1740340_1741564_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.0	7.9e-98
WP_003615644.1|1741838_1742486_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_002879808.1|1742508_1742829_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002879806.1|1742907_1743564_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	1847543	1905316	2165984	tRNA,transposase	Ralstonia_virus(20.0%)	45	NA	NA
WP_016395838.1|1847543_1848911_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003617929.1|1849047_1850166_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003615771.1|1851865_1852528_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016396754.1|1852527_1853457_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003615773.1|1853468_1854098_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095439289.1|1854100_1855348_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	1.8e-25
WP_095439290.1|1855463_1856666_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002876514.1|1857230_1857503_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	1.1e-25
WP_095439292.1|1858286_1859336_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.2	3.3e-52
WP_002876509.1|1859531_1859897_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002876508.1|1859949_1860459_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003615780.1|1860719_1861121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003615782.1|1861345_1862596_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.9	2.9e-39
WP_003615784.1|1862691_1863696_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003615785.1|1863858_1864554_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002876501.1|1864637_1865063_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002876498.1|1865188_1865743_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003615789.1|1865834_1866005_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002876495.1|1866011_1866161_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003615790.1|1866336_1868088_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_002876482.1|1869109_1869325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016396767.1|1869392_1869962_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003615793.1|1870073_1870823_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002876476.1|1870809_1871253_-	ribonuclease iii family protein	NA	NA	NA	NA	NA
WP_003615794.1|1871245_1872670_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.1	2.1e-46
WP_035182765.1|1872812_1873379_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_095439199.1|1874075_1875443_+|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_003615806.1|1876209_1877085_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	29.1	9.5e-13
WP_035182766.1|1878314_1879817_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003615810.1|1879961_1880798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182767.1|1880797_1881496_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	8.9e-14
WP_002876367.1|1881497_1881866_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003615812.1|1882239_1883859_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003615813.1|1883990_1884515_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003615814.1|1884555_1885776_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_095439272.1|1887486_1888710_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.2	2.5e-96
WP_003615823.1|1889712_1890915_-	MFS transporter	NA	NA	NA	NA	NA
WP_003615825.1|1891209_1892331_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003616752.1|1893738_1895385_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095439293.1|1896702_1898331_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003616740.1|1898561_1900190_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003616729.1|1902012_1902663_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003616726.1|1902829_1903000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002877198.1|1903446_1903629_-	cytochrome c551	NA	NA	NA	NA	NA
WP_095439295.1|1904110_1905316_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	2019733	2101129	2165984	protease,transposase	Bacillus_phage(15.79%)	53	NA	NA
WP_095439311.1|2019733_2020996_-|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.2	4.2e-54
WP_095439277.1|2021571_2022606_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.5e-52
WP_003616558.1|2022828_2025075_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.4	2.8e-61
WP_035182882.1|2027071_2027680_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003616550.1|2027828_2030360_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.9e-72
WP_003616548.1|2030535_2030754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616546.1|2031057_2031975_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	3.2e-19
WP_003616543.1|2032145_2033093_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_095439312.1|2033311_2034574_+|transposase	IS3-like element ISL6 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.2	1.9e-54
WP_003616539.1|2034832_2035834_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003616536.1|2035827_2036139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616535.1|2036313_2037732_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003613167.1|2037757_2039161_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003616531.1|2039678_2039903_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_148465380.1|2040146_2040371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057727112.1|2040641_2041556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616523.1|2041614_2041854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616522.1|2041950_2042451_-	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	47.6	7.0e-37
WP_003616516.1|2043347_2044928_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.5	2.8e-15
WP_003616510.1|2047746_2049237_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.0	3.1e-96
WP_003616508.1|2049405_2050164_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003616503.1|2051902_2052571_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_035161674.1|2052765_2053002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003614608.1|2057420_2058089_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	49.8	5.7e-50
WP_080553986.1|2058263_2058977_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_003617868.1|2059073_2059928_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_035172677.1|2061834_2062032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616492.1|2062973_2063171_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.1	1.9e-17
WP_003616489.1|2063705_2063948_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	55.8	1.4e-06
WP_003613384.1|2066318_2067128_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_035182879.1|2067192_2068068_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003616481.1|2068060_2069371_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003616476.1|2075191_2075461_-	anion permease	NA	NA	NA	NA	NA
WP_169845243.1|2075400_2075622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016396126.1|2075682_2075865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003616470.1|2076250_2076715_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	1.5e-25
WP_013440306.1|2076729_2077908_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	5.8e-98
WP_003616467.1|2077927_2078542_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.9	4.6e-30
WP_003616462.1|2086081_2086708_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003616461.1|2086711_2088712_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	33.9	4.4e-29
WP_016396121.1|2088849_2089239_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003613653.1|2089398_2089623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003613649.1|2089797_2091084_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002879627.1|2091073_2091316_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_003616459.1|2091385_2092618_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.0	5.4e-22
WP_035182877.1|2092614_2094117_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.5	3.4e-42
WP_003613642.1|2094132_2094282_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_003616457.1|2094474_2094777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616456.1|2094813_2096022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003616454.1|2096619_2097090_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003616453.1|2097250_2099065_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.3	2.5e-63
WP_035165557.1|2099226_2100387_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003616451.1|2100472_2101129_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 18
NZ_CP022988	Lactobacillus delbrueckii subsp. lactis DSM 20072 chromosome, complete genome	2165984	2125814	2134175	2165984	transposase	Lactobacillus_virus(33.33%)	7	NA	NA
WP_095439199.1|2125814_2127182_-|transposase	ISL3-like element ISLdl1 family transposase	transposase	A4PE56	Ralstonia_virus	29.1	4.2e-31
WP_157737572.1|2127447_2128584_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.3	9.1e-24
WP_003611191.1|2128811_2129459_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.2e-49
WP_003611175.1|2129480_2130179_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	1.0e-54
WP_003616420.1|2130422_2131880_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003616418.1|2131899_2132646_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-27
WP_003616417.1|2132864_2134175_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.7	2.0e-51
