The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	170098	306160	3466824	integrase,protease,coat,transposase,tRNA	Bacillus_phage(13.79%)	103	233450:233509	275073:275191
WP_095858728.1|170098_171232_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_095858729.1|171346_172231_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011229683.1|172615_173071_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_033007523.1|173483_174116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858731.1|174389_174947_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	60.8	1.3e-52
WP_095858732.1|175805_176558_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_095860167.1|176607_177981_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_095858733.1|178404_179652_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	1.9e-62
WP_095858734.1|179948_181496_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_095858735.1|181566_182775_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.5	1.1e-30
WP_033016526.1|182926_183535_+	DedA family protein	NA	NA	NA	NA	NA
WP_095858736.1|183597_184587_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_095858737.1|184583_185591_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_095858738.1|185658_186585_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015373767.1|186591_187383_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.3	3.2e-15
WP_095858739.1|189201_189906_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_081107437.1|189991_190480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094239465.1|191758_192397_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	34.5	7.9e-25
WP_095858740.1|192411_193965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858741.1|194383_196345_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	9.2e-141
WP_033010305.1|196804_198142_+	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_095858742.1|198526_200362_+	APC family permease	NA	NA	NA	NA	NA
WP_095858743.1|200467_201106_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_095858744.1|201169_202153_+	sporulation protein	NA	NA	NA	NA	NA
WP_095860168.1|202301_202808_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_033010289.1|203508_204330_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_033016518.1|204735_205809_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_095858745.1|206137_206866_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_095858746.1|206876_207488_+	DedA family protein	NA	NA	NA	NA	NA
WP_055359165.1|207484_208627_+	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_033016543.1|208787_209882_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_095858747.1|209897_211274_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_095858748.1|211346_212069_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_095858749.1|212130_213534_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.9	2.2e-67
WP_033010298.1|213545_214163_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_033010299.1|214281_214671_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_044743921.1|214750_215770_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_095860169.1|216012_217179_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	1.3e-30
WP_033010302.1|217293_217575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|217579_217930_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_095858750.1|218472_220635_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_095858751.1|220692_220806_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_047817690.1|220899_221418_+	SprT family protein	NA	U5J9G1	Bacillus_phage	25.6	5.6e-05
WP_095858752.1|223444_224389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858753.1|224352_225231_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095858754.1|225374_225689_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
233450:233509	attL	GCCTAGTGGTGATAGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGAAGTTAAGCC	NA	NA	NA	NA
WP_033010045.1|233793_234252_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_095858756.1|234248_234989_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_033010040.1|234948_235401_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_050368105.1|235397_236411_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	44.8	1.2e-70
WP_033016753.1|237161_239093_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	34.1	2.1e-60
WP_095860170.1|239188_239677_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_033010037.1|239692_240334_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_095858757.1|240351_240504_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_095860171.1|240524_241268_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_047818438.1|241531_243046_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	36.5	2.5e-77
WP_095858758.1|243218_243398_-	YdiK family protein	NA	NA	NA	NA	NA
WP_044742383.1|243394_244129_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_033010033.1|244489_244774_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	1.1e-18
WP_033010031.1|244892_246509_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	3.4e-165
WP_050497516.1|246587_246770_-|integrase	tyrosine-type recombinase/integrase	integrase	S6C485	Thermus_phage	100.0	1.0e-22
WP_011229657.1|248106_249765_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_095858759.1|249948_251109_+	hypothetical protein	NA	Q5YA51	Bacillus_phage	43.4	1.1e-08
WP_091704432.1|251123_251582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858760.1|252053_252572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858761.1|252586_253957_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_095858762.1|254091_255315_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_095858763.1|255443_256400_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_095858764.1|256405_257581_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_095858765.1|257577_259740_+	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_095860172.1|260347_261880_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.1	1.6e-18
WP_095858766.1|262160_263486_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	6.8e-55
WP_095860173.1|266233_266704_-	YjdJ family protein	NA	NA	NA	NA	NA
WP_095858767.1|267122_267683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858768.1|267703_268582_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095858720.1|271662_271890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858769.1|275430_275874_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
275073:275191	attR	GCCTAGTGGTGATAGCGGAGGGGAAACACCCGTTCCCATCCCGAACACGGAAGTTAAGCCCTCCAGCGCCGATGGTAGTTGGGGCCAGCGCCCCTGCAAGAGTAGGTCGCTGCTAGGCA	NA	NA	NA	NA
WP_033009939.1|276233_276722_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.0	1.3e-22
WP_095860174.1|276648_277863_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_095858770.1|277859_279155_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	34.3	2.2e-18
WP_033009943.1|279230_279959_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.9	9.6e-43
WP_049624734.1|279946_280201_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_033016682.1|280197_280884_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_050368120.1|280867_283096_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.8	1.3e-170
WP_033009946.1|283071_284484_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.1	9.2e-50
WP_095858771.1|284549_285590_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FC27	Synechococcus_phage	43.9	2.1e-67
WP_033009948.1|285586_286219_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.4	1.2e-25
WP_044744031.1|286181_287720_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	6.0e-79
WP_033009953.1|289390_289636_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_095858772.1|289730_291476_+	adenine deaminase	NA	NA	NA	NA	NA
WP_095858773.1|291494_292520_+	DUF3048 domain-containing protein	NA	NA	NA	NA	NA
WP_033009956.1|292622_292949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033009957.1|293048_293750_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_033016687.1|293778_295953_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.7	1.5e-128
WP_033016671.1|295974_297987_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	40.0	2.1e-108
WP_095858774.1|297983_299207_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_095858775.1|299447_300002_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_050368127.1|300490_301267_-	VOC family protein	NA	NA	NA	NA	NA
WP_033016666.1|301296_301845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858776.1|302014_302590_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_014194780.1|302955_303246_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_050368129.1|303258_304716_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_095858777.1|304729_306160_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	318463	374806	3466824	transposase	Rhodobacter_phage(12.5%)	42	NA	NA
WP_015864903.1|318463_319717_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_095858787.1|319869_320415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_050483815.1|320812_321676_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_013144165.1|321695_321851_+	competence pheromone ComX	NA	NA	NA	NA	NA
WP_095858789.1|321857_324122_+	histidine kinase	NA	NA	NA	NA	NA
WP_095858790.1|324147_324819_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_020756630.1|324967_325450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101878866.1|325465_326368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095860175.1|326604_327087_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	1.0e-16
WP_095858791.1|328138_329626_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_095858792.1|329644_330145_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_095858793.1|334005_335496_+	TIGR02677 family protein	NA	NA	NA	NA	NA
WP_095858794.1|335498_336695_+	TIGR02678 family protein	NA	NA	NA	NA	NA
WP_095858795.1|336654_340776_+	TIGR02680 family protein	NA	NA	NA	NA	NA
WP_095858796.1|340772_341993_+	TIGR02679 family protein	NA	NA	NA	NA	NA
WP_095858797.1|342060_342438_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015374552.1|342855_343901_-|transposase	IS630-like element ISBs2 family transposase	transposase	S5VXX4	Leptospira_phage	27.5	1.6e-27
WP_095858798.1|345023_345323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858799.1|345335_346619_-	peptidoglycan-binding protein	NA	A0A0A0YSS3	Erwinia_phage	59.5	7.4e-06
WP_033016933.1|349881_350190_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_050368140.1|350194_351094_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_095858800.1|351023_354287_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_095860176.1|354681_355047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095858801.1|355451_355661_+	hypothetical protein	NA	A0A1U9WQQ3	Geobacillus_phage	87.0	3.0e-26
WP_095858802.1|355827_356712_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_042382835.1|357744_358491_+	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_011229827.1|358977_359202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858803.1|359338_360385_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_095858804.1|360445_361678_-	MFS transporter	NA	NA	NA	NA	NA
WP_095858805.1|361876_362530_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_095858806.1|362489_363014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033024617.1|363194_363542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858807.1|363739_366049_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_033011731.1|366124_366694_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095858808.1|366869_368243_-	GHKL domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.4	2.5e-12
WP_044743566.1|368232_368895_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	1.4e-32
WP_095858809.1|369068_370274_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	29.0	2.0e-13
WP_033010060.1|370998_371751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020958535.1|371781_372027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074043271.1|372070_373462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858810.1|373458_373827_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_095858811.1|373927_374806_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	386220	410085	3466824	transposase	Tupanvirus(20.0%)	18	NA	NA
WP_095858816.1|386220_386835_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_095858817.1|388646_389012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858818.1|389144_390278_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_095858819.1|391202_392021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858820.1|392115_392952_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_095858821.1|392955_393816_+	S8 family serine peptidase	NA	A0A2K9L1P3	Tupanvirus	31.3	2.2e-09
WP_095858822.1|393834_394359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858823.1|394908_396567_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_095858824.1|397485_397872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064213564.1|398468_399269_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095858825.1|399261_400515_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	2.8e-10
WP_033011705.1|400667_401213_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_095858826.1|403811_404174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158522901.1|404398_404674_-	hypothetical protein	NA	A0A1V0SCG6	Indivirus	36.2	8.7e-05
WP_095858828.1|404889_405456_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011229840.1|405762_406899_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	27.1	1.2e-31
WP_055358810.1|407339_407708_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	77.9	6.9e-50
WP_095858829.1|408636_410085_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	662341	734171	3466824	transposase,bacteriocin	Streptococcus_phage(18.18%)	58	NA	NA
WP_012749092.1|662341_663622_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_033005228.1|664018_664312_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_060787853.1|664336_664756_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_095858950.1|664921_668332_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	1.3e-09
WP_095858951.1|668324_670172_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_095858952.1|670476_670860_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011230222.1|671391_671622_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_095858953.1|671689_673309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230224.1|673322_673832_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_011230225.1|674021_674672_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	4.6e-12
WP_095858954.1|674794_675856_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.4	2.9e-40
WP_033010565.1|675852_676662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095858955.1|676658_677462_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095858956.1|677462_678536_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095858957.1|678961_679279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858958.1|679622_680453_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095858959.1|680406_681132_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	4.2e-22
WP_095858960.1|683317_683926_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_044743365.1|684549_685041_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_008879040.1|685241_685373_-	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_095858961.1|685607_686702_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	35.6	3.0e-48
WP_095858962.1|686758_687622_-	DegV family protein	NA	NA	NA	NA	NA
WP_015374102.1|687798_687999_-	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_095858963.1|688369_689176_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_050368327.1|689291_690059_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_015374106.1|690259_690631_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	61.5	8.6e-40
WP_095860189.1|690620_692747_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	63.4	9.7e-245
WP_095858964.1|692969_693197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033027956.1|693168_693492_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_095858965.1|693514_694765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013146125.1|694761_694971_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_095858966.1|694974_695208_-	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_095858967.1|695283_695976_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_095858968.1|699047_699755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013523134.1|700490_700724_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_095858969.1|700696_701407_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_095858970.1|701496_702099_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_095858971.1|703895_704774_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095858972.1|704794_705436_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	2.5e-31
WP_020279212.1|705451_706945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033012619.1|706937_707717_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095858971.1|707866_708745_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095858973.1|711404_712580_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_095858974.1|714006_714705_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_095858975.1|714922_715585_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_095858976.1|715639_716665_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_095858977.1|716752_717460_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_095858978.1|717746_718703_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	1.1e-11
WP_095858979.1|718753_720013_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_095858980.1|720009_720510_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_011230276.1|720506_720974_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011230277.1|720970_721201_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_033013772.1|721206_721935_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_033843279.1|729191_729425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020279908.1|729872_730673_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033011561.1|730665_731916_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	9.7e-11
WP_033011559.1|732057_732621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858981.1|732980_734171_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	25.4	1.2e-29
>prophage 5
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	741294	802383	3466824	coat,transposase,tRNA	Bacillus_phage(18.18%)	55	NA	NA
WP_095858984.1|741294_741840_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|741992_743246_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_095858985.1|743238_744039_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095858986.1|744349_744667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864904.1|745530_746718_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_032101163.1|746898_747429_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_095858988.1|748415_749294_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095858990.1|750921_751608_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_095858991.1|751931_752966_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_095858992.1|752983_754216_+	bifunctional ornithine acetyltransferase/N-acetylglutamate synthase	NA	NA	NA	NA	NA
WP_095858993.1|754228_755008_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_095858994.1|755011_756172_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.7	7.6e-34
WP_095858995.1|756260_757325_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.4	3.1e-58
WP_095858996.1|757317_760446_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011230297.1|760442_761381_+	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.6	3.5e-21
WP_011230299.1|761565_761745_+	YjzC family protein	NA	NA	NA	NA	NA
WP_095858997.1|761852_764441_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.4	1.1e-125
WP_033015617.1|764712_765285_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095858998.1|765375_767502_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_063210636.1|767558_767747_-	YjzD family protein	NA	NA	NA	NA	NA
WP_014195165.1|767880_768621_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014195166.1|768655_768907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858999.1|769165_770098_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_095859000.1|770138_771377_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011230307.1|771521_772325_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_011230308.1|772461_772668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011230309.1|772753_773494_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.0	9.4e-46
WP_095859001.1|773555_774542_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_094239707.1|774875_775250_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_095859002.1|775672_777325_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011230313.1|777448_778378_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011230314.1|778377_779397_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_081132975.1|779418_780480_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	6.5e-16
WP_011230317.1|781495_781678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033018851.1|781980_782379_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_095859003.1|782429_783089_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	38.9	1.7e-22
WP_033010433.1|783297_783978_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_095859004.1|784258_785767_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_033015650.1|785955_787284_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_095859005.1|787283_789107_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	28.4	1.3e-67
WP_011230324.1|789120_789318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050368369.1|789744_790638_-	DsbA family protein	NA	NA	NA	NA	NA
WP_011230326.1|790630_791044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859006.1|791146_791770_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	58.5	1.8e-34
WP_095859007.1|791766_792357_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_050368372.1|792492_792870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033010443.1|793014_793653_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_033015662.1|793649_794465_+	NAD kinase	NA	NA	NA	NA	NA
WP_033010446.1|794621_795536_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_095859008.1|795930_796668_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	V9QL63	Rhizobium_phage	25.4	2.2e-10
WP_095859009.1|796867_798043_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_095859010.1|798241_799018_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_050368376.1|799137_799548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859011.1|799672_801286_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_095859012.1|801282_802383_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	909082	916125	3466824	integrase,transposase	Streptococcus_virus(33.33%)	9	903304:903319	915601:915616
903304:903319	attL	GAAAACGGCGAAAAGC	NA	NA	NA	NA
WP_095859072.1|909082_910519_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1X9I6E7	Streptococcus_phage	25.6	9.8e-07
WP_095859073.1|910686_911799_+	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_095859074.1|911970_912642_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.2	7.2e-69
WP_095859075.1|912638_913076_+	6-carboxytetrahydropterin synthase QueD	NA	A0A1U9WRB3	Streptococcus_virus	33.0	9.6e-06
WP_095859076.1|913075_913810_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	45.4	9.9e-56
WP_025948364.1|913862_914360_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	67.9	1.0e-51
WP_095859077.1|914413_915097_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_033005507.1|915129_915309_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_063211005.1|915540_916125_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3JQ51	Bacillus_phage	49.0	3.8e-42
915601:915616	attR	GCTTTTCGCCGTTTTC	NA	NA	NA	NA
>prophage 7
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	1289508	1379456	3466824	integrase,transposase	Erysipelothrix_phage(27.27%)	61	1319584:1319601	1345811:1345828
WP_095859221.1|1289508_1290876_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_050368573.1|1291204_1292392_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_050368114.1|1292666_1293893_+	MFS transporter	NA	NA	NA	NA	NA
WP_095859224.1|1294173_1295364_-|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	24.9	6.2e-31
WP_095859225.1|1295461_1295650_+|transposase	transposase	transposase	G3MB42	Bacillus_virus	63.2	1.4e-06
WP_095859226.1|1295714_1296152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859227.1|1296977_1298138_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_095859228.1|1298106_1298643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095860208.1|1299508_1299940_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	59.5	1.9e-43
WP_095859229.1|1302428_1303157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014195544.1|1303473_1304640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859230.1|1304702_1305470_-	dioxygenase	NA	NA	NA	NA	NA
WP_014195546.1|1306794_1306977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075261456.1|1306976_1307225_+	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	63.4	5.4e-22
WP_014195549.1|1308667_1308862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014195550.1|1308867_1309098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859231.1|1309619_1310987_+|transposase	ISLre2-like element ISGsp3 family transposase	transposase	NA	NA	NA	NA
WP_015374508.1|1311199_1311535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859232.1|1314482_1315253_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_095859233.1|1315257_1317159_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	42.6	1.0e-120
WP_095859234.1|1317162_1320117_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	44.3	1.8e-217
1319584:1319601	attL	AACAATCCGCAAAAATTT	NA	NA	NA	NA
WP_095859235.1|1320255_1321419_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_095859236.1|1321872_1323321_+|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_095859238.1|1324961_1326020_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	26.5	1.3e-11
WP_095859240.1|1326619_1327138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859241.1|1327174_1327963_+	NERD nuclease	NA	A0A2R2ZH57	Clostridioides_phage	31.3	7.5e-25
WP_094238548.1|1328016_1328634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094239938.1|1329318_1329585_+	DUF3986 family protein	NA	NA	NA	NA	NA
WP_095859242.1|1330186_1331809_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_094238551.1|1331940_1332213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094238552.1|1332271_1333006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094238553.1|1333345_1334209_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	32.3	3.8e-22
WP_095859243.1|1334220_1335201_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_095859244.1|1335706_1335931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859245.1|1338216_1338396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859246.1|1338566_1339085_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_064213564.1|1345948_1346749_-	AAA family ATPase	NA	NA	NA	NA	NA
1345811:1345828	attR	AAATTTTTGCGGATTGTT	NA	NA	NA	NA
WP_095859148.1|1346741_1347992_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	9.7e-11
WP_162494983.1|1351122_1351446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158522907.1|1351453_1351738_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095859248.1|1351954_1353460_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_095859249.1|1353738_1354293_+	YpiB family protein	NA	NA	NA	NA	NA
WP_095859250.1|1354397_1355519_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_095859251.1|1355625_1356420_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_095859252.1|1356556_1357396_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_095859253.1|1357956_1358607_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_011230900.1|1359050_1359521_+	DUF2935 domain-containing protein	NA	NA	NA	NA	NA
WP_025951297.1|1359588_1359906_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_025951296.1|1360096_1360405_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095859254.1|1360421_1361351_+	cation transporter	NA	NA	NA	NA	NA
WP_095859255.1|1361381_1362278_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095859256.1|1362520_1364344_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_095859257.1|1364370_1366092_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_095859258.1|1366498_1367632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_095860209.1|1368439_1369168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859259.1|1369339_1373101_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859260.1|1373454_1374888_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	44.2	1.9e-106
WP_047818219.1|1374990_1375302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015374612.1|1375501_1375930_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_158522908.1|1377096_1378353_+	MFS transporter	NA	NA	NA	NA	NA
WP_064213576.1|1378322_1379456_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	1693852	1740472	3466824	protease,transposase,bacteriocin	Escherichia_phage(25.0%)	25	NA	NA
WP_095859402.1|1693852_1698013_-|bacteriocin	bacteriocin-processing peptidase family protein	bacteriocin	NA	NA	NA	NA
WP_014195917.1|1698158_1698911_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011231316.1|1699236_1699740_-	membrane protein	NA	NA	NA	NA	NA
WP_095859404.1|1703587_1705057_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.6e-20
WP_095859405.1|1705111_1705687_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_095859406.1|1705662_1706367_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_068896110.1|1706557_1707352_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_095859407.1|1707561_1707807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860218.1|1707969_1710336_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_095859408.1|1710602_1711901_+	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.9	1.4e-15
WP_033017013.1|1712063_1712813_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_049626256.1|1712987_1713389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859409.1|1714561_1716430_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_095859410.1|1716456_1717368_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_095859411.1|1717364_1718117_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_095859412.1|1718295_1720128_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_095859413.1|1720327_1720924_-	DUF5317 domain-containing protein	NA	NA	NA	NA	NA
WP_095859415.1|1723320_1723659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859416.1|1723678_1727281_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_094238572.1|1727475_1728276_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012820636.1|1728268_1729519_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	3.3e-11
WP_095859417.1|1729661_1730225_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095859418.1|1736488_1737034_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095859419.1|1737992_1738721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858915.1|1739335_1740472_+|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
>prophage 9
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	1893884	1997768	3466824	protease,transposase	Wolbachia_phage(18.75%)	94	NA	NA
WP_145956580.1|1893884_1894451_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.3	1.7e-34
WP_095859499.1|1894754_1894997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859500.1|1895229_1895859_-	VanZ family protein	NA	NA	NA	NA	NA
WP_095859501.1|1895929_1896313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033845283.1|1897413_1898862_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_095860227.1|1899040_1899643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095860228.1|1899834_1900668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031406929.1|1902247_1903483_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	63.0	6.9e-142
WP_095859502.1|1905064_1905334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095860229.1|1905546_1905711_-	general secretion pathway domain protein	NA	NA	NA	NA	NA
WP_095859503.1|1907277_1908129_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_095860230.1|1908499_1908913_+	EamA family transporter	NA	NA	NA	NA	NA
WP_095859505.1|1909193_1910312_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_095859506.1|1910998_1911781_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_095859507.1|1911853_1912990_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_095859508.1|1913038_1913608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859509.1|1913644_1913941_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_063329984.1|1913953_1914319_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015375138.1|1914336_1914819_-	YrkE-like protein	NA	NA	NA	NA	NA
WP_047818515.1|1914870_1915098_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_013145015.1|1915199_1915460_-	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_095859510.1|1915426_1915819_-	rhodanese	NA	NA	NA	NA	NA
WP_015375142.1|1915908_1916478_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_095859511.1|1916563_1916782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011231562.1|1916807_1917197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859512.1|1918876_1920133_-	MFS transporter	NA	NA	NA	NA	NA
WP_095859513.1|1920119_1920665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859514.1|1920661_1921288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956581.1|1921300_1922476_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_095859238.1|1922610_1923669_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	26.5	1.3e-11
WP_095859516.1|1923696_1924476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033845283.1|1926846_1928295_-|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_095859517.1|1928363_1929542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033027772.1|1929855_1931043_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_095858915.1|1931445_1932582_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
WP_095858915.1|1933000_1934137_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
WP_095859518.1|1934554_1935691_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.1	1.2e-36
WP_095858787.1|1936092_1936638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|1936790_1938044_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|1938036_1938837_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_047818520.1|1940973_1941876_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.9	2.1e-55
WP_095859519.1|1941983_1943441_-	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	34.6	4.5e-76
WP_003252445.1|1943977_1944343_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047818522.1|1944862_1945537_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033015477.1|1945552_1946224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081106643.1|1946327_1946663_+	bis-aminopropyl spermidine synthase family protein	NA	NA	NA	NA	NA
WP_095860231.1|1947066_1947624_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_015375155.1|1947627_1948263_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_094238572.1|1948803_1949604_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095858787.1|1950020_1950566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|1950718_1951972_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|1951964_1952765_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859417.1|1954098_1954662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158522912.1|1955124_1955379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013144995.1|1957205_1957469_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_044746556.1|1957472_1958456_-	type I-B CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_013144993.1|1958455_1958953_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_095859520.1|1958967_1961145_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_061580951.1|1961168_1961870_-	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_095859521.1|1961872_1962760_-	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_095859522.1|1962756_1964553_-	type I-B CRISPR-associated protein Cas8b1/Cst1	NA	NA	NA	NA	NA
WP_095859523.1|1964549_1965275_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_095859524.1|1965591_1968048_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	25.0	1.4e-32
WP_033015496.1|1968040_1968367_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_095859525.1|1968567_1968795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859526.1|1968871_1970203_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_095859527.1|1971447_1971729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858787.1|1971802_1972348_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|1972500_1973754_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|1973746_1974547_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859528.1|1974801_1975068_-	protein rep	NA	A0A286QS97	Streptococcus_phage	46.0	4.9e-05
WP_015864904.1|1975338_1976526_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_101878873.1|1976621_1977317_-	protein rep	NA	NA	NA	NA	NA
WP_069304107.1|1978531_1979284_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	41.4	1.2e-37
WP_033017219.1|1979656_1979989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859529.1|1980085_1981057_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_095859530.1|1981160_1982315_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_095859531.1|1982311_1983061_-	trehalose utilization protein ThuA	NA	NA	NA	NA	NA
WP_095859532.1|1983555_1984635_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_095859533.1|1984776_1985781_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.6	8.6e-34
WP_095859534.1|1986038_1986935_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_095859535.1|1986965_1987340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859536.1|1987664_1988960_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_095859537.1|1989094_1989550_-	dehydratase	NA	NA	NA	NA	NA
WP_015375219.1|1990190_1990595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859538.1|1990608_1991535_-	glutaminase A	NA	NA	NA	NA	NA
WP_015864904.1|1991821_1993009_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_095859539.1|1993075_1993651_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_061580688.1|1993786_1994248_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_095859540.1|1994781_1995954_-	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	28.3	3.0e-38
WP_044743730.1|1996160_1996343_+	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_095859541.1|1996339_1996528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069304366.1|1996620_1996989_-	glyoxalase	NA	NA	NA	NA	NA
WP_095859542.1|1996985_1997768_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2064777	2075715	3466824		Pandoravirus(25.0%)	13	NA	NA
WP_063330384.1|2064777_2065797_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	43.7	1.6e-67
WP_095859570.1|2065790_2067317_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	40.4	3.7e-36
WP_095859571.1|2067542_2067929_-	chorismate mutase	NA	NA	NA	NA	NA
WP_033014002.1|2067925_2069026_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	32.5	8.3e-22
WP_033014001.1|2069028_2070195_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.5	1.2e-42
WP_049624819.1|2070294_2071065_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_033013999.1|2071137_2071587_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	5.4e-28
WP_033009740.1|2071685_2072648_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	23.1	7.2e-06
WP_033009739.1|2072663_2073368_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_095859572.1|2073372_2074203_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_033013997.1|2074505_2074730_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_033013996.1|2074743_2075310_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.6	1.5e-48
WP_008879623.1|2075442_2075715_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	78.9	3.5e-30
>prophage 11
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2130101	2140284	3466824		Staphylococcus_phage(50.0%)	11	NA	NA
WP_095859592.1|2130101_2131247_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.9	1.6e-23
WP_095859593.1|2131806_2133063_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	44.1	7.7e-40
WP_095859595.1|2133419_2133821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033008290.1|2133867_2134482_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	34.7	3.5e-14
WP_033008270.1|2134808_2135570_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.9	9.4e-09
WP_033008269.1|2135813_2136326_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_033008266.1|2136377_2136728_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033008265.1|2136839_2137304_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.1	5.2e-42
WP_050367490.1|2137323_2138517_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.3	7.4e-117
WP_033008263.1|2138539_2139184_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.6	5.7e-39
WP_095859596.1|2139186_2140284_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.9	7.9e-57
>prophage 12
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2421667	2482171	3466824	protease,coat,transposase,tRNA	Pacmanvirus(14.29%)	55	NA	NA
WP_095859721.1|2421667_2423326_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_049624749.1|2423484_2424588_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_055357870.1|2424603_2425434_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_095859722.1|2425462_2427013_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_047819372.1|2427117_2428263_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X6WFP1	Pacmanvirus	28.6	5.6e-29
WP_094239027.1|2428259_2428799_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_033010956.1|2428867_2429716_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_033010955.1|2429737_2430181_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_033014266.1|2430199_2431501_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_095859723.1|2431595_2432156_-	sporulation protein	NA	NA	NA	NA	NA
WP_008881065.1|2432334_2432625_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_033010951.1|2432640_2432973_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_033010949.1|2432974_2433283_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_095859724.1|2433523_2434384_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_095859725.1|2434376_2435144_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_095859726.1|2435397_2436201_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_033010588.1|2436203_2436896_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_049624755.1|2436936_2437455_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_033010591.1|2437451_2438318_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_033014277.1|2438338_2439361_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_055357875.1|2439521_2440202_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_095859727.1|2440341_2440929_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_095860243.1|2441039_2442155_-	stage II sporulation protein D	NA	NA	NA	NA	NA
WP_094239031.1|2442271_2442733_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_095859728.1|2442754_2443474_-	pilus assembly protein PilO	NA	NA	NA	NA	NA
WP_013144607.1|2443470_2444046_-	fimbrial protein	NA	NA	NA	NA	NA
WP_082825830.1|2444035_2444974_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_095859729.1|2445763_2446225_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_014195799.1|2446468_2447716_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWW3	Bacteriophage	36.9	4.9e-63
WP_095859730.1|2447780_2448992_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_095859731.1|2448978_2450034_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_015375512.1|2450046_2451711_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_095859732.1|2451707_2453078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053532384.1|2453094_2453874_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_095859733.1|2453863_2455480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859734.1|2455623_2456244_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_044744827.1|2456227_2456806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859735.1|2456849_2458556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859736.1|2458650_2461881_-	VWA domain-containing protein	NA	A0A140XG62	Salmonella_phage	29.0	3.9e-11
WP_095859737.1|2461949_2463245_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_095859738.1|2463462_2466105_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.5	2.5e-165
WP_011232115.1|2466581_2466770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859739.1|2466808_2467840_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_050367623.1|2467882_2468932_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_063211600.1|2469050_2470340_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_095859740.1|2470356_2471331_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_050367625.1|2471331_2472099_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_095859741.1|2472095_2473028_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_095859742.1|2473043_2473862_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_095859743.1|2473872_2475237_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_033014324.1|2475404_2475890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033014325.1|2475931_2476519_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_095859744.1|2476515_2478858_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	1.4e-175
WP_050367631.1|2479088_2480762_-|protease	ATP-dependent protease LonB	protease	A0A076FMQ5	Aureococcus_anophage	32.2	1.8e-12
WP_044744796.1|2480905_2482171_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	67.0	8.3e-151
>prophage 13
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2660541	2712859	3466824	holin,transposase,tRNA	Staphylococcus_phage(64.29%)	45	NA	NA
WP_033009793.1|2660541_2661189_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_050367707.1|2661328_2661598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033009796.1|2661649_2662435_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_063210942.1|2663035_2663971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049626118.1|2663975_2664554_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_049625020.1|2664550_2665735_-	MFS transporter	NA	NA	NA	NA	NA
WP_095859803.1|2665803_2667219_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_008880936.1|2667469_2667691_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033009804.1|2667786_2668533_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_033006856.1|2668637_2668850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859804.1|2669066_2670692_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_094239107.1|2670804_2672115_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	58.9	7.5e-30
WP_008880941.1|2672317_2672497_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_095859806.1|2672612_2674259_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_095859807.1|2674800_2676075_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050367712.1|2676349_2676664_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	47.9	3.3e-16
WP_095859808.1|2676903_2679321_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	74.5	0.0e+00
WP_095859809.1|2679681_2680881_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	46.7	8.0e-95
WP_033009817.1|2680996_2681161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033009819.1|2681293_2681557_-	YtzC family protein	NA	NA	NA	NA	NA
WP_063210932.1|2682013_2682601_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	47.3	7.7e-43
WP_050368712.1|2682658_2683741_-	tetraprenyl-beta-curcumene synthase family protein	NA	NA	NA	NA	NA
WP_095859811.1|2684106_2684655_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_095859812.1|2684677_2685889_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.4	1.3e-164
WP_095859813.1|2686601_2688188_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.8	6.9e-195
WP_033018136.1|2689422_2690670_+	MFS transporter	NA	NA	NA	NA	NA
WP_063210924.1|2690942_2691893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095859814.1|2692126_2692369_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_095859815.1|2692437_2693226_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	37.7	8.8e-34
WP_095859816.1|2693518_2694523_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_050367718.1|2694541_2695333_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.6e-35
WP_033014564.1|2695316_2696126_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047818907.1|2696241_2696709_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	39.0	2.7e-22
WP_094239126.1|2696767_2697100_-	hydrolase	NA	NA	NA	NA	NA
WP_095859817.1|2697158_2697554_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	46.6	6.0e-23
WP_095859818.1|2697707_2698148_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	67.1	6.2e-53
WP_095860248.1|2700611_2701205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859819.1|2701367_2703020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003253480.1|2704530_2705247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860249.1|2705926_2706856_+|transposase	ISL3 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	22.9	8.8e-17
WP_094238572.1|2707000_2707801_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095858787.1|2708217_2708763_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|2708915_2710169_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|2710161_2710962_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859417.1|2712295_2712859_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2744056	2774583	3466824	transposase,tail	Geobacillus_phage(57.14%)	30	NA	NA
WP_015864904.1|2744056_2745244_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_099233601.1|2746195_2746675_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095859832.1|2747105_2748473_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_095859833.1|2749173_2749458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095859834.1|2749423_2750101_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158522917.1|2750427_2751213_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_095859836.1|2751415_2752216_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033011707.1|2752208_2753462_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	1.2e-11
WP_095859837.1|2753614_2754160_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095859838.1|2754368_2755556_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_019417960.1|2756860_2757166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859839.1|2757171_2758452_-	peptidoglycan-binding protein	NA	A0A2P1JUA1	Erwinia_phage	37.6	2.5e-06
WP_095859840.1|2758578_2758827_-	DNA-binding protein	NA	A0A290FZJ4	Caldibacillus_phage	57.3	6.2e-18
WP_145956586.1|2758840_2759203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144115.1|2759341_2759902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144114.1|2759908_2760679_-	hypothetical protein	NA	W8ECW5	Geobacillus_phage	30.6	1.3e-05
WP_095859841.1|2760745_2761462_-	N-acetylmuramoyl-L-alanine amidase	NA	Q0H257	Geobacillus_phage	55.7	1.2e-58
WP_095859842.1|2761514_2762333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859843.1|2762593_2762953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859844.1|2762973_2763168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033020079.1|2763167_2763518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859845.1|2763532_2766424_-	glycoside hydrolase	NA	W8EK73	Geobacillus_phage	43.8	8.0e-234
WP_095859846.1|2766420_2767218_-	hypothetical protein	NA	W8EBC9	Geobacillus_phage	45.2	9.1e-55
WP_095859847.1|2767222_2767420_-	hypothetical protein	NA	W8ECV6	Geobacillus_phage	56.5	7.5e-11
WP_095859848.1|2767416_2768910_-	hypothetical protein	NA	W8EEW0	Geobacillus_phage	51.4	2.4e-141
WP_095859849.1|2768920_2769985_-	hypothetical protein	NA	W8EIX3	Geobacillus_phage	37.5	2.2e-48
WP_095859850.1|2770000_2770750_-|tail	phage tail protein	tail	W8EK66	Geobacillus_phage	40.4	2.1e-53
WP_095859851.1|2770746_2772309_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	46.3	3.8e-20
WP_080986158.1|2772556_2773339_-	endonuclease	NA	A0A1B1P765	Bacillus_phage	59.8	3.3e-89
WP_095859852.1|2773449_2774583_-	tape measure protein	NA	A6XMK6	Bacillus_virus	70.5	1.0e-99
>prophage 15
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2778127	2832814	3466824	integrase,portal,terminase,capsid,transposase,head	Bacillus_virus(19.23%)	50	2779202:2779217	2837690:2837705
WP_095859857.1|2778127_2779045_-|capsid	phage major capsid protein	capsid	V9QJI4	Rhizobium_phage	37.3	2.2e-36
2779202:2779217	attL	TGACGACTTGTTCGTA	NA	NA	NA	NA
WP_095859858.1|2780549_2781416_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_095859859.1|2781408_2782851_-|portal	phage portal protein	portal	A0A2L1IVM1	Streptomyces_phage	31.4	1.0e-48
WP_095859860.1|2782869_2784288_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	54.5	3.3e-140
WP_095859861.1|2784262_2784730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013144090.1|2785018_2785381_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	28.7	7.2e-07
WP_095859863.1|2786118_2786868_-	DUF4065 domain-containing protein	NA	Q0H268	Geobacillus_phage	98.8	7.8e-141
WP_015864904.1|2787438_2788626_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_095859864.1|2789338_2789524_-	hypothetical protein	NA	S6AVV9	Thermus_phage	51.7	1.6e-07
WP_095859865.1|2789520_2789937_-	transcriptional regulator	NA	E5DV97	Deep-sea_thermophilic_phage	57.9	4.8e-39
WP_095859866.1|2789933_2790437_-	hypothetical protein	NA	A0A0C5AJE6	Paenibacillus_phage	51.7	1.1e-32
WP_095859867.1|2790446_2790995_-	dUTPase	NA	S6AVW3	Thermus_phage	47.6	6.7e-33
WP_095859868.1|2791013_2791196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859869.1|2791659_2792157_-	single-stranded DNA-binding protein	NA	E5DV85	Deep-sea_thermophilic_phage	58.8	1.1e-45
WP_095859870.1|2792538_2792967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859871.1|2792971_2794222_-	DNA helicase	NA	A0A0U4B0A1	Bacillus_phage	38.1	8.3e-79
WP_095859872.1|2794218_2794482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859873.1|2795265_2795493_-	hypothetical protein	NA	E5DV81	Deep-sea_thermophilic_phage	56.7	3.4e-15
WP_095859874.1|2795664_2796366_-	single-stranded DNA-binding protein	NA	A0A1J0MFT8	Staphylococcus_phage	44.4	1.1e-38
WP_011888089.1|2796861_2797056_-	hypothetical protein	NA	A6M980	Geobacillus_virus	73.3	3.2e-22
WP_095859875.1|2797056_2797236_-	hypothetical protein	NA	Q0H238	Geobacillus_phage	89.7	1.0e-06
WP_095860254.1|2797207_2797456_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_095859876.1|2797493_2798066_-	phage antirepressor Ant	NA	A6XMM0	Bacillus_virus	98.9	5.3e-105
WP_095859877.1|2798037_2798229_-	hypothetical protein	NA	A6XMM0	Bacillus_virus	100.0	7.5e-24
WP_015985936.1|2798243_2798480_-	helix-turn-helix transcriptional regulator	NA	B3RH39	Bacillus_virus	100.0	7.4e-37
WP_095859878.1|2798623_2799094_+	helix-turn-helix transcriptional regulator	NA	A6XML9	Bacillus_virus	99.4	4.8e-80
WP_095859879.1|2799114_2799555_+	ImmA/IrrE family metallo-endopeptidase	NA	Q0H245	Geobacillus_phage	96.5	1.7e-74
WP_095859880.1|2799597_2800731_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.7	6.6e-99
WP_095859881.1|2808724_2809633_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033010733.1|2809694_2810372_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.5	1.0e-14
WP_095859882.1|2810322_2812095_-	recombinase family protein	NA	E5DV73	Deep-sea_thermophilic_phage	25.9	4.6e-30
WP_061567183.1|2812177_2812387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061567182.1|2812722_2813310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061567181.1|2813516_2814251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859883.1|2814368_2815055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061567322.1|2815437_2816064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858787.1|2817054_2817600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|2817752_2819006_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
WP_015864165.1|2818998_2819799_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_061567323.1|2820216_2820702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956588.1|2820713_2821043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033026122.1|2821336_2821942_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	33.0	1.0e-18
WP_061567325.1|2822255_2823095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859884.1|2823229_2824234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956589.1|2824485_2826708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033011705.1|2826860_2827406_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_095859886.1|2827558_2828812_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.0	1.3e-10
WP_064213564.1|2828804_2829605_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859887.1|2829802_2831149_-	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_033845283.1|2831365_2832814_+|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
2837690:2837705	attR	TACGAACAAGTCGTCA	NA	NA	NA	NA
>prophage 16
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	2839480	2894840	3466824	protease,transposase	Bacillus_phage(22.22%)	53	NA	NA
WP_061567192.1|2839480_2840362_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.8	3.7e-49
WP_061567191.1|2840370_2840667_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064213516.1|2840755_2841235_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	33.6	2.0e-09
WP_061567522.1|2841343_2842300_-	hypothetical protein	NA	A0A2K9V489	Faecalibacterium_phage	35.7	6.9e-41
WP_095859891.1|2842901_2843570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033026134.1|2843586_2844309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859892.1|2844308_2845070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033026138.1|2846254_2846524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859893.1|2846847_2847600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859894.1|2847629_2848289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042382392.1|2848308_2848839_-	recombinase family protein	NA	NA	NA	NA	NA
WP_095859895.1|2849620_2849902_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.1	8.0e-14
WP_095859896.1|2850422_2851358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859897.1|2851371_2852139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089113833.1|2853054_2853372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859898.1|2853601_2855674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013877640.1|2855663_2856722_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	26.5	1.3e-11
WP_145956590.1|2856795_2859984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145956591.1|2860180_2860717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020279908.1|2861133_2861934_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033011561.1|2861926_2863177_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	9.7e-11
WP_033011559.1|2863318_2863882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859901.1|2863853_2864777_-	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064213433.1|2865290_2865902_-	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_095859902.1|2866483_2867392_+	nuclease	NA	O64020	Bacillus_phage	44.3	1.2e-15
WP_033016279.1|2867515_2867767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033010730.1|2867823_2868324_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_145956592.1|2869032_2869446_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_095859903.1|2870199_2871858_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_095859904.1|2871889_2872831_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094240049.1|2873185_2873920_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011231214.1|2874124_2875003_+|transposase	IS982-like element ISGsp1 family transposase	transposase	NA	NA	NA	NA
WP_033016280.1|2875314_2875503_-	H-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_095859905.1|2875615_2876611_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	43.1	1.2e-06
WP_033010726.1|2876607_2877012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033016353.1|2877257_2878607_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_094239149.1|2879271_2880435_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_033010722.1|2880581_2880815_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_033010720.1|2880877_2881237_-	general stress protein 13	NA	NA	NA	NA	NA
WP_033010718.1|2881586_2882759_-	aminotransferase	NA	NA	NA	NA	NA
WP_033010737.1|2882755_2883256_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033010717.1|2883306_2883570_-	DUF1871 family protein	NA	NA	NA	NA	NA
WP_095859906.1|2883653_2884868_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_095859907.1|2885113_2885638_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_033010715.1|2885694_2885910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033016292.1|2885979_2886600_-	3'-5' exonuclease KapD	NA	NA	NA	NA	NA
WP_033016293.1|2886767_2887136_-	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_033010711.1|2887113_2887395_-	Na(+)/H(+) antiporter subunit F1	NA	NA	NA	NA	NA
WP_095859908.1|2887391_2887868_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_095859909.1|2887874_2889347_-	Na+/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_095859910.1|2889339_2889681_-	Na(+)/H(+) antiporter subunit C	NA	NA	NA	NA	NA
WP_095859911.1|2889681_2890098_-	Na(+)/H(+) antiporter subunit B	NA	NA	NA	NA	NA
WP_033017188.1|2893655_2894840_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.4	1.8e-75
>prophage 17
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	3010018	3081677	3466824	protease,holin,transposase	Pseudomonas_phage(13.33%)	58	NA	NA
WP_095859955.1|3010018_3010381_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011232554.1|3010483_3010810_-	DUF4870 domain-containing protein	NA	A0A2H4JDX0	uncultured_Caudovirales_phage	31.1	2.1e-05
WP_095860261.1|3010937_3013796_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.1	0.0e+00
WP_095859956.1|3013812_3015789_-	excinuclease ABC subunit UvrB	NA	B2CRJ8	Acidianus_filamentous_virus	36.6	6.1e-07
WP_033012047.1|3015964_3016186_-	CsbA family protein	NA	NA	NA	NA	NA
WP_050367797.1|3016200_3017373_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_033012045.1|3017593_3018136_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095859957.1|3018260_3019703_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	32.2	9.8e-23
WP_095859958.1|3020068_3020782_-	pirin family protein	NA	NA	NA	NA	NA
WP_021321653.1|3022653_3023445_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_014196746.1|3023437_3024130_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_095859959.1|3024505_3025804_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	40.0	1.8e-15
WP_095859960.1|3025828_3026722_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095860262.1|3026702_3027398_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.8	4.1e-27
WP_053532702.1|3027616_3027949_-	cytochrome c	NA	NA	NA	NA	NA
WP_095859961.1|3028011_3028875_-	YitT family protein	NA	NA	NA	NA	NA
WP_145956593.1|3028993_3030098_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	2.4e-05
WP_095859962.1|3030189_3032703_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_095859963.1|3032947_3033484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047819006.1|3033569_3034118_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_095859964.1|3034292_3035372_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_095859965.1|3035405_3035756_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_015375824.1|3035755_3036157_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_095859966.1|3036359_3037862_-	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
WP_095859967.1|3037877_3038237_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_033014989.1|3038526_3038913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033026284.1|3038909_3039170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859968.1|3039327_3040986_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_095858915.1|3041467_3042604_+|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
WP_095859970.1|3043691_3043886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859971.1|3044152_3045178_-	flagellin	NA	NA	NA	NA	NA
WP_095859972.1|3045366_3045606_-	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	56.9	2.5e-08
WP_095859973.1|3045622_3046057_-	flagellar assembly protein FliW	NA	NA	NA	NA	NA
WP_095859974.1|3046079_3046634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033009483.1|3046668_3047562_-	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_095859975.1|3047572_3049168_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_063210692.1|3049180_3049648_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_095859976.1|3049663_3049930_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_095859977.1|3050001_3050412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063329626.1|3050647_3051085_-	YaaR family protein	NA	NA	NA	NA	NA
WP_095859978.1|3051167_3053561_-	flagellar protein	NA	NA	NA	NA	NA
WP_095860264.1|3053582_3054005_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_095859979.1|3054061_3054358_-	flagellar biosynthesis protein FlhS	NA	NA	NA	NA	NA
WP_095859980.1|3054354_3056511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064213564.1|3056719_3057520_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859148.1|3057512_3058763_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	9.7e-11
WP_095859149.1|3058904_3059468_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095859981.1|3059614_3066442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095859982.1|3066514_3067207_-	ComF family protein	NA	NA	NA	NA	NA
WP_095859983.1|3067203_3068595_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	38.4	3.8e-64
WP_155266788.1|3068594_3068768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033009498.1|3069316_3070162_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	2.4e-13
WP_095859985.1|3070405_3071080_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	31.0	9.6e-05
WP_095859986.1|3071076_3072258_-	histidine kinase	NA	NA	NA	NA	NA
WP_095859987.1|3072474_3073119_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	9.1e-37
WP_095859988.1|3075884_3076763_-	accessory Sec system S-layer assembly protein	NA	NA	NA	NA	NA
WP_095859989.1|3076779_3079143_-	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_095859990.1|3079439_3081677_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	31.1	4.0e-07
>prophage 18
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	3211096	3247130	3466824	transposase	Rhodobacter_phage(50.0%)	28	NA	NA
WP_095860062.1|3211096_3211990_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_095860063.1|3212777_3213251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053532361.1|3213293_3213494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860064.1|3213734_3214232_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_095860065.1|3214403_3215342_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_013524778.1|3215489_3215948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095860066.1|3215961_3216567_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_044744270.1|3216937_3217327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860067.1|3217339_3218260_-	ADP-ribosyl-[dinitrogen reductase] hydrolase	NA	G3M9X5	Bacillus_virus	50.0	1.0e-78
WP_145956595.1|3218359_3219106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860069.1|3219564_3220017_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_095860070.1|3222132_3222879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860071.1|3222880_3223753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064213564.1|3224847_3225648_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_095859148.1|3225640_3226891_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.8	9.7e-11
WP_095859149.1|3227032_3227596_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_095860072.1|3229502_3230690_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_095860073.1|3231035_3232307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860074.1|3232401_3234069_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_095860075.1|3234094_3235873_-	Hsp70 family protein	NA	A0A1V0SBC3	Catovirus	27.1	1.9e-31
WP_095860076.1|3235893_3237339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860077.1|3237320_3239741_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_095860078.1|3240102_3241437_-	MFS transporter	NA	NA	NA	NA	NA
WP_095860080.1|3241996_3242917_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011888351.1|3244161_3244419_-	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_095860275.1|3244387_3244792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095858787.1|3245178_3245724_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015864903.1|3245876_3247130_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	25.6	4.8e-10
>prophage 19
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	3339787	3431984	3466824	integrase,protease,coat,transposase,tRNA	Wolbachia_phage(21.05%)	78	3394299:3394358	3427312:3428680
WP_095860128.1|3339787_3341461_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_033010742.1|3341465_3341897_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_095860129.1|3342150_3342528_-	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_049624641.1|3342659_3343535_-	agmatinase	NA	NA	NA	NA	NA
WP_095860130.1|3343547_3344375_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_095860131.1|3344631_3346677_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011232874.1|3346808_3347324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011232875.1|3347341_3348010_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_011232876.1|3348142_3348331_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_014196148.1|3348439_3349699_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	45.3	1.1e-75
WP_033015432.1|3349947_3350466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860278.1|3350479_3351778_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.6	3.6e-24
WP_011232879.1|3351922_3352150_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_011232880.1|3352325_3352979_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	51.5	9.9e-07
WP_095860132.1|3353117_3353969_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_095860133.1|3354168_3355149_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_021321327.1|3355406_3356153_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_011232884.1|3356358_3356805_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_095860134.1|3356823_3357408_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_095860135.1|3357603_3357975_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_095860136.1|3358045_3359305_-	HNH endonuclease	NA	Q331Y3	Clostridium_botulinum_C_phage	45.3	1.5e-75
WP_063167150.1|3359769_3360069_-	YwdI family protein	NA	NA	NA	NA	NA
WP_011232888.1|3360086_3360776_-	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	50.2	2.7e-55
WP_145956597.1|3364696_3364930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860137.1|3365041_3366226_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.1	4.1e-75
WP_095860138.1|3366446_3367829_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SAN4	Catovirus	30.2	2.5e-52
WP_095860279.1|3368116_3368947_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_095860139.1|3369026_3370223_-	MFS transporter	NA	NA	NA	NA	NA
WP_145956598.1|3370331_3370736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013146668.1|3370810_3371128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033011559.1|3371807_3372371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033011561.1|3372512_3373763_+|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	9.7e-11
WP_020279908.1|3373755_3374556_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_094239823.1|3376208_3377327_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094239822.1|3377340_3378639_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062679206.1|3378641_3379331_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.6e-29
WP_094239821.1|3379327_3379738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095858915.1|3382908_3384045_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
WP_095860142.1|3384462_3385599_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.1	7.2e-37
WP_095858915.1|3386016_3387153_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	2.1e-36
WP_095860143.1|3387722_3388859_-|transposase	IS110-like element ISGka2 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.9	1.2e-36
WP_095860144.1|3389505_3391263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011232902.1|3391279_3392140_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095860145.1|3392213_3393149_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_021321312.1|3393145_3394039_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
3394299:3394358	attL	CTGTAGATGAGCATTTTTCATTACAATAATTTCCATGGTTAGAGAGACAAACAGGGTACC	NA	NA	NA	NA
WP_095859838.1|3394360_3395548_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_110107477.1|3395677_3395845_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_095860146.1|3395863_3396358_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_095860147.1|3396383_3396758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095860148.1|3396848_3398084_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011232912.1|3398201_3399335_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_095860149.1|3400277_3400796_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_095860150.1|3400841_3401657_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_095860151.1|3401811_3402672_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_033009164.1|3403686_3404409_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.1e-33
WP_011232920.1|3404596_3404896_-	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_015376112.1|3404897_3405512_-	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_095860152.1|3405515_3407462_-	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_042381220.1|3407479_3408385_-	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_033008879.1|3408886_3409597_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_095860153.1|3410258_3411425_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050368156.1|3411823_3412354_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095860281.1|3412353_3412656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_095860280.1|3412692_3412881_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_158522922.1|3412929_3414369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033845283.1|3414382_3415831_+|transposase	IS66-like element ISBst12 family transposase	transposase	NA	NA	NA	NA
WP_095860155.1|3416306_3416861_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095860156.1|3417007_3418141_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_060788907.1|3418221_3418575_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	55.6	2.0e-22
WP_095860157.1|3419064_3420453_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_095860158.1|3420638_3422165_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033008876.1|3422356_3423319_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_050368738.1|3423482_3424607_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	9.9e-55
WP_033017188.1|3424796_3425981_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0H3V0V2	Geobacillus_virus	41.4	1.8e-75
WP_095859838.1|3426121_3427309_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_013877640.1|3427620_3428679_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	26.5	1.3e-11
WP_020279908.1|3429940_3430741_-	AAA family ATPase	NA	NA	NA	NA	NA
3427312:3428680	attR	GGTACCCTGTTTGTCTCTCTAACCATGGAAATTATTGTAATGAAAAATGCTCATCTACAGCTTATAATATAAAATATGAATAATCGAAAATCTATCCTGAAAACACCATTTAAGACAAAAAACGGAGCCCACCTAGCCTTCGGAATCGGATTCCAAAGGAAGGTATTTCAGTATATATATGGTTAATAAGTGCTATGCACTCGTTTTTTCTATATAGATGCACATTGAAACATTAACGTCCGTATAAGTGGCTTCCACCCCGGTTATACTGCTCCTAAGTACTTCACGAAGAAAAGGAGCGGAAACGGAATGAAACGATTGAAAATCACCAATGACCATGGATGGACGCCACGAACCCTTCGAAAGGAAGAGAAAAAAATCAAAAACATTTCCCTGCGTCAACGCGTCATGGCCGTTCGCCTCGTCATGGAAGGGTATCTGGGGAAAGACGTCGCTTCCATGCTCAACCTGTGCCGCCAAAGCGTCGCATTTTATGTCTCCTTATTCAACGAAGGAGGGCTCGATCTCCTGCTCGATCGGAAATATCCGCCGGGCCGGGAGCCGTTTTTGACACTGGAACAGCAACAGGAACTGAAACAGACGATCTTGACCCACACCCCGGCCGAACTCGGTTGGGACATCGCTTCTTCTTGGAATACGCGGATTCTTCAGTCTTATATCCGCGAACACTACGAGGTGGACATGTCCCGGGAAGGAATTCGCAAACTTTTACATCGAATGAGATTGTCTTGGACTCGTCCCACCTATACCCTGGCCAAAGGCGATGCCGAACAACAGCAGGCGTTTGAAAAACAAATGGATCTCATTAAAAAAAAACTGATCACTCCCGATACGATTCTTTTATATGCCGATGAAACTCATGTCCGGTCTTATCAAATCCTGCGGGCCACTTGGTCGGAGGCAGGCCGGCAAAAACAAGTGCCCACGTACGGCCATCATGCCCACGTTTCTGTATTTGGGGCGGTGAATGTGCTCAATGGGGACACCGTTCTTCATCGAGCAGTCGCTGCGAATGCGACGACGTTTTTGGATTTTTTAAAGATCTTGAAGAGCCGTTATCCAGACCAGCTGATCGTGCTCGTGCTCGACAATGCCCGCATCCACCATGCCAAAATGGTGAGAGATTTCTTGCGCCAAGAAGGGGAATCGTTTCACTTGATCTTTTTACCTCCTTATTCCCCACAGCTGAATCCCATCGAACGCTTGTGGAAATGGCTCAAGGATGCGGTCATTGCCAATGTGTTTCACAAAGATCAAATGGATATTGACCAAGCCATTGCCCGGTTTATGGAATATATAGATCAACAACCGGAAGAGGTGCTTCGACGCTTGGGGTGTGCAGCGTGAT	NA	NA	NA	NA
WP_033011561.1|3430733_3431984_-|transposase	IS481 family transposase	transposase	M4T586	Rhodobacter_phage	26.3	9.7e-11
>prophage 20
NZ_CP016552	Geobacillus stearothermophilus strain DSM 458 chromosome, complete genome	3466824	3436618	3446491	3466824		uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_050368739.1|3436618_3437836_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	8.0e-18
WP_063211306.1|3437937_3438732_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.5	1.5e-44
WP_095860160.1|3438738_3439524_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_095860161.1|3439510_3440839_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_033008868.1|3440831_3442661_-	cell wall metabolism sensor histidine kinase WalK	NA	A0A1V0SGX0	Hokovirus	27.0	9.5e-23
WP_095860162.1|3442667_3443381_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.9	7.7e-45
WP_095860282.1|3443686_3444973_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	7.8e-72
WP_033008866.1|3445126_3446491_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	3.2e-124
