The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	8928	60707	5175249	tRNA,integrase,transposase	Wolbachia_phage(12.5%)	46	32556:32573	63433:63450
WP_074057959.1|8928_9852_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.2	1.6e-23
WP_074057958.1|10321_11989_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_074057957.1|12005_12866_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_095574581.1|12939_14523_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	41.4	2.5e-80
WP_074057955.1|14491_15697_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_074057954.1|15757_17128_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_095574582.1|17168_17906_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_006451098.1|17942_18950_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_006451097.1|19186_19747_-	phasin family protein	NA	NA	NA	NA	NA
WP_043889151.1|19998_20274_-	polyhydroxyalkanoic acid system family protein	NA	NA	NA	NA	NA
WP_023903666.1|20445_21255_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_006451093.1|21196_21853_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_006451092.1|21995_22964_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_006451091.1|23143_24229_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.6	6.8e-77
WP_095574583.1|24295_25495_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_074057951.1|25617_26934_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_043909286.1|26917_27385_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_074057950.1|27746_28412_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_074057949.1|28525_29806_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.8e-98
WP_095574585.1|29995_30758_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074057948.1|31123_32125_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
32556:32573	attL	ATCCCACTCTCTCCGCCA	NA	NA	NA	NA
WP_167387165.1|32657_34130_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157732739.1|34224_35100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574586.1|35479_35815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574587.1|35811_36126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574588.1|36168_36930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574589.1|37041_37380_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095575245.1|37576_38161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574590.1|38157_39087_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_095574591.1|39266_40715_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080995410.1|42021_43617_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_095575246.1|43784_44009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574592.1|44414_44894_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_095574593.1|44963_45146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574594.1|45340_45982_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_095574595.1|46016_48599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053055618.1|48735_50352_+	DNA methylase	NA	A0A220NUF4	Escherichia_phage	43.5	1.8e-97
WP_095574596.1|50354_53006_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_095574597.1|53017_54298_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_157732741.1|54336_54891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574599.1|54965_55346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574600.1|55805_56111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574601.1|56107_57210_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	1.5e-44
WP_095575247.1|57580_57982_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	41.5	9.7e-13
WP_095574602.1|58814_59207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056260.1|59726_60707_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
63433:63450	attR	ATCCCACTCTCTCCGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	483792	493694	5175249	tRNA	Moraxella_phage(16.67%)	7	NA	NA
WP_006453298.1|483792_485469_+	2-polyprenylphenol 6-hydroxylase	NA	A0A0R6PKQ6	Moraxella_phage	30.2	8.4e-42
WP_006453297.1|485578_486220_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	1.8e-13
WP_095574653.1|486392_487427_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	8.6e-114
WP_074057645.1|487710_488199_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_006453294.1|488299_490948_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	40.1	6.3e-84
WP_003481884.1|491087_491300_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_074058838.1|491720_493694_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.1	3.3e-13
>prophage 3
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	926998	941745	5175249	coat	Xanthomonas_phage(93.33%)	24	NA	NA
WP_157732745.1|926998_927367_-	hypothetical protein	NA	B1NI83	Stenotrophomonas_phage	66.9	5.0e-40
WP_095574702.1|927525_927711_+	hypothetical protein	NA	A0A1D6ZIV1	Xanthomonas_phage	80.3	6.4e-20
WP_095574703.1|927707_927929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157732746.1|927921_928128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387218.1|928219_929161_+	replication initiation protein	NA	A0A077JDC0	Xanthomonas_phage	95.5	4.7e-175
WP_095574705.1|929157_929454_+	DNA-binding protein	NA	O80282	Xanthomonas_phage	87.6	3.0e-43
WP_095574706.1|929457_929679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574707.1|929692_929932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157732747.1|930256_931552_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	45.0	1.2e-43
WP_157732748.1|931559_931874_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_095574710.1|931870_933055_+	zonular occludens toxin family protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	1.1e-56
WP_095574711.1|933051_933735_+	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	62.3	7.8e-71
WP_095575279.1|933797_934199_+	DUF4124 domain-containing protein	NA	A0A077JCA3	Xanthomonas_phage	59.5	9.6e-37
WP_095574712.1|935214_935406_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	77.0	5.6e-19
WP_157732749.1|935402_935645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387162.1|935810_935951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574714.1|936114_936660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574715.1|936988_937285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574716.1|937288_937492_+	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	97.0	3.7e-29
WP_095574717.1|937504_937735_+|coat	phage coat protein	coat	A0A1W6DXZ2	Xanthomonas_phage	89.5	8.8e-27
WP_095575280.1|938053_939511_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	62.9	9.9e-124
WP_095574718.1|939510_939840_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	95.4	3.5e-53
WP_095574719.1|939839_941075_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	86.4	2.2e-201
WP_095574720.1|941076_941745_+	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	71.7	1.3e-83
>prophage 4
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	1028964	1087601	5175249	integrase,transposase	Ralstonia_phage(28.57%)	50	1020407:1020423	1089247:1089263
1020407:1020423	attL	GCCGAGCAGGTCAAGCG	NA	NA	NA	NA
WP_029996207.1|1028964_1029927_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_157732751.1|1030299_1030449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157732752.1|1030485_1031010_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_074056260.1|1031059_1032040_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
WP_095574754.1|1032167_1032824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574755.1|1032817_1033102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056260.1|1033206_1034187_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
WP_089111531.1|1034308_1035452_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	4.8e-89
WP_167387174.1|1035493_1035877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078565720.1|1035879_1036296_+	NUDIX domain-containing protein	NA	A0A1Q2U351	Vibrio_phage	52.7	1.2e-05
WP_095574758.1|1036292_1036898_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_095574759.1|1036917_1038264_+	MFS transporter	NA	NA	NA	NA	NA
WP_095574760.1|1038424_1038871_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_095574761.1|1038867_1039824_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_039445626.1|1039834_1041229_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_095574762.1|1041225_1041573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574763.1|1041588_1043106_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_157732754.1|1043372_1044266_-	EamA family transporter	NA	NA	NA	NA	NA
WP_157732755.1|1044270_1045119_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_039588099.1|1045237_1046053_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_024420815.1|1046088_1046841_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_095574766.1|1046837_1051106_-	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	22.7	1.5e-47
WP_039433051.1|1051334_1052081_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_057417709.1|1052038_1053037_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039433053.1|1053863_1054241_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_095574767.1|1054326_1054959_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_015471990.1|1054971_1055598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574768.1|1055913_1057842_+	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_095574769.1|1057862_1058393_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_167387175.1|1058975_1059635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574770.1|1059631_1060165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089111531.1|1060133_1061278_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	4.8e-89
WP_095574771.1|1061762_1062284_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_095574772.1|1063007_1064390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574773.1|1064386_1065046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574774.1|1065042_1065573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574775.1|1065904_1066423_-	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
WP_095574776.1|1066462_1067602_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_042774121.1|1067633_1068281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574777.1|1069309_1070857_-	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_095574778.1|1072047_1075317_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095574779.1|1075584_1079619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042826170.1|1079633_1080041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046735330.1|1080037_1080955_-	radical SAM protein	NA	NA	NA	NA	NA
WP_095574780.1|1081313_1082210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042825850.1|1082468_1083182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046735332.1|1083640_1084525_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042826515.1|1084552_1084846_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095574781.1|1084948_1085599_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_095574782.1|1085669_1087601_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0U1UNT3	Pseudomonas_phage	47.8	1.7e-99
1089247:1089263	attR	CGCTTGACCTGCTCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	2173052	2201974	5175249	transposase	Ralstonia_phage(20.0%)	26	NA	NA
WP_095574585.1|2173052_2173815_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095574887.1|2173950_2175270_-	glycoside hydrolase family 30 protein	NA	NA	NA	NA	NA
WP_074056894.1|2175912_2176788_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_074056893.1|2176787_2177567_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_074056892.1|2177738_2178368_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074056891.1|2178432_2179182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056890.1|2179620_2181000_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_074056888.1|2181698_2182514_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_074056260.1|2182915_2183896_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
WP_074056887.1|2184002_2184809_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074056885.1|2185197_2186004_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095574601.1|2187114_2188216_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	1.5e-44
WP_074056884.1|2188311_2188581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575325.1|2188577_2188874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574890.1|2189174_2192258_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_074056881.1|2192265_2192853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155767611.1|2192849_2193521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056880.1|2193517_2194597_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	38.9	7.3e-55
WP_074056879.1|2194593_2196780_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	25.5	1.5e-35
WP_074056878.1|2196852_2197743_-	Mrr restriction system protein	NA	NA	NA	NA	NA
WP_074056877.1|2197783_2198092_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_074056876.1|2198098_2198362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056875.1|2198742_2199273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056874.1|2199474_2200767_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	37.6	8.4e-74
WP_074058750.1|2201194_2201380_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_074056873.1|2201509_2201974_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	2269516	2341221	5175249	head,transposase,integrase,holin,tail,portal,terminase,protease,capsid,plate	Stenotrophomonas_phage(52.5%)	79	2301818:2301870	2342811:2342863
WP_095574903.1|2269516_2270917_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_095575326.1|2271484_2272219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574904.1|2272211_2273621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157732762.1|2273790_2274579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065047574.1|2274775_2275555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065047572.1|2275607_2276561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574907.1|2276737_2278456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089111531.1|2278593_2279737_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	58.8	4.8e-89
WP_095574908.1|2279963_2281559_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_095574909.1|2281611_2281953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574910.1|2282467_2283208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095574911.1|2283382_2284891_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_006450178.1|2285264_2285969_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_074056840.1|2285965_2286700_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.9	6.7e-36
WP_023902882.1|2286712_2287165_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	56.1	4.2e-41
WP_006450175.1|2287196_2287853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056839.1|2287865_2288633_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_074056838.1|2288629_2289808_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_074058747.1|2290255_2292226_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_006451749.1|2292753_2293026_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	3.8e-21
WP_006451748.1|2293240_2295712_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.8	5.4e-223
WP_006451747.1|2295856_2297143_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.6	1.5e-136
WP_023902875.1|2297267_2297894_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.7e-56
WP_006451745.1|2297967_2299263_-	trigger factor	NA	NA	NA	NA	NA
WP_074056837.1|2299838_2301134_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_074056836.1|2301138_2301597_-	hypothetical protein	NA	NA	NA	NA	NA
2301818:2301870	attL	TTTTATTTGGTGGGCCGTCAAGGATTCGAACCTTGGACCTATTGATTAAGAGT	NA	NA	NA	NA
WP_095574912.1|2303315_2303972_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
WP_095574913.1|2304291_2308035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081376437.1|2307973_2308711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095574914.1|2308746_2309457_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.6	4.5e-106
WP_010364016.1|2309374_2309620_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	52.5	1.8e-14
WP_074056833.1|2309645_2310668_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.8	3.1e-140
WP_095574915.1|2310667_2312452_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	76.3	9.5e-270
WP_095574916.1|2312573_2313416_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	53.6	9.9e-68
WP_023904832.1|2313468_2314485_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.1	1.1e-137
WP_095574917.1|2314488_2315208_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	62.8	5.0e-68
WP_023904834.1|2315306_2315774_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	51.0	1.3e-32
WP_005917735.1|2315773_2315983_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	59.4	7.0e-15
WP_005929454.1|2315987_2316344_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_074056827.1|2316336_2316612_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	58.6	1.5e-20
WP_167387192.1|2316611_2317250_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	61.5	1.3e-48
WP_074056825.1|2317249_2317738_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	53.1	5.8e-28
WP_074056824.1|2317734_2318154_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.4	2.0e-40
WP_095574919.1|2318141_2318588_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	55.4	4.1e-36
WP_074056822.1|2318796_2319222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074056821.1|2319602_2320040_+	phosphotransferase	NA	NA	NA	NA	NA
WP_095574920.1|2320199_2321090_+|plate	baseplate J/gp47 family protein	plate	V9IQV9	Stenotrophomonas_phage	52.4	1.7e-81
WP_074056819.1|2321082_2321631_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	53.1	6.1e-50
WP_095574921.1|2321634_2322840_+|tail	phage tail protein	tail	E5FFH1	Burkholderia_phage	41.5	2.8e-31
WP_074056817.1|2322841_2323069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056816.1|2323147_2323711_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	48.1	9.7e-27
WP_074056815.1|2323707_2324067_+	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	64.4	4.3e-36
WP_074056814.1|2324078_2325245_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.9	4.5e-135
WP_006450505.1|2325275_2325785_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	77.5	2.2e-70
WP_057672078.1|2325830_2326133_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	68.6	6.3e-25
WP_005922203.1|2326141_2326255_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_095574922.1|2326284_2329155_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	50.3	8.0e-210
WP_074056812.1|2329167_2329569_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	59.1	7.4e-37
WP_095574923.1|2329565_2330555_+	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	53.9	1.7e-90
WP_074056811.1|2330676_2331048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154844845.1|2331139_2331730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056810.1|2331953_2332382_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	37.0	1.6e-13
WP_074056809.1|2332448_2332703_+	DNA-binding protein	NA	A0A1B0VRL1	Pseudomonas_phage	46.7	2.2e-07
WP_074056808.1|2332709_2333021_+	ogr/Delta-like zinc finger family protein	NA	V9IQW3	Stenotrophomonas_phage	56.0	8.5e-25
WP_074056807.1|2333042_2333324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011038118.1|2333320_2333560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056806.1|2333563_2336251_+	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_074056805.1|2336562_2336781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056804.1|2336777_2337056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016851182.1|2337052_2337316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056803.1|2337393_2337804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387193.1|2337796_2337973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167387220.1|2337995_2338241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056801.1|2338237_2338483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056800.1|2338479_2338752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056799.1|2338748_2338955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074056798.1|2338951_2339173_+	hypothetical protein	NA	V9IQX6	Stenotrophomonas_phage	56.9	4.2e-18
WP_074056797.1|2339172_2340354_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	55.8	3.1e-123
WP_095574585.1|2340457_2341221_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
2342811:2342863	attR	TTTTATTTGGTGGGCCGTCAAGGATTCGAACCTTGGACCTATTGATTAAGAGT	NA	NA	NA	NA
>prophage 8
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	2730150	2736523	5175249		Escherichia_phage(33.33%)	6	NA	NA
WP_074056634.1|2730150_2731497_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.5	6.3e-32
WP_074056633.1|2731542_2732946_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	7.2e-47
WP_074056632.1|2733067_2733976_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.9	3.4e-29
WP_006449668.1|2733972_2734530_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.6	4.1e-46
WP_074056631.1|2734526_2735414_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.8	1.7e-94
WP_074056630.1|2735467_2736523_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	47.7	1.8e-82
>prophage 9
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	3508966	3518144	5175249		Escherichia_phage(33.33%)	6	NA	NA
WP_074058683.1|3508966_3509710_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.4	1.5e-06
WP_055829449.1|3509832_3510123_-	HigA family addiction module antidote protein	NA	A0A076G6J7	Escherichia_phage	34.3	2.8e-06
WP_074058684.1|3510140_3510422_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	42.6	1.2e-09
WP_074058685.1|3510636_3511692_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	50.6	6.4e-88
WP_095575051.1|3511830_3514074_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.4	1.3e-08
WP_095575052.1|3514070_3518144_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	20.9	7.8e-09
>prophage 10
NZ_CP016878	Xanthomonas hortorum strain B07-007 chromosome, complete genome	5175249	4255546	4303633	5175249	transposase	Ralstonia_phage(33.33%)	35	NA	NA
WP_006449292.1|4255546_4256353_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074056260.1|4257096_4258077_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
WP_006448937.1|4259179_4260142_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_095575129.1|4260267_4264425_+	Ice nucleation protein	NA	NA	NA	NA	NA
WP_043908547.1|4264762_4265035_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_074058388.1|4265152_4266322_-	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_006451532.1|4266715_4267093_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074058386.1|4267236_4267749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074058385.1|4267761_4268682_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_043909620.1|4269112_4270039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006451536.1|4270035_4270404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575130.1|4270533_4271052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095575131.1|4271075_4272203_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_095575132.1|4272431_4272722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157732771.1|4273733_4273913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095575134.1|4274123_4274417_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_095575135.1|4274427_4275174_+	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	43.7	2.7e-61
WP_095575136.1|4275137_4276493_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_095575137.1|4276941_4278846_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	20.6	4.0e-08
WP_095575138.1|4278847_4280833_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_006451537.1|4281243_4282611_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_043909622.1|4282653_4283043_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_006451539.1|4283059_4283545_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_074058384.1|4283648_4284095_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_095575139.1|4284948_4287291_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_074058925.1|4287296_4287629_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_074058382.1|4287976_4289770_-	endonuclease	NA	NA	NA	NA	NA
WP_006451546.1|4290042_4290330_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	41.1	3.0e-16
WP_023902681.1|4290477_4292121_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.7	1.5e-176
WP_006451548.1|4292465_4293353_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_074058381.1|4293592_4295707_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_074058380.1|4296081_4298055_-	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_095575402.1|4301162_4301925_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074058379.1|4301953_4302193_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_074056260.1|4302652_4303633_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	5.7e-99
