The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	1220868	1230473	4792385	integrase	Enterobacteria_phage(83.33%)	9	1206348:1206363	1245104:1245119
1206348:1206363	attL	TCCGGTGCCGCAGGCG	NA	NA	NA	NA
WP_023181090.1|1220868_1223202_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
WP_023181089.1|1223216_1223537_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023181088.1|1223533_1223761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181087.1|1223757_1224309_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	7.2e-35
WP_023181086.1|1225112_1225850_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	1.2e-80
WP_000984211.1|1225846_1226092_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_023181085.1|1226108_1226675_+	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.2	4.5e-56
WP_130525681.1|1227010_1229254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023180952.1|1229267_1230473_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	4.5e-106
1245104:1245119	attR	TCCGGTGCCGCAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	1664731	1694325	4792385	holin,protease,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_021000536.1|1664731_1665226_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1665639_1666131_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1666120_1666384_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1666380_1668867_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1668873_1669569_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1669555_1670425_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1670540_1670990_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1670999_1671602_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1671622_1672240_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1672236_1672896_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_023181007.1|1672947_1673685_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1673681_1673894_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053600.1|1673890_1674370_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982529.1|1674366_1676298_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1676294_1676852_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238332.1|1676848_1677892_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1677935_1678583_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1679312_1679876_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1680067_1680271_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1680573_1681365_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1681661_1681865_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1682033_1684400_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1684728_1685718_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1685732_1686101_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1686129_1687461_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1687757_1688087_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1688679_1689921_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1689923_1690451_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1690828_1691272_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1691326_1693156_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1693503_1693794_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1693821_1694325_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	1766377	1775548	4792385	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000569166.1|1766377_1767325_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1767308_1768040_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1768020_1768128_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1768187_1768919_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1769141_1770827_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1770823_1771543_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1771589_1772057_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023180840.1|1772113_1772644_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.1e-15
WP_023180841.1|1772815_1773274_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	3.8e-53
WP_000195343.1|1773514_1775548_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	1843857	1854363	4792385		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023180817.1|1843857_1845261_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	2.3e-21
WP_000981471.1|1845438_1846332_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697838.1|1846708_1847794_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023662.1|1847793_1848693_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1848740_1849619_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1849619_1850171_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1850176_1851169_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1851165_1851939_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1851943_1853023_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_095823056.1|1853049_1854363_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 5
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	1940354	1950926	4792385		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1940354_1940828_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|1941475_1941766_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1942137_1942935_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001521460.1|1943402_1943564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1943690_1944110_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1944112_1945381_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1945835_1946048_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1946058_1946247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|1946507_1947686_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107430.1|1948335_1948635_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1948726_1949422_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157301.1|1949495_1950926_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	2054161	2060970	4792385	tail,integrase	Salmonella_phage(33.33%)	11	2056371:2056393	2066086:2066108
WP_000856224.1|2054161_2054392_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2054529_2054904_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2054904_2055780_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2055796_2056150_+	YebY family protein	NA	NA	NA	NA	NA
2056371:2056393	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2056523_2057378_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2057437_2057932_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2058121_2058352_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2058405_2058939_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2059195_2059363_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2059427_2059616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2060088_2060970_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2066086:2066108	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	2847570	2931057	4792385	lysis,integrase,tRNA,portal,holin,terminase,protease,tail	Salmonella_phage(46.15%)	90	2871664:2871683	2942206:2942225
WP_000938191.1|2847570_2848251_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2848871_2849531_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2849617_2849947_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2849943_2850225_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2850273_2851053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2851078_2851627_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2851841_2853053_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2853110_2853428_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2853472_2853889_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2854059_2854722_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2854816_2855275_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420517.1|2855310_2857365_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2857488_2857935_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950875.1|2857953_2860107_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2860093_2860699_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2860915_2861425_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2861781_2862834_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2862905_2863358_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2863543_2865304_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2865372_2865891_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2865990_2866158_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2866413_2866977_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2866973_2868614_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2868618_2869872_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2869886_2871794_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2871664:2871683	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2871806_2873915_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2874013_2875123_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2875119_2875662_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2875827_2876838_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2877045_2879658_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497442.1|2880084_2880291_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	98.5	4.5e-30
WP_001536069.1|2880766_2881567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2882046_2882769_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143175.1|2882964_2883540_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	3.4e-96
WP_023205986.1|2883539_2885981_-|tail	Gifsy-2 prophage tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	1.2e-86
WP_000178851.1|2886034_2886277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077911794.1|2886315_2887191_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_001576012.1|2889737_2890442_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_023205988.1|2890339_2891077_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.2e-114
WP_023205989.1|2891086_2891782_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.7e-89
WP_000877926.1|2891871_2892405_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2892521_2893019_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|2893117_2893450_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_077911799.1|2893446_2896434_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.8	1.5e-264
WP_010989009.1|2896513_2896843_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2896839_2897238_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_023205991.1|2897283_2898033_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.2	5.3e-89
WP_000196703.1|2898044_2898446_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453194.1|2898442_2899009_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2898989_2899289_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2899281_2899605_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2899695_2901777_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077911800.1|2901700_2903218_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.9	4.4e-175
WP_000196190.1|2903244_2903451_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2903447_2905586_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2905542_2906076_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2906283_2906763_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2906780_2907233_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2907216_2907546_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2907821_2908508_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798705.1|2908868_2909318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2909453_2909579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2909752_2910070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2910136_2910934_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2910923_2911070_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2911066_2911678_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_000929805.1|2911886_2912489_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2912571_2912793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2912904_2913138_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2913429_2913720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2913797_2914109_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2914105_2914453_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2914463_2915213_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2915215_2916199_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2916283_2916658_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2916623_2916863_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2916982_2917393_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077911795.1|2917442_2917703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917563.1|2917695_2917854_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_023205995.1|2917875_2918226_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_023205996.1|2918352_2921280_+	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	99.0	0.0e+00
WP_077911796.1|2921242_2922400_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	3.6e-217
WP_001237031.1|2922442_2922682_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2922722_2922971_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2923015_2924308_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2924502_2925705_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2925782_2927219_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2927463_2928678_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2928994_2929456_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2929656_2931057_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
2942206:2942225	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP023166	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 chromosome, complete genome	4792385	4378720	4425687	4792385	plate,tRNA,tail	Burkholderia_phage(40.91%)	49	NA	NA
WP_001182230.1|4378720_4379719_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4379806_4381117_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4381363_4381879_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4381977_4382187_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4382208_4382322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4382318_4383644_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4383822_4384431_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4384539_4384908_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4385078_4387499_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4387597_4388470_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4388483_4388981_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4389161_4390079_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4390242_4391601_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4391689_4392799_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4393160_4394351_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4394482_4396027_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4396041_4396932_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4397097_4397508_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4397650_4399747_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4399746_4400484_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4400480_4401149_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4401182_4401425_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4401868_4403518_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4403862_4405212_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4405344_4405692_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4406267_4406555_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4406557_4407163_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4407175_4407490_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4407649_4408105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4408101_4408299_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4408288_4409716_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_023137586.1|4409715_4410240_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_001003639.1|4410291_4410609_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4410568_4410697_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023137585.1|4410793_4413148_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.2	7.3e-68
WP_023137584.1|4413147_4414101_+	bacteriophage protein	NA	A4JWL1	Burkholderia_virus	51.5	1.0e-36
WP_001269716.1|4414100_4414310_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023137583.1|4414297_4415341_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679390.1|4415350_4416073_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4416396_4416759_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_023137582.1|4416755_4417685_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_023180994.1|4417684_4419232_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	4.2e-48
WP_001093501.1|4419395_4419755_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951737.1|4419745_4420861_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.0	2.0e-100
WP_000359509.1|4420853_4421486_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4421488_4423147_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_023180992.1|4423153_4423768_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023180991.1|4423764_4424220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587738.1|4424958_4425687_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP023167	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence	254041	22598	85338	254041	transposase,integrase,protease	uncultured_Caudovirales_phage(33.33%)	54	27312:27328	73037:73053
WP_038989254.1|22598_23033_+|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	39.2	6.8e-20
WP_000792088.1|23104_23977_-	lipoprotein	NA	NA	NA	NA	NA
WP_000517883.1|24158_25943_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	26.4	2.1e-19
WP_000045554.1|26340_27216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120823.1|27274_27652_+	hypothetical protein	NA	NA	NA	NA	NA
27312:27328	attL	CCGGGATAGTTATCAGT	NA	NA	NA	NA
WP_095823077.1|27712_28699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000180136.1|28758_29811_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_000129110.1|29849_30119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143798.1|30189_31317_+	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_038989257.1|31394_33407_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000192122.1|33478_33700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113001.1|33793_35047_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
WP_038989259.1|35321_35846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011071.1|35836_36802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691116.1|36872_37808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000644670.1|37885_38806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351466.1|38878_39814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185349.1|39990_40947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111914.1|41359_41629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988154.1|41683_42274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072212.1|42281_42539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836954.1|42612_43149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011072.1|43165_43621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135563.1|44201_45161_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001198597.1|45171_46080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418845.1|46015_46360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086279.1|46384_47566_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|47780_47993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|49578_50334_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|51818_52892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058656975.1|52969_53113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989500.1|53293_54121_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.6	3.4e-44
WP_038989501.1|54139_55618_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	4.7e-198
WP_000416123.1|56553_57030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|57441_57642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000341068.1|57708_58101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058656979.1|58437_58695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255860.1|58849_60055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038989394.1|60224_60734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|61401_62106_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_048659818.1|63063_65109_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_004011547.1|65170_67828_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_021546938.1|71471_73235_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
73037:73053	attR	ACTGATAACTATCCCGG	NA	NA	NA	NA
WP_000687847.1|73251_76929_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000645940.1|76947_77532_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001021938.1|77528_78128_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_021546939.1|78137_79025_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_032156934.1|79132_79450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012600012.1|79673_79853_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_001175593.1|80999_81323_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001089729.1|81428_82562_+	permease	NA	NA	NA	NA	NA
WP_094642239.1|82689_83019_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001067858.1|83054_83759_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001493761.1|83946_85338_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP023167	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence	254041	91137	147069	254041	transposase,integrase	Escherichia_phage(29.17%)	54	132011:132027	154736:154752
WP_001067855.1|91137_91842_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001447541.1|92265_93150_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|93366_94581_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|94608_94914_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|95025_96519_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_072042932.1|96549_96783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001456218.1|96983_97826_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_001206316.1|97914_98706_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|98875_99208_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|100387_101179_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|101647_101893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|101930_102794_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|102939_103179_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067855.1|103251_103956_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001355915.1|104236_104710_-	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
WP_000845048.1|104866_105880_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|106082_106433_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|106608_107169_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_015058874.1|107172_107769_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	85.1	4.7e-64
WP_015058875.1|107800_108478_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|108556_109756_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000027057.1|110739_111600_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_049821832.1|111782_112214_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	1.3e-63
WP_001067855.1|112238_112943_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|113064_113970_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|114411_115116_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|115269_115854_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|116770_117475_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105383.1|117741_119178_+	glutathione synthase	NA	NA	NA	NA	NA
WP_032193599.1|120289_120994_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|121023_121728_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|121841_122618_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|122846_123872_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001067858.1|125033_125738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_157739178.1|125749_125929_-	hypothetical protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	60.5	1.2e-07
WP_054113027.1|125915_126116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000509966.1|127023_127629_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001553819.1|127723_130621_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_061423829.1|130592_131930_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
132011:132027	attL	TTCAGGAAGTCAGGGCT	NA	NA	NA	NA
WP_000062400.1|132589_133045_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000272280.1|133213_133402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|133404_134625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323423.1|134679_134883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529857.1|134920_136216_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_011011077.1|136240_136411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038989455.1|136539_137967_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
WP_000173534.1|138190_138706_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_011011078.1|138702_139635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|139690_140470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|140817_141117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011079.1|141366_141975_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000125669.1|142464_143871_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_072157032.1|144176_145517_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001774874.1|145503_147069_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
154736:154752	attR	AGCCCTGACTTCCTGAA	NA	NA	NA	NA
>prophage 3
NZ_CP023167	Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence	254041	160059	166277	254041	transposase	Escherichia_phage(100.0%)	6	NA	NA
WP_061424402.1|160059_162495_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	100.0	0.0e+00
WP_000816147.1|162508_163135_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
WP_000544912.1|163127_163904_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
WP_001139856.1|163958_164555_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	100.0	1.7e-114
WP_001327048.1|164551_165082_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
WP_000019445.1|165296_166277_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
