The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	197159	260767	5088339	plate,protease,tRNA,transposase	Stx2-converting_phage(27.27%)	54	NA	NA
WP_001295561.1|197159_198512_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198541_200974_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|201095_201581_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201584_202610_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202714_203170_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203173_203962_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|203961_205110_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205106_205703_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|205739_209222_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209234_210194_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020980.1|210292_212434_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212490_212880_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176579.1|212944_214243_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214291_214552_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214538_214739_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214904_215450_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215446_215869_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215882_216593_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001355777.1|216747_217572_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217625_219344_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219454_220162_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220158_220563_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220680_221496_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221535_222189_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222181_223213_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223400_223976_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000381395.1|229764_231336_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|231355_231703_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|231702_232380_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_024184875.1|232436_233234_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_000648576.1|233230_234145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234385_235186_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|235263_236034_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|236081_237440_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|237511_238267_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|238300_239023_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239019_239487_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|239551_240283_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|240818_241604_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|241740_242220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|242229_243144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243187_243670_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000377959.1|243693_245046_-	membrane protein	NA	NA	NA	NA	NA
WP_122985795.1|245056_248491_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240543.1|248599_250015_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088873.1|250019_250763_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614335.1|250759_253519_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	2.7e-82
WP_000343293.1|253527_254289_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|254293_255625_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255627_256152_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|256148_257429_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|257453_258536_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258499_260350_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|260353_260767_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	306065	319779	5088339	integrase	Enterobacteria_phage(88.89%)	14	295655:295668	310667:310680
295655:295668	attL	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_001398674.1|306065_307271_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.0	1.9e-144
WP_001717712.1|307245_308628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|308829_309402_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|309475_309976_-	transactivation protein	NA	NA	NA	NA	NA
WP_095908812.1|309972_310707_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.5	1.1e-128
310667:310680	attR	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_001149161.1|311258_311525_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.8e-44
WP_095908813.1|311521_312076_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	79.3	5.8e-40
WP_001244670.1|312068_312356_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_095908814.1|312348_312804_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|312939_313260_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_095908815.1|313274_315608_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_001111349.1|316225_316636_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121335.1|316614_317571_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667065.1|317580_319779_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 3
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	819923	868969	5088339	head,lysis,protease,terminase,capsid,portal,tail,integrase,transposase	Enterobacteria_phage(52.46%)	64	811869:811885	860882:860898
811869:811885	attL	CGGAAGATGGCAGCGTG	NA	NA	NA	NA
WP_000533642.1|819923_820994_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|820971_821190_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|821229_821397_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120065.1|821639_822242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|822452_822674_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|822772_823054_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|823064_823256_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682306.1|823228_823411_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|823407_824088_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|824084_824870_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|824875_825172_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|825246_825390_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|825358_825523_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|825595_825964_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001066169.1|826224_826806_+	superinfection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_001398786.1|826822_827095_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	91.1	3.5e-22
WP_001095981.1|827407_828058_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	98.6	4.1e-122
WP_000276886.1|828138_828324_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_001177650.1|828432_828711_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000185503.1|828745_829645_+	replication protein	NA	M1FN81	Enterobacteria_phage	100.0	1.7e-174
WP_000788877.1|829641_830343_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000971860.1|830339_830513_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	89.1	1.6e-20
WP_001224618.1|830659_831154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141579.1|832091_832193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053013.1|832189_832645_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|832644_832815_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774484.1|832807_833098_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_001099712.1|833094_833457_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|833453_833594_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|833679_834063_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737273.1|834251_835334_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.8	3.3e-156
WP_000839596.1|835921_836137_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|836136_836634_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_024175646.1|836850_837057_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	91.2	4.2e-28
WP_001139682.1|837085_837238_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001356151.1|837409_838432_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|838428_839211_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001059339.1|839399_839924_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001355838.1|840226_840637_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.0	8.0e-55
WP_001663509.1|840695_840929_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453576.1|841317_841863_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027268.1|841837_843763_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|843759_843966_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_023607171.1|843962_845564_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.0e-307
WP_000123310.1|845544_846864_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.9	2.1e-234
WP_001358225.1|846873_847206_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063221.1|847261_848287_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158875.1|848328_848724_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|848735_849089_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_001711999.1|849382_850060_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_000624622.1|850059_850407_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|850426_851998_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000683129.1|852382_852778_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001390117.1|852785_853526_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.5e-128
WP_000479193.1|853541_853964_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|853945_854380_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840178.1|854372_856952_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.1	0.0e+00
WP_000847382.1|856948_857278_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	6.2e-58
WP_000140713.1|857979_858723_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_000515638.1|859349_862847_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
860882:860898	attR	CACGCTGCCATCTTCCG	NA	NA	NA	NA
WP_001233077.1|862917_863517_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	7.0e-108
WP_071607502.1|863581_866980_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885606.1|866979_867564_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.0e-103
WP_000586339.1|867637_868969_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 4
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	1249579	1307191	5088339	protease,holin,portal,tail,tRNA,integrase,transposase	Enterobacteria_phage(51.02%)	67	1248191:1248206	1268009:1268024
1248191:1248206	attL	ATCCACCGCATCACCG	NA	NA	NA	NA
WP_001403676.1|1249579_1250698_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	4.5e-84
WP_000003742.1|1250666_1250936_-	excisionase	NA	NA	NA	NA	NA
WP_001398899.1|1250997_1253469_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_001090252.1|1253548_1253752_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449198.1|1253748_1253937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122994023.1|1254342_1254510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1254503_1254737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394517.1|1254714_1255122_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.7e-09
WP_001171921.1|1255144_1255363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1255522_1255678_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001003379.1|1255867_1256275_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476985.1|1256352_1256580_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705382.1|1256563_1257085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054517.1|1257065_1258031_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.4	1.5e-56
WP_000788772.1|1258036_1258783_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.1	5.1e-116
WP_000450703.1|1258804_1259566_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.8	1.6e-85
WP_001509842.1|1259598_1259880_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.1e-31
WP_000160146.1|1260398_1260821_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	43.3	1.8e-17
WP_000935258.1|1261055_1261268_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001277775.1|1261483_1261663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818165.1|1261681_1262167_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000701918.1|1262367_1262628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023607105.1|1262694_1262973_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	4.8e-11
WP_001502278.1|1262974_1264030_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.1e-87
WP_001297842.1|1264030_1264396_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	2.7e-38
WP_001398904.1|1264404_1264947_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.9e-67
WP_000917767.1|1265259_1265457_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611206.1|1265607_1266657_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.1	2.8e-184
WP_001297664.1|1267148_1267541_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_000950576.1|1267530_1267806_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
WP_001117825.1|1267808_1268186_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	5.6e-63
1268009:1268024	attR	CGGTGATGCGGTGGAT	NA	NA	NA	NA
WP_001297666.1|1268318_1268432_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_000415817.1|1268790_1269183_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
WP_000421824.1|1269763_1270303_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
WP_001743889.1|1271165_1272737_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.9e-168
WP_000624622.1|1272756_1273104_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1273103_1273781_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001072975.1|1275114_1275327_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001460789.1|1275326_1276802_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.6e-281
WP_024169733.1|1276779_1278807_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_001097045.1|1278893_1279217_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283153.1|1279209_1279485_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001398416.1|1279496_1280087_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001464346.1|1280083_1280485_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	97.7	7.0e-72
WP_000211121.1|1280495_1281239_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001298500.1|1281299_1281686_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|1281694_1282024_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001460656.1|1281995_1285052_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.5	0.0e+00
WP_000447253.1|1285051_1285381_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152385.1|1285390_1286089_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_001462126.1|1286093_1286837_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.4e-150
WP_000741576.1|1286734_1287382_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_095908817.1|1287442_1290922_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_001462065.1|1290989_1291589_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	6.5e-106
WP_095908818.1|1291653_1295067_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	3.7e-12
WP_000885577.1|1295066_1295651_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_126123768.1|1295705_1296374_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1296430_1296697_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|1296929_1297793_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1297776_1298913_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359463.1|1299162_1300392_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1300537_1301659_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1301734_1303195_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1303194_1303866_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1304033_1305404_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001736266.1|1305407_1306049_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1306084_1307191_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	1406506	1470123	5088339	head,protease,holin,terminase,capsid,portal,tail,integrase,transposase	Escherichia_phage(35.42%)	75	1412366:1412393	1456318:1456345
WP_000998069.1|1406506_1408045_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	2.6e-292
WP_000967595.1|1408394_1408691_-	YciI family protein	NA	NA	NA	NA	NA
WP_001376357.1|1408914_1409634_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1409673_1410072_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1410176_1410716_-	septation protein A	NA	NA	NA	NA	NA
WP_000028540.1|1410745_1411489_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|1411845_1412484_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
1412366:1412393	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113701.1|1412529_1413660_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	1.3e-102
WP_000113189.1|1413637_1413886_-	excisionase	NA	NA	NA	NA	NA
WP_001745181.1|1413950_1416422_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	3.0e-56
WP_000199480.1|1416517_1416706_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|1416702_1416891_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001299931.1|1417291_1417456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|1417459_1417678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071608135.1|1417837_1417993_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_001397087.1|1418285_1418624_-	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000747951.1|1419015_1419258_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1419241_1419667_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_089516821.1|1419738_1420809_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151221.1|1420849_1421272_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_000161640.1|1421418_1422228_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_122358658.1|1422643_1422751_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	9.4e-08
WP_001013636.1|1422795_1423008_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001410105.1|1423174_1423453_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001736257.1|1423454_1424513_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	1.1e-90
WP_000140028.1|1424513_1424894_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	4.5e-36
WP_000762892.1|1424890_1425712_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	3.0e-77
WP_000562553.1|1426607_1426739_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1427019_1427355_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1427615_1427804_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000372595.1|1428111_1428327_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193278.1|1428331_1428676_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1428641_1428914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992067.1|1429019_1429553_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	1.1e-99
WP_122986666.1|1430071_1430257_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	77.0	7.1e-19
WP_000867569.1|1430760_1431309_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_023356388.1|1431280_1433209_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	1.5e-260
WP_000259002.1|1433192_1433399_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001355910.1|1433395_1434988_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253936.1|1434977_1436483_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	1.2e-100
WP_000256823.1|1436519_1436867_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1436924_1437953_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|1438004_1438388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1438380_1438734_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974977.1|1438749_1439283_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.6e-58
WP_000683079.1|1439279_1439675_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1439682_1440435_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479095.1|1440448_1440880_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000533402.1|1440906_1441320_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082347.1|1441300_1443874_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|1443870_1444200_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001355911.1|1444199_1444898_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	3.5e-127
WP_000194701.1|1444908_1445652_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_122994019.1|1445597_1446230_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	1.1e-100
WP_000514651.1|1446470_1449944_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_001233193.1|1450011_1450611_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	3.1e-108
WP_095908819.1|1450675_1454089_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885580.1|1454088_1454673_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1454727_1455396_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1455452_1455722_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079509.1|1456495_1457002_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1456318:1456345	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1457047_1457548_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1457633_1457813_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|1458193_1459000_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1458999_1460193_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001398955.1|1460204_1461563_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	1.5e-36
WP_000763511.1|1461566_1463162_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_016570170.1|1463161_1464724_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1464815_1464860_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1464997_1465879_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1465875_1466496_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1466596_1467469_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1467508_1468099_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1468095_1468854_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1469073_1470123_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	1761322	1817849	5088339	head,holin,terminase,capsid,portal,tail,integrase,transposase	Escherichia_phage(33.96%)	64	1813005:1813018	1816234:1816247
WP_001165996.1|1761322_1761889_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	63.4	2.5e-62
WP_001233545.1|1763918_1764518_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	4.2e-105
WP_095908820.1|1764585_1767981_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.7	0.0e+00
WP_157732293.1|1768052_1768643_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.2	1.2e-54
WP_001152639.1|1769326_1770025_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|1770024_1770354_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840312.1|1770350_1772930_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.4	0.0e+00
WP_000459458.1|1772922_1773357_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000479153.1|1773338_1773761_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001711723.1|1773776_1774517_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000683119.1|1774524_1774920_-|tail	phage tail protein U	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_000985130.1|1774916_1775495_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.9e-78
WP_000752994.1|1775506_1775860_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158859.1|1775871_1776258_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.9e-53
WP_000063254.1|1776299_1777325_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001299443.1|1777380_1777713_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123336.1|1777722_1779042_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.6	1.8e-233
WP_001355924.1|1779022_1780624_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	7.9e-308
WP_000198149.1|1780620_1780827_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001711999.1|1781504_1782182_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_000624622.1|1782181_1782529_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1782548_1784120_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_095908821.1|1784040_1785456_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.6	1.4e-268
WP_000453576.1|1785430_1785976_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001415975.1|1786364_1786559_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738421.1|1786919_1787213_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001305859.1|1787568_1787682_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_000836754.1|1787901_1788447_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.7	6.4e-92
WP_001398933.1|1788448_1788727_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	94.6	9.0e-42
WP_001398932.1|1788716_1789109_-|holin	phage holin	holin	Q9MBZ5	Enterobacteria_phage	88.5	3.8e-54
WP_000799652.1|1790178_1791225_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	85.2	2.8e-176
WP_001355891.1|1791374_1791569_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_000123148.1|1791825_1793109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532207.1|1793315_1793669_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.4e-55
WP_001217451.1|1793658_1794030_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	2.3e-37
WP_001265103.1|1794042_1795089_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	2.5e-108
WP_001410105.1|1795090_1795369_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001013636.1|1795535_1795748_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_122358658.1|1795792_1795900_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	9.4e-08
WP_001399639.1|1796704_1797535_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	30.2	5.4e-26
WP_000130123.1|1797531_1798038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032190252.1|1798040_1798736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000625667.1|1799018_1800296_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005032116.1|1800359_1802357_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_001356151.1|1802610_1803633_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|1803629_1804412_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_085947771.1|1804653_1805815_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001151151.1|1805917_1806340_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262391.1|1806380_1807451_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693850.1|1807522_1807948_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|1807944_1808160_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103684.1|1808209_1808926_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	5.9e-53
WP_000379589.1|1809198_1809354_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171930.1|1809513_1809732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|1809735_1809900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449194.1|1810299_1810488_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090551.1|1810484_1810688_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048591.1|1810767_1813248_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	2.0e-60
1813005:1813018	attL	GACTTTCGATAACG	NA	NA	NA	NA
WP_001296941.1|1813332_1813569_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001355842.1|1813588_1814884_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	62.0	4.8e-154
WP_072131185.1|1814906_1815014_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|1815071_1816091_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1816102_1817317_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
1816234:1816247	attR	CGTTATCGAAAGTC	NA	NA	NA	NA
WP_000598292.1|1817522_1817849_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 7
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	2272202	2282280	5088339	transposase	Stx2-converting_phage(40.0%)	15	NA	NA
WP_001502865.1|2272202_2273021_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.3e-45
WP_000855059.1|2273362_2273836_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|2273851_2274328_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692341.1|2274390_2274612_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
WP_001744949.1|2274800_2276414_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	9.5e-176
WP_000624688.1|2276444_2276795_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001403014.1|2276791_2277226_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001295723.1|2277323_2277692_+	antitoxin	NA	NA	NA	NA	NA
WP_000854762.1|2277781_2278156_+	toxin	NA	NA	NA	NA	NA
WP_000976829.1|2278152_2278359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2278371_2278485_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000612588.1|2279702_2280050_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_001171554.1|2280046_2280427_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001433436.1|2280529_2281504_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.5	1.7e-188
WP_001667685.1|2281497_2282280_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.0e-138
>prophage 8
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	2316226	2438987	5088339	head,lysis,holin,terminase,capsid,portal,tail,tRNA,plate,integrase,transposase	Escherichia_phage(32.26%)	119	2378025:2378051	2411711:2411737
WP_085949082.1|2316226_2316921_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.3	1.3e-121
WP_000595974.1|2316980_2318468_-	O115 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000240349.1|2318460_2319192_-	CatB-related O-acetyltransferase	NA	M1HJ62	Paramecium_bursaria_Chlorella_virus	35.1	1.7e-07
WP_000095687.1|2319184_2320258_-	hypothetical protein	NA	A0A1V0SDW6	Indivirus	25.8	7.8e-25
WP_001100786.1|2320264_2320813_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	4.2e-51
WP_000857543.1|2320817_2321696_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	2.8e-105
WP_001023635.1|2321753_2322653_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.3	6.3e-28
WP_000699442.1|2322652_2323738_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.6e-102
WP_000183073.1|2324110_2325004_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116037.1|2325178_2326573_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.7e-19
WP_000862579.1|2326583_2327804_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_000770768.1|2327800_2329081_-	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_000058426.1|2329152_2330631_-	M-antigen undecaprenyl disphosphate flippase	NA	NA	NA	NA	NA
WP_000183116.1|2330632_2332027_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_001355816.1|2332081_2333452_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	6.4e-32
WP_000079268.1|2333644_2335081_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	3.7e-46
WP_000699706.1|2335083_2336307_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001399100.1|2336303_2336783_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|2336785_2337751_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|2337753_2338875_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_001153570.1|2338901_2339450_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000927039.1|2339465_2340212_-	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_000107816.1|2340222_2341440_-	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_001023946.1|2341414_2342632_-	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000888729.1|2342628_2343117_-	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_000654503.1|2343119_2343959_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137111.1|2344051_2346214_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2346216_2346660_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2346665_2347805_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|2348463_2350047_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|2350320_2352174_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2352195_2352777_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2352868_2353510_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_000043694.1|2353827_2357145_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000288381.1|2357182_2358040_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000469714.1|2358173_2359526_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	7.1e-07
WP_001355818.1|2359537_2361478_-	protein kinase YegI	NA	NA	NA	NA	NA
WP_000119074.1|2361474_2362236_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_000003178.1|2362232_2362892_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010723109.1|2363112_2363172_-	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_001386899.1|2363444_2363501_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001386901.1|2363772_2363829_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000678935.1|2364107_2365355_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197821.1|2365354_2368477_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000667541.1|2368477_2371555_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130867.1|2371555_2372971_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675149.1|2372967_2374371_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	1.6e-33
WP_000137873.1|2374367_2375090_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_001351381.1|2375280_2375613_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2375821_2376118_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2376119_2376416_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2376518_2377880_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2378025:2378051	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|2378152_2378371_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882934.1|2378452_2379616_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	2.0e-204
WP_000978892.1|2379615_2380095_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.9e-84
WP_000069946.1|2380109_2382557_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
WP_000785970.1|2382549_2382669_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2382701_2382977_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2383033_2383552_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286708.1|2383564_2384755_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000251361.1|2385240_2386107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071594437.1|2386344_2386614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399106.1|2386891_2387827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164102.1|2388302_2388830_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	1.8e-91
WP_000104742.1|2388833_2391152_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	66.5	3.1e-212
WP_001285325.1|2391162_2391693_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121470.1|2391685_2392594_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
WP_000127163.1|2392598_2392946_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001712382.1|2392942_2393578_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.9e-111
WP_001001786.1|2393644_2394097_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917139.1|2394089_2394557_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_000040649.1|2394646_2395090_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.9e-66
WP_000736619.1|2395077_2395503_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	6.6e-60
WP_001144101.1|2395517_2396015_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2396014_2396296_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001668220.1|2396299_2396503_-	phage Tail protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2396502_2397012_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_016569916.1|2397111_2397855_-|terminase	terminase endonuclease subunit	terminase	Q94ME4	Enterobacteria_phage	98.4	2.8e-122
WP_001661061.1|2397858_2398932_-|capsid	phage major capsid protein, P2 family	capsid	Q778Z0	Enterobacteria_phage	99.7	1.9e-201
WP_001403632.1|2398990_2399845_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.6	8.1e-134
WP_000156861.1|2400018_2401791_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001554332.1|2401790_2402825_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	2.3e-199
WP_000423309.1|2403328_2405545_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001731158.1|2405794_2408059_-	replication endonuclease	NA	M1SV59	Escherichia_phage	97.7	0.0e+00
WP_000027668.1|2408048_2408324_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_001113264.1|2408320_2408545_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277961.1|2408544_2408847_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_000557703.1|2408846_2409071_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|2409134_2409635_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000043869.1|2409812_2410088_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2410202_2410502_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985256.1|2410617_2411631_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001404010.1|2411896_2412214_-	hypothetical protein	NA	NA	NA	NA	NA
2411711:2411737	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807362.1|2412628_2413528_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2413609_2414389_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844201.1|2414488_2415529_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2415576_2416932_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|2416935_2417220_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|2417250_2417703_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853879.1|2417712_2418975_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001345895.1|2419003_2419858_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2420165_2421218_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858481.1|2421474_2422752_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846219.1|2422748_2423753_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000011976.1|2423749_2424715_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2424688_2425435_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2425486_2426305_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822275.1|2426369_2427170_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195602.1|2427166_2427955_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2428177_2428450_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134648.1|2428570_2429395_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2429613_2429952_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405707.1|2430033_2431068_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945466.1|2431083_2433564_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|2433579_2434254_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2434333_2434876_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001307891.1|2435168_2435450_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2435712_2436822_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2436953_2438987_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 9
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	2451510	2460952	5088339		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2451510_2452647_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001326004.1|2452643_2454644_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2454768_2455230_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2455270_2455741_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2455787_2456507_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2456503_2458189_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2458410_2459142_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2459201_2459309_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2459289_2460021_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|2460025_2460952_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	2921139	3007552	5088339	head,lysis,terminase,capsid,portal,tail,tRNA,plate,integrase,transposase	Salmonella_phage(69.81%)	93	2982929:2982943	3013644:3013658
WP_001297411.1|2921139_2921877_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2922008_2923343_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001307344.1|2923551_2924433_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2924535_2925123_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2925178_2925562_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2925866_2926556_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2926603_2927641_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2927847_2928267_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001307345.1|2928335_2929034_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082949.1|2929065_2931726_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949252.1|2931839_2933195_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2933240_2933564_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2933560_2934859_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2940637_2943211_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2943340_2944072_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|2944068_2945049_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2945183_2945921_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2946191_2946533_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2946636_2946684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2946782_2947943_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2947985_2949107_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|2949117_2950188_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2950397_2950763_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2950912_2951431_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|2951420_2952647_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2952662_2953145_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2953221_2953569_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2953610_2954378_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2954408_2954957_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2954975_2955224_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016569955.1|2955360_2956722_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2956888_2957680_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2957700_2958987_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287917.1|2959109_2959715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300112.1|2959749_2960340_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2960462_2961341_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2961426_2963088_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2963236_2963578_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2963639_2963930_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2963919_2964396_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2964527_2965010_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001399230.1|2965710_2966193_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|2966219_2966438_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001399231.1|2966506_2967607_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	5.8e-177
WP_000980394.1|2967603_2968089_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001404025.1|2968085_2971163_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.6	0.0e+00
WP_000763311.1|2971155_2971275_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2971289_2971592_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|2971646_2972162_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001404026.1|2972171_2973344_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_000120166.1|2973476_2973911_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	40.6	4.2e-22
WP_001404027.1|2973910_2975641_-|tail	phage tail fiber repeat family protein	tail	A0A0M3ULH6	Salmonella_phage	62.8	4.7e-80
WP_001086815.1|2975637_2976243_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	2.3e-111
WP_001404028.1|2976235_2977144_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177597.1|2977130_2977490_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993765.1|2977486_2978065_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_024169309.1|2978153_2978591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001404029.1|2978615_2979065_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.9	3.7e-61
WP_001404030.1|2979057_2979489_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_001404032.1|2979584_2980013_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	3.8e-47
WP_000730951.1|2980009_2980387_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001069913.1|2980388_2980901_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_000171568.1|2980881_2981097_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2981100_2981304_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_001404033.1|2981303_2981768_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	1.9e-73
WP_000059199.1|2981863_2982514_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_000742530.1|2982517_2983576_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.2e-181
2982929:2982943	attL	GACGGCATCCATCAC	NA	NA	NA	NA
WP_001404034.1|2983592_2984426_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	6.3e-123
WP_001098431.1|2984568_2986335_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_001404035.1|2986334_2987363_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.8	1.0e-170
WP_024169310.1|2987400_2988072_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001404036.1|2988064_2989303_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001404037.1|2989755_2990409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001404038.1|2990661_2991114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001404039.1|2992016_2992250_-	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	8.0e-36
WP_001154434.1|2992260_2992449_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001736394.1|2992602_2995041_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.7	0.0e+00
WP_001399245.1|2995037_2995895_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	2.4e-162
WP_001399246.1|2995891_2996119_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244228.1|2996118_2996352_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000963854.1|2996419_2996761_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	2.3e-55
WP_000934004.1|2996843_2997092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399247.1|2997177_2997474_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_001399248.1|2997481_2997991_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|2998023_2998266_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932271.1|2998387_2999020_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
WP_001399250.1|2999022_3000039_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.7	1.4e-188
WP_001083625.1|3000049_3000718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341819.1|3001013_3002243_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|3002281_3002698_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214997.1|3002769_3004518_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|3004519_3006238_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_085947771.1|3006389_3007552_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
3013644:3013658	attR	GTGATGGATGCCGTC	NA	NA	NA	NA
>prophage 11
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	3094430	3103196	5088339	integrase	Escherichia_phage(71.43%)	7	3091155:3091168	3096853:3096866
3091155:3091168	attL	ATCCATAATGATGC	NA	NA	NA	NA
WP_001399294.1|3094430_3095891_-|integrase	phage integrase	integrase	A0A0R6PGY7	Moraxella_phage	26.1	3.0e-19
WP_001554745.1|3096050_3098618_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
3096853:3096866	attR	GCATCATTATGGAT	NA	NA	NA	NA
WP_001141330.1|3098723_3099380_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3099430_3100198_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3100393_3101302_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3101298_3102561_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3102557_3103196_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 12
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	3399521	3405232	5088339	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_001711999.1|3399521_3400199_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_000624622.1|3400198_3400546_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3400565_3402137_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_024172271.1|3402151_3402982_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.8e-46
WP_001183319.1|3402981_3403251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001355870.1|3403319_3403793_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001502867.1|3403808_3404285_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692327.1|3404347_3404569_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	9.4e-10
WP_000086771.1|3404587_3405232_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	33.6	1.3e-27
>prophage 13
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	3931996	3970791	5088339	transposase	Stx2-converting_phage(44.44%)	34	NA	NA
WP_000998069.1|3931996_3933535_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	2.6e-292
WP_000723069.1|3933750_3934185_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001211180.1|3934402_3935803_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_001188930.1|3935799_3936480_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_000998778.1|3936534_3937464_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|3937468_3937849_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001242438.1|3937888_3938785_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925239.1|3938784_3940602_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|3940836_3941286_+	copper resistance protein	NA	NA	NA	NA	NA
WP_000287501.1|3941574_3942312_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
WP_000843494.1|3942345_3942543_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001356151.1|3943081_3944104_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|3944100_3944883_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000758224.1|3947117_3947558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000574029.1|3947644_3950791_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_000157620.1|3950801_3952094_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|3952207_3952561_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475506.1|3952588_3953974_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697968.1|3954163_3954844_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000555736.1|3954836_3956318_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_001744949.1|3956692_3958306_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	9.5e-176
WP_000624688.1|3958336_3958687_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001403014.1|3958683_3959118_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000647571.1|3959690_3960041_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000381395.1|3960174_3961746_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3961765_3962113_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|3962112_3962790_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_071594469.1|3962789_3964475_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001744949.1|3964529_3966143_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	9.5e-176
WP_000624688.1|3966173_3966524_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001403014.1|3966520_3966955_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_001097216.1|3967644_3967944_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000262420.1|3968296_3969223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001324699.1|3969234_3970791_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	4179507	4189584	5088339	integrase	Enterobacteria_phage(100.0%)	11	4179325:4179347	4190060:4190082
4179325:4179347	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001219057.1|4179507_4180683_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	3.8e-206
WP_000160301.1|4180712_4182479_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000446131.1|4182759_4183332_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000638628.1|4183405_4183906_-	transactivation protein	NA	NA	NA	NA	NA
WP_016569933.1|4183902_4184637_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|4185189_4185456_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001360858.1|4185452_4186052_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001244665.1|4186044_4186332_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_095908824.1|4186324_4186780_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.4e-63
WP_000856729.1|4186915_4187236_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_053895792.1|4187250_4189584_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
4190060:4190082	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 15
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	4439029	4518562	5088339	head,lysis,holin,protease,terminase,capsid,portal,tail,tRNA,plate,integrase,transposase	Escherichia_phage(38.64%)	89	4432237:4432254	4520138:4520155
4432237:4432254	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
WP_000560983.1|4439029_4439467_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4439511_4440453_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4440516_4441425_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4441653_4441965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4441965_4442256_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4442860_4443079_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4443297_4443540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|4443869_4444799_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4444795_4445431_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4445427_4446330_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077632586.1|4446342_4449393_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	8.5e-08
WP_000753589.1|4449586_4450420_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001307491.1|4450572_4451613_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931315.1|4451662_4453411_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019463.1|4453410_4454481_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446026.1|4454470_4455922_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4455932_4456379_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4456691_4457006_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4457015_4457840_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001307492.1|4458014_4459274_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144052.1|4459270_4460740_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|4461027_4461864_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|4461847_4462786_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063489.1|4462782_4463817_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4464101_4464722_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166062.1|4464981_4465965_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4466113_4466788_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4466893_4468267_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4468263_4468962_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4469111_4469612_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000023384.1|4469797_4470778_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|4470847_4471141_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4471293_4471566_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|4471735_4472236_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4472299_4472524_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|4472523_4472826_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001113264.1|4472825_4473050_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027668.1|4473046_4473322_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	6.6e-45
WP_000268607.1|4473311_4475579_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.9	0.0e+00
WP_000287234.1|4475856_4476327_+	SocA family protein	NA	I6R0L8	Salmonella_phage	37.4	2.5e-12
WP_001112381.1|4476367_4476940_+	DUF2975 domain-containing protein	NA	S5M7T3	Escherichia_phage	35.3	1.8e-12
WP_000038177.1|4477315_4478350_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	2.4e-201
WP_000156859.1|4478349_4480122_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085948.1|4480295_4481150_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_001248563.1|4481208_4482282_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	4.3e-201
WP_016569916.1|4482285_4483029_+|terminase	terminase endonuclease subunit	terminase	Q94ME4	Enterobacteria_phage	98.4	2.8e-122
WP_000988633.1|4483128_4483638_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001668220.1|4483637_4483841_+	phage Tail protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123124.1|4483844_4484126_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4484125_4484623_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736619.1|4484637_4485063_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	6.6e-60
WP_001736217.1|4485050_4485494_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.9e-66
WP_000917140.1|4485583_4486051_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	96.8	1.4e-79
WP_001001785.1|4486043_4486496_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	2.6e-75
WP_000255498.1|4486567_4487353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093716.1|4487436_4488072_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.0e-113
WP_000127164.1|4488068_4488416_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121454.1|4488420_4489329_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	8.3e-161
WP_001285347.1|4489321_4489852_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	8.6e-102
WP_000104686.1|4489862_4492112_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	55.9	8.4e-138
WP_001398860.1|4492115_4492643_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	92.6	2.4e-88
WP_000152899.1|4493036_4494029_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001286703.1|4494626_4495817_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251401.1|4495829_4496348_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	1.9e-93
WP_001031303.1|4496404_4496680_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4496712_4496832_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001504916.1|4496824_4499272_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.2	0.0e+00
WP_000978889.1|4499286_4499766_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_001504918.1|4499765_4500929_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	1.4e-205
WP_000468308.1|4501010_4501229_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076755.1|4501464_4502367_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|4502547_4503510_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000399589.1|4503784_4504765_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001045698.1|4505107_4506097_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|4506203_4506959_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4507013_4507781_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802233.1|4507888_4508488_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4508588_4509029_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4509240_4509540_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4509566_4509995_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4509999_4510746_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4510842_4511853_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4511988_4513497_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4513519_4514365_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4514789_4515035_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4515119_4515605_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4515697_4516624_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4516690_4518022_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4518031_4518562_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
4520138:4520155	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 16
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	4848448	4907700	5088339	integrase,transposase	Escherichia_phage(26.67%)	60	4867370:4867390	4914913:4914933
WP_000181155.1|4848448_4849393_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	7.0e-62
WP_001137015.1|4849859_4851092_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001736534.1|4851132_4852413_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001355767.1|4852528_4853680_+	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_000222495.1|4853689_4854457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298932.1|4854774_4855635_+	YjiK family protein	NA	NA	NA	NA	NA
WP_001141202.1|4855702_4856881_+	MFS transporter	NA	NA	NA	NA	NA
WP_001151859.1|4856893_4857448_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
WP_001295597.1|4857697_4858381_+	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_000211971.1|4858377_4858839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000568432.1|4858851_4860024_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000340740.1|4860088_4861000_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000986224.1|4860992_4861385_-	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_120795393.1|4861381_4861465_-	iraD leader peptide	NA	NA	NA	NA	NA
WP_077635510.1|4862057_4862480_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_126123760.1|4862498_4862888_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000833677.1|4863028_4863802_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000208220.1|4864016_4865477_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
WP_000438591.1|4865557_4866742_-	mannonate dehydratase	NA	NA	NA	NA	NA
4867370:4867390	attL	GGGAGAGGGTTAGGGTGAGGG	NA	NA	NA	NA
WP_000832240.1|4867528_4868431_-	type 1 fimbria D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000872005.1|4868450_4868954_-	type 1 fimbria minor subunit FimG	NA	NA	NA	NA	NA
WP_001244826.1|4868966_4869497_-	type 1 fimbria minor subunit FimF	NA	NA	NA	NA	NA
WP_000120930.1|4869506_4872143_-	fimbrial biogenesis usher protein FimD	NA	NA	NA	NA	NA
WP_000066558.1|4872209_4872935_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000824105.1|4872971_4873511_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000695546.1|4873575_4874124_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000044711.1|4874604_4875201_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|4875678_4876281_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_001443018.1|4877736_4878453_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001341302.1|4878472_4879579_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991415.1|4879643_4880624_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	6.1e-101
WP_001037966.1|4880631_4881282_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001399657.1|4882286_4884203_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.0	3.1e-16
WP_001399656.1|4884205_4885357_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_001399655.1|4885366_4886263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399654.1|4886656_4887586_+	abi-like family protein	NA	NA	NA	NA	NA
WP_001665149.1|4887746_4888355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399653.1|4888367_4889276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169336.1|4889630_4890071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001503478.1|4890048_4890753_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000381395.1|4890673_4892245_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4892264_4892612_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|4892611_4893289_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_095908826.1|4893265_4893805_+	relaxase	NA	NA	NA	NA	NA
WP_001317493.1|4893848_4894631_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|4894627_4895650_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001667138.1|4896146_4896425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001555564.1|4896454_4896841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399632.1|4896865_4897129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569887.1|4897169_4897598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200789.1|4897692_4898091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399631.1|4898100_4899705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399630.1|4899720_4901046_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001399629.1|4900996_4902265_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001399628.1|4902551_4902866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200782.1|4902887_4903094_-	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.4	2.2e-05
WP_001399627.1|4903259_4904069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032190416.1|4904210_4905287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399625.1|4905222_4906362_-	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	27.9	3.6e-28
WP_001399624.1|4906449_4907700_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.6	3.9e-84
4914913:4914933	attR	CCCTCACCCTAACCCTCTCCC	NA	NA	NA	NA
>prophage 17
NZ_CP023346	Escherichia coli strain ETEC-2265 chromosome, complete genome	5088339	5011360	5052923	5088339	protease,lysis,terminase,portal,tail,integrase	Enterobacteria_phage(43.75%)	49	5003901:5003916	5029259:5029274
5003901:5003916	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_016570103.1|5011360_5012584_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.3	8.9e-235
WP_016570101.1|5012738_5013554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184839.1|5013883_5014195_-	hypothetical protein	NA	A0A2H4N7F8	Pectobacterium_phage	43.6	4.9e-12
WP_000476212.1|5014191_5014431_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_000156999.1|5014423_5014627_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	6.1e-32
WP_001767794.1|5014623_5015502_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.5	1.5e-167
WP_016570097.1|5015492_5016029_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	2.4e-99
WP_016570096.1|5016158_5016983_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	5.0e-149
WP_000135682.1|5017048_5017411_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000859460.1|5018099_5018774_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|5018864_5019065_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|5019108_5019660_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087352.1|5019656_5020493_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
WP_015364394.1|5020497_5020722_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_000061506.1|5020718_5021537_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_072185076.1|5021533_5022028_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.5	7.6e-84
WP_001442792.1|5022027_5022681_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|5022677_5023004_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767103.1|5023000_5023390_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_001061379.1|5023409_5024219_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001360050.1|5024226_5025216_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047105.1|5025229_5025982_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000217632.1|5026262_5026688_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000595432.1|5026911_5027115_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
WP_000799653.1|5027265_5028318_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	1.4e-207
WP_000839596.1|5028384_5028600_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_095908827.1|5028599_5029094_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	98.8	9.2e-90
WP_001341210.1|5029090_5029558_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
5029259:5029274	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139680.1|5029545_5029698_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_000373425.1|5030373_5030868_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934132.1|5030867_5032970_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.7	0.0e+00
WP_001072973.1|5032966_5033179_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985938.1|5033178_5034687_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
WP_016240729.1|5034631_5036659_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097045.1|5036745_5037069_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_001283152.1|5037061_5037337_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_032192251.1|5037348_5037927_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.0	8.0e-101
WP_001079419.1|5037923_5038325_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211104.1|5038335_5039079_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	7.8e-133
WP_001372042.1|5039139_5039526_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|5039534_5039864_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372045.1|5039835_5042901_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447253.1|5042900_5043230_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152379.1|5043239_5043938_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_095908828.1|5043943_5044687_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	9.8e-152
WP_000741576.1|5044584_5045232_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_095908829.1|5045292_5048790_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.6	0.0e+00
WP_001233077.1|5048860_5049460_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	7.0e-108
WP_095908830.1|5049524_5052923_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
>prophage 1
NZ_CP023347	Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence	142368	3867	51423	142368	transposase,protease	Stx2-converting_phage(29.41%)	53	NA	NA
WP_001744949.1|3867_5481_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	9.5e-176
WP_000624688.1|5511_5862_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001403014.1|5858_6293_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000896607.1|6307_6529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146678.1|6518_7970_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_001230779.1|7969_8698_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399780.1|8684_9251_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_001117572.1|9272_9584_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001098986.1|9588_9951_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000089263.1|9983_10211_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000283565.1|10347_11019_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_000124827.1|11212_11596_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000252686.1|11930_12521_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234442.1|12817_13639_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	1.3e-43
WP_001272251.1|13749_14046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550495.1|14108_14342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332444.1|14940_15102_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000872086.1|15310_15625_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	39.3	1.5e-13
WP_000994094.1|15621_16341_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845950.1|16337_16772_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000468050.1|16826_17402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023607118.1|17450_18791_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	31.8	1.9e-20
WP_000005971.1|18854_19088_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290803.1|19144_19672_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.6	5.7e-45
WP_001337416.1|19736_19973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297832.1|20485_21049_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
WP_000170657.1|21095_22457_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|22508_22739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091723.1|24138_25806_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.1	2.3e-164
WP_001024838.1|26118_26310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271732.1|26306_26729_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001666994.1|26775_27078_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001006237.1|27615_28386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077764356.1|28430_28985_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104871.1|28878_29100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086125.1|29100_29784_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001440221.1|30167_31070_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000959884.1|31604_32567_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_001365718.1|32569_32920_+	protein stbB	NA	NA	NA	NA	NA
WP_001254203.1|33032_33326_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	95.5	1.7e-43
WP_001355931.1|33468_33774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024169330.1|36625_36829_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000346360.1|37038_37842_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085949098.1|38417_39111_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	88.7	1.9e-120
WP_001398483.1|39883_41098_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000588734.1|41413_42274_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000762576.1|42715_43099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142434.1|43214_43562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001674494.1|43579_44170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|44465_46037_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|46056_46404_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|46403_47081_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
WP_001045016.1|47328_51423_-|protease	serine protease autotransporter toxin EatA	protease	Q9LA58	Enterobacterial_phage	39.5	1.0e-258
>prophage 2
NZ_CP023347	Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence	142368	54879	122492	142368	integrase,transposase	Stx2-converting_phage(40.0%)	58	90625:90684	114983:116937
WP_001744949.1|54879_56493_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	9.5e-176
WP_000624688.1|56523_56874_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_001403014.1|56870_57305_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000878037.1|59193_60213_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000739895.1|62160_62772_+	CS5 fimbrial major subunit CsfA	NA	NA	NA	NA	NA
WP_000699813.1|62829_63504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399372.1|63500_65945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000694232.1|65960_66572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399373.1|67074_67260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399374.1|67256_68378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126123792.1|70610_72188_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	7.1e-176
WP_000747007.1|72219_72570_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000978936.1|74349_76809_-	CS6 fimbrial biogenesis usher CssD	NA	NA	NA	NA	NA
WP_000837510.1|76765_77464_-	CS6 fimbrial biogenesis chaperone CssC	NA	NA	NA	NA	NA
WP_000913743.1|77516_78020_-	CS6 fimbrial subunit CssB	NA	NA	NA	NA	NA
WP_000750952.1|78037_78502_-	CS6 fimbrial subunit CssA	NA	NA	NA	NA	NA
WP_001665141.1|79073_79439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000780220.1|80993_81275_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	37.0	6.5e-08
WP_000493287.1|81255_81585_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_013188501.1|82573_82792_+	heat-stable enterotoxin ST-I group b	NA	NA	NA	NA	NA
WP_001218562.1|83756_84728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205720.1|84747_85494_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.5	9.3e-09
WP_000704522.1|85552_86413_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840464.1|86515_87076_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001297500.1|87206_87416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|87605_89177_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|89196_89544_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|89543_90221_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
90625:90684	attL	TGTCACGAACGGTGCAATAGTGATCCACACCCAACGCCTGAAATCAGATCCAGGGGGTAA	NA	NA	NA	NA
WP_001356151.1|90710_91733_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_001317493.1|91729_92512_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000612626.1|92733_93081_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099345.1|93814_94621_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.7	4.1e-55
WP_001159861.1|94621_94927_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813631.1|94928_95147_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001095858.1|95701_96391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001433458.1|96424_97114_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_001261281.1|97533_97764_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044769.1|97760_98177_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000115575.1|99934_101179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001399277.1|101197_101347_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	70.5	7.0e-09
WP_000593827.1|102219_102846_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	1.7e-19
WP_021018664.1|102838_103612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001399279.1|103568_104774_-	TolC family protein	NA	NA	NA	NA	NA
WP_000336105.1|104770_105910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071594470.1|106192_106543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095908834.1|107764_108978_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_000528933.1|110218_110719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998068.1|110763_112302_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.3	3.1e-293
WP_000612591.1|112351_112699_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|112695_113076_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001317493.1|113154_113937_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001356151.1|113933_114956_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.2	3.6e-197
WP_021018667.1|115698_117579_+	colicin IA	NA	NA	NA	NA	NA
114983:116937	attR	TTACCCCCTGGATCTGATTTCAGGCGTTGGGTGTGGATCACTATTGCACCGTTCGTGACACCTGTGGATAGCAAACTGGAACGAAACACGCTCACTGCTCTTCTGAATGTGGCCAGCTGGCTTAAAAGAAAGCCAGGTACGCCGGAATTAAGTCTGGAAAGGCCCCTGTTTGATACAGAAGTTTATGTTAATGGTGAAAAGAAATATGTCCTGCCGGATTTCATTGTCACAGCAAGGGCTCCTGACGGAAAGACGGCCAGAGTGCTCATCGAAACGATGGGATATGAAGACAGTGATTACTGCGCGAGAAAATCCAGGCAGCATACCGGCATGAAGCAGATTGGTGTTCTGCATACCGATCCACCGAAATGGCTGGATAACGATCATCCCCCTTTTGAGAAACATATGTACGGTGTTTTTATGCATCTCAGGTACTGAGATATTTTGTGGCTCAGTTCTGTAACTTTTCCCGTAACATTGTCTGTTGTTACGGGAAAGTCCGGTTTTTGTATTGCACCAGAGAATACTCAGACTGTGATGCTGCCACAGCGTCAGCAGGCTTTCTGAACGGTGTAACATCACTTCATGTTAATGATAATCACTATCATTAAATCTTGACATGCCATTTTCTCCTTAATAAATTAATACTGTATATGTATCCATATGCGTAAGCAGTTAATTCATTTGTTTTCCTCAGAGGATGAAGGAGATACCGAATGTCTGACCCTGTACGTATTACAAATCCCGGTGCAGAATCGCTGGGGTATGATTCAGATGGCCATGAAATTATGGCCGTTGATATTTATGTAAACCCTCCACGTGTCGATGTCTTTCATGGTACCCCGCCTGCATGGAGTTCCTTCGGGAACAAAACCATCTGGGGCGGAAACGAGTGGGTCGATGATTCCCCAACCCGAAGTGATATCGAAAAAAGGGACAAGGAAATCACAGCGTACAAAAACACGCTCAGCGCGCAGCAGAAAGAAAATGAGAATAAGCGCACTGAAGCCGGAAAAAGCCTCTCTGCGGCGATTGCTGCAAGGGAAAAAGATGAAAACACACTGAAAACACTCCGTGCCGGAAACGCAGATGCCGCTGATATTACACGACAGGAGTTCAGACTCCTGCAGGCAGAGCTGAGAGAATACGGATTCCGTACTGAAATCGCCGGATATGACGCCCTCCGGCTGCATACAGAGAGCCGGATGCTGTTTGCTGATGCTGATTCTCTTCGTATATCTCCCCGGGAGGCCAGGTCGTTAATCGAACAGGCTGAAAAACGGCAGAAGGATGCGCAGAACGCAGACAAGAAGGCCGCTGATATGCTTGCTGAATACGAGCGCAGAAAAGGTATTCTGGACACGCGGTTGTCAGAGCTGGAAAAAAATGGCGGGGCAGCCCTTGCCGTTCTTGATGCACAACAGGCCCGTCTGCTCGGGCAGCAGACACGGAATGACAGGGCCATTTCAGAGGCCCGGAATAAACTCAGTTCAGTGACGGAATCGCTTAACACGGCCCGTAATGCATTAACCAGAGCTGAACAACAGCTGACGCAACAGAAAAACACGCCTGACGGCAAAACGATAGTTTCCCCTGAAAAATTCCCGGGGCGTTCATCAACAAATCATTCTATTGTTGTGAGCGGTGATCCGAGATTTGCCGGTACGATAAAAATCACAACCAGCGCAGTCATCGATAACCGTGCAAACCTGAATTATCTTCTGACCCATTCCGGTCTGGATTATAAACGCAATATTCTGAATGACCGGAATCCGGTGGTGACAGAGGATGTGGAAGGTGACAAGAAAATTTATAATGCTGAAGTTGCTGAATGGGATAAGTTACGGCAACGATTGCTTGATGCCAGAAATAAAATCACCTCTGCTGAATCTGCGGTAAATTCGGCGAGAAATAACCTCAGTGCCAGAACAAATGAGCAAAAGCATGCAAATGAC	NA	NA	NA	NA
WP_001080730.1|117600_117936_-	colicin 1A immunity protein	NA	NA	NA	NA	NA
WP_000142443.1|118064_118412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398382.1|118896_119454_+	recombinase family protein	NA	NA	NA	NA	NA
WP_001239408.1|119484_121311_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.3	1.3e-16
WP_001398381.1|121469_122492_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP023347	Escherichia coli strain ETEC-2265 plasmid unnamed1, complete sequence	142368	131236	137583	142368	integrase,transposase	Stx2-converting_phage(50.0%)	8	118520:118534	139627:139641
118520:118534	attL	AAAAGACACCGTTTT	NA	NA	NA	NA
WP_000016490.1|131236_132034_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	2.5e-52
WP_000239529.1|132171_132447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633916.1|132440_133085_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	3.0e-40
WP_001103696.1|133313_134285_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	2.2e-66
WP_000340828.1|134289_134682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001745416.1|134967_136539_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	1.1e-168
WP_000624622.1|136558_136906_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001711999.1|136905_137583_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	5.6e-21
139627:139641	attR	AAAAGACACCGTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP023348	Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence	88757	39307	84959	88757	transposase	Stx2-converting_phage(42.86%)	54	NA	NA
WP_001398404.1|39307_39631_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.9	4.7e-26
WP_032144808.1|39852_40047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775238.1|40524_40686_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001399514.1|41054_41705_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.6	8.0e-17
WP_000624618.1|41704_42052_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381456.1|42071_43643_+|transposase	IS66-like element IS679 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	4.9e-169
WP_001398553.1|43916_44426_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	68.9	1.3e-57
WP_001404319.1|44425_45145_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845967.1|45141_45576_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_016607469.1|45630_47598_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.8	1.1e-19
WP_000005975.1|47658_47892_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_000290789.1|47948_48476_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	2.3e-46
WP_001297832.1|49313_49877_-	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.9	3.0e-20
WP_000170668.1|49923_51285_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|51336_51567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027519.1|52568_52760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271734.1|52756_53179_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_072105978.1|53225_53528_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001668315.1|54065_54836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126130113.1|54880_55435_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104871.1|55328_55550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086125.1|55550_56234_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_000219394.1|56930_57947_-|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
WP_001438601.1|58283_59186_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000774834.1|59609_60032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218105.1|60034_61015_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	5.5e-86
WP_157732294.1|61229_61337_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	57.6	3.3e-05
WP_000862856.1|61404_61623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103553.1|62610_63168_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000754127.1|63476_63767_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_000989040.1|63798_64725_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_001673832.1|64743_65451_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_001196880.1|65452_65980_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000181069.1|66312_66675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175572.1|66671_66863_-	DUF2164 family protein	NA	NA	NA	NA	NA
WP_000115001.1|67175_67685_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	8.8e-19
WP_000124089.1|68212_68578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398473.1|68584_69772_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000019162.1|69991_70264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398470.1|70578_71355_+	heat-labile enterotoxin LT subunit A	NA	A0A023W6A1	Vibrio_virus	79.8	4.2e-121
WP_024168673.1|71351_71726_+	heat-labile enterotoxin LT subunit B	NA	D1GID8	Vibrio_virus	81.5	4.4e-52
WP_000829597.1|72794_72986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|73638_74851_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000624622.1|76183_76531_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|76530_77208_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001398514.1|77986_78268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398513.1|78283_78679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000561970.1|78719_78926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398512.1|79116_79947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001657154.1|79959_80334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403858.1|80972_81977_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001339397.1|82343_83021_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|83020_83368_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001743889.1|83387_84959_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.9e-168
